CN103739685B - Transcription factor Csa5G157230 participating in regulation of synthesis of cucumber cucurbitacine C and application thereof - Google Patents
Transcription factor Csa5G157230 participating in regulation of synthesis of cucumber cucurbitacine C and application thereof Download PDFInfo
- Publication number
- CN103739685B CN103739685B CN201310701070.5A CN201310701070A CN103739685B CN 103739685 B CN103739685 B CN 103739685B CN 201310701070 A CN201310701070 A CN 201310701070A CN 103739685 B CN103739685 B CN 103739685B
- Authority
- CN
- China
- Prior art keywords
- gene
- cucumber
- synthesis
- bitterness
- transcription factor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8237—Externally regulated expression systems
- C12N15/8238—Externally regulated expression systems chemically inducible, e.g. tetracycline
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- General Chemical & Material Sciences (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Nutrition Science (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention provides a transcription factor Csa5G157230 participating in regulation of synthesis of cucumber cucurbitacine C and application thereof. The transcription factor is one of two bHLH transcription factors (Csa5G157230 and Csa5G156220) which are found in cucumber genome firstly and used for controlling synthesis of bitter taste; the two bHLH transcription factors are used for controlling the forming of the bitter taste in fruits and leaves respectively; simple crossing of yeast, a gel tissue system and instantaneous expression of tobacco prove that the two transcription factors can be combined to a bitter taste synthesis promoter region and used for activating transcription of a synthesis gene; meanwhile, the bitter taste characteristics of cucumber plants can be restored by expressing the corresponding transcription factors in the leaves or fruits of the cucumber free of bitter taste abundantly. The invention further discloses a molecular mechanism for forming bitter taste of cucumber and provides theoretical basis for breeding cucumber free of bitter taste and molecular assisted breeding goals.
Description
Technical field
The present invention relates to genetic engineering and biology field, specifically, are related to participate in regulation and control cucumber cucurbitacine C conjunction
Into transcription factor Csa5G157230 and its application.
Background technology
The bitterness of Fructus Cucumidis sativi is by caused by a class referred to as triterpenoid of cucurbitacin C.Cucurbitacin C is accumulated in cucumber fruits
The mouthfeel and quality of Fructus Cucumidis sativi can be had a strong impact on.The classical geneticses test of early stage finds the bitterness of Fructus Cucumidis sativi by two genes of Bi and Bt
Control.Research recently finds that a gene cluster by 8 genomic constitutions participates in synthesizing for Fructus Cucumidis sativi bitterness.Wherein Bi gene codes oxygen
Change squalene cyclase, it is catalyzed and generates 2 enol of calabash, be one of most critical in the first step of cucurbitacin C synthesis, and synthesis
Step.
Although having determined substantially the molecular mechanism of bitterness synthesis in Fructus Cucumidis sativi, regulate and control the molecular mechanism mesh that bitterness is formed
Front not clear, related synthetic gene is not cloned yet.
The content of the invention
It is an object of the invention to provide participating in transcription factor Csa5G157230 of regulation and control cucumber cucurbitacine C synthesis and its answering
With.
In order to realize the object of the invention, a kind of transcription factor of participation regulation and control cucumber cucurbitacine C synthesis of the present invention
Csa5G157230, its aminoacid sequence is as shown in SEQ ID No.4, or sequence Jing replaces, lacks or add one or several
The amino acids formed aminoacid sequence with equal function.
The present invention also provides the gene of coding transcription factor Csa5G157230, its nucleotide sequence such as SEQ ID
Shown in No.3.
The present invention also provides the carrier containing the coding transcription factor Csa5G157230 gene, engineering bacteria, host cell
And the plant of conversion.
The gene that coding transcription factor Csa5G157230 is also provided of the invention answering in the bitterness synthesis of regulation and control Fructus Cucumidis sativi
With.
The present invention also provides the gene of coding transcription factor Csa5G157230 in without bitterness Fructus Cucumidis sativi molecular breeding
Using.
The present invention also provides a kind of method of the transient expression gene in plant, using agriculture bacillus mediated method, will contain
There is the carrier for encoding the transcription factor Csa5G157230 gene to proceed to plant（Such as Nicotiana tabacum L.）In, obtain genes of interest a large amount of
Expression.
The present invention further provides for the primer pair of transcription factor Csa5G157230 gene described in PCR amplification codings, bag
Include forward primer 5 '-TGTATACAATCTCCATTCCCTTTTGA-3 ' and downstream primer 5 '-
TATTCCAAGTTAGTCAATTTATTCTGT-3′。
From Fructus Cucumidis sativi mutant of the blade without bitterness from Hunan（XY-3）, it is by bitterness Fructus Cucumidis sativi（XY-2）From
So it is mutated.In mutant XY-3, the expression of the bitterness synthetic gene for finding before is have detected, find bitterness synthesis base
Because expression of the cluster in mutant it is very low.Thus the gene for regulating and controlling bitterness synthesis in speculating the mutant may have occurred
Mutation.The genomic DNA of XY-2 and XY-3 is sequenced.By Comparative genomic strategy sequence, emphasis is found to be occurred in transcription
The internal modifications of the factor.By analysis, a SNP is found, positioned at the inside of this transcription factor of Csa5G156220.With reference to turn
Record group data, find the gene only great expression in blade.Expression of the gene in mutant XY-3 is detected further,
It was found that expression of the transcription factor in mutant is also greatly reduced.Moreover, it has been found that the adverse circumstance such as arid and ABA is processed and all may be used
So that the transcription factor and bitterness synthetic gene expression are raised, with very high concordance.Thus it is speculated that the mutation may cause
The transcription factor expression amount is reduced, so that synthetic gene expression is greatly reduced, has been ultimately resulted in blade and has been changed into not bitter from hardship.
In order to further verify, yeast one-hybrid and gel retardation assasy have been carried out, it was demonstrated that the transcription factor really can
It is attached to the promoter region of bitterness synthetic gene.Additionally, the promoter of bitterness synthetic gene is connected reporter gene also
（LUC）, activation of the transcription factor to promoter region is detected in Nicotiana tabacum L., it is found that it can activate the table of reporter gene
Reach.Due to stable Fructus Cucumidis sativi transformation system it is also immature, therefore, the present invention establishes cucumber cotyledons transient expression system, profit
With Agrobacterium by transcription factor import Fructus Cucumidis sativi XY-3 without without cotyledon in bitterness cotyledon, is detected after one week, find transcription factor and
Synthetic gene great expression, so as to cause cotyledon to become bitter by not bitter.Summary result of study, present invention firstly discovers that
Regulate and control the transcription factor of bitterness synthetic gene expression in blade.It is Bf by the unnamed gene, its table by regulation and control synthetic gene
Up to so as to further regulating and controlling the formation of blade bitterness.
Genetic analyses before find that cucumber fruits gene is by Bt Gene Handling.Due to wild cucumber fruits it is unusual
Hardship, therefore during Fructus Cucumidis sativi domestication, Bt genes necessarily there occurs mutation, cause cucumber fruits not bitter, the mutation is subject to artificial
Select and remain.In research before, 114 parts of Fructus Cucumidis sativi core germplasms materials are carried out with weight sequencing analysis, by biology
The region that the domestication of bioinformatics analysis Fructus Cucumidis sativi occurs, in conjunction with map based cloning, by the area of Bt gene mapping to No. 5 chromosome 442kb
In.There are 68 candidate genes in this interval.The transcript profile data of these genes are further analyzed, wherein Csa5G157230 is found
Only express in the fruit of raw cucumber out of office, do not express in cultivated cucumber fruit.And Csa5G157230 genes are found with simultaneously
The gene of regulation and control blade bitterness synthesis be homologous geness, be all bHLH class transcription factor.By detecting Csa5G157230 genes
The expression conditions for synthesizing Bi genes in different cucumber varieties and in Bt Gene segregation colony individuality with bitterness.It was found that it
Expression be proportionate with the content of bitter principle in fruit.That is the expression of Csa5G157230 genes is higher, then Bi genes
Expression is higher, so as to cucumber fruits are more bitter.According to these information, thus it is speculated that this gene is exactly probably Bt genes, it leads to
The bitterness synthesis crossed in the mechanism regulating cucumber fruits of similar Bf regulation and control bitterness synthesis.
Based on the research system reported before, such as yeast one-hybrid, gel blocking proves Csa5G157230 genes really
Can be with the expression of transcriptional activation bitterness synthetic gene.As stable Fructus Cucumidis sativi transformation system is also immature, therefore the present invention builds
Cucumber fruits transient expression system is found, using Agrobacterium by Csa5G157230 channel genes Xintai City close bur reality, after three weeks
The fruit of detection injection areas, finds Csa5G157230 genes and synthetic gene great expression, so as to cause fruit by not bitter change
Into hardship.Summary result of study, it is believed that Csa5G157230 genes are Bt genes.Its expression by regulation and control synthetic gene
So as to the formation of further regulating fruit bitterness.
Description of the drawings
Fig. 1 be in the embodiment of the present invention 1 XY-3 that is related to without bitterness mutant relevant information；Wherein, A is calabash in mutant
The relative concentration of Lu Su C, XY-2 are bitterness Fructus Cucumidis sativi；B is the expression of bitterness synthetic gene in mutant；C attaches most importance to being sequenced and sends out
The position being now mutated is located at the inside of Bf transcription factor.
Expression of the Fig. 2 for Csa5G156220 and bitterness synthetic gene after being processed with arid and ABA in the embodiment of the present invention 1
Situation.
Bt gene mapping is contaminated in No. 5 by Fig. 3 to combine map based cloning with bioinformatic analysis in the embodiment of the present invention 1
The situation of colour solid；Wherein, there are 67 candidate genes, their expression gradient colors in wild and cultivated cucumber fruit and blade
Distinguish, deeper to represent content higher.
Fig. 4 is to detect that bitterness is closed in different types of Fructus Cucumidis sativi and the individuality in Bt segregating populations in the embodiment of the present invention 1
Into the content of gene Bi, the expression of bitterness controlling gene Bt and cucurbitacin C.
Fig. 5 is to prove that Bf can be combined with yeast-one-hybrid system and Nicotiana tabacum L. transient expression system in the embodiment of the present invention 1
To in the promoter of bitterness synthetic gene, and activate downstream reporter gene transcription.
Fig. 6 is to prove that Bf can be incorporated into the startup of bitterness synthetic gene with gel blocking system in the embodiment of the present invention 1
On son.
Fig. 7 is to prove that Bt can be combined with yeast-one-hybrid system and Nicotiana tabacum L. transient expression system in the embodiment of the present invention 1
To in the promoter of bitterness synthetic gene, and activate downstream reporter gene transcription.
Fig. 8 is to prove that Bf can be incorporated into the startup of bitterness synthetic gene with gel blocking system in the embodiment of the present invention 1
On son.
Fig. 9 is respectively with blade and fruit transient expression system proving the biology of Bf and Bt in the embodiment of the present invention 2
Function, when causing bitterness synthetic gene Bt expression to raise after Bf or Bt expression, finally makes the content liter of bitter substance cucurbitacin C
It is high.
Specific embodiment
Following examples are used to illustrate the present invention, but are not limited to the scope of the present invention.If not specializing, embodiment
According to conventional laboratory conditions, such as Sambrook equimoleculars Cloning: A Laboratory Manual（Sambrook J&Russell DW,
Molecular cloning:a laboratory manual,2001）, or according to the condition of manufacturer's description suggestion.
The transcription factor of the regulation and control cucumber cucurbitacine C synthesis of embodiment 1 is excavated and is obtained
1st, the excavation of candidate gene
Fructus Cucumidis sativi mutant of the blade without bitterness is found that in Hunan（XY-3）, it is by bitterness Fructus Cucumidis sativi（XY-2）From
So it is mutated（Fig. 1, A）.In mutant XY-3, expression of the bitterness synthetic gene cluster in mutant is very low（Figure
1, B）, thus it is speculated that the gene for regulating and controlling bitterness synthesis in the mutant may have occurred mutation.By the genomic DNA of XY-2 and XY-3
Carry out sequence of resurveying.Using bioinformatic analysis, the internal modifications occurred in transcription factor are found.A SNP is found in the analysis,
Positioned at the inside of this transcription factor of Csa5G156220（Fig. 1, C）.The transcript profile data display gene big scale in blade
Reach, and expression of the transcription factor in mutant is also greatly reduced（Fig. 1, B）.Additionally, the adverse circumstance such as arid and ABA is processed all
Raise can the transcription factor and bitterness synthetic gene expression（Fig. 2）.Therefore, the transcription factor is classified as into candidate gene, is ordered
Entitled Bf.
Genetic analyses before find that cucumber fruits bitterness is by Bt Gene Handling.During Fructus Cucumidis sativi domestication, Bt genes
Mutation is necessarily there occurs, causes cucumber fruits not bitter.114 parts of Fructus Cucumidis sativi core germplasms materials are carried out with weight sequencing analysis, by life
The region that the domestication of thing bioinformatics analysis Fructus Cucumidis sativi occurs, in conjunction with map based cloning, by Bt gene mapping to No. 5 chromosome 442kb's
In interval.There are 68 candidate genes in this interval（Fig. 3）.The transcript profile data of these genes are further analyzed, is found wherein
Csa5G157230 is only expressed in the fruit of raw cucumber out of office, is not expressed in cultivated cucumber fruit（Fig. 3）.Detection
The gene that Csa5G157230 genes and bitterness synthesize Bi genes in different cucumber varieties and in Bt Gene segregation colony individuality
Expression.It was found that their expression is proportionate with the content of bitter principle in fruit（Fig. 4）.That is Csa5G157230 genes
Expression it is higher, then Bi gene expression amounts are higher, so as to cucumber fruits are more bitter.And Csa5G157230 genes are sent out with us
The gene of existing regulation and control blade bitterness synthesis is homologous geness, is all bHLH class transcription factor.According to these information, thus it is speculated that this
Gene is exactly probably Bt genes, and it regulates and controls the bitterness conjunction in the mechanism regulating cucumber fruits of bitterness synthesis by being similar to Bf
Into.
2nd, Fructus Cucumidis sativi Csa5G157230 gene functions checking
The cDNA library of cucumber leaves and fruit is prepared first, then enters performing PCR expansion using forward primer and reverse primer
Increase（Primer sequence is shown in Table 1）.
1 primer sequence of table（5′-3′）
| Csa5G156220-TVector-F | TCTCTTTCCTCTCTCATTACGGGTGA |
| Csa5G156220-TVector-R | CGCACATCAAGGCAATCAACTCG |
| Csa5G157230-TVector-R | TGTATACAATCTCCATTCCCTTTTGA |
| Csa5G157230-TVector-R | TATTCCAAGTTAGTCAATTTATTCTGT |
PCR reaction systems are calculated as with 20 μ L：1 μ L of 10-20ng/ μ L templates, 10pmol/ μ L are positive, each 1 μ L of reverse primer,
10mmol/L dNTP mix0.4 μ L, 0.5U/ μ L high-fidelities Taq archaeal dna polymerase 1 μ L, 10 × PCR reaction buffers, 2 μ L are remaining
Measure as water.
PCR reaction conditions are：94 DEG C 5 minutes；94 DEG C 20 seconds, 55 DEG C 20 seconds, 72 DEG C 1 point, 35 circulation；72 DEG C 10 points
Clock.
The fragment that amplification is obtained and T- carriers（TAKARA）Connection, sequencing are confirmed without mutation.Fructus Cucumidis sativi Csa5G157230
Shown in the nucleotide sequence SEQ ID No.3 of gene, the aminoacid sequence of its encoding proteins is as shown in SEQ ID No.4.
Prove that Bf can be attached to the promoter region of bitterness synthetic gene using yeast one-hybrid（Fig. 5, A）.Additionally, also
The promoter of bitterness synthetic gene is connected into reporter gene（LUC）, detect that transcription factor is swashed to promoter region in Nicotiana tabacum L.
Effect living, it is found that it can activate the expression of reporter gene（Fig. 5, B）.Subsequently, by gel retardation assasy also demonstrate Bf with
The interaction of promoter（Fig. 6）.Using identical experimental system, it was demonstrated that the interaction of Bt and bitterness synthetic gene promoter（Fig. 7 and
Fig. 8）.
Embodiment 2 synthesizes the function of transcription factor using agriculture bacillus mediated instant expression method access control Fructus Cucumidis sativi bitterness
As stable Fructus Cucumidis sativi transformation system is also immature, therefore cucumber cotyledons and fruit are established in the present embodiment
Transient expression system, further verifies the function of Bf and Bt.
By Csa5G156220（SEQ ID No.2）, Csa5G157230 genes（SEQ ID No.3）It is building up to binary vector
On pBIN-Plus.It is directed respectively in Agrobacterium EA105 using chemical conversion.Agrobacterium containing Csa5G156220 genes is trained
Support to OD600About 1.0, then OD is diluted to injection buffer600About 0.3 or so, with the syringe without syringe needle by Agrobacterium
The cucumber seedlings of injection 10 days or so.Blade is collected after one week, with the compound in methanol extraction blade, is then carried out
UPLC-Q-TOF（Agilent）Detection and the analysis of correlated expression amount.As a result as shown in Figure 9 A.Expression of the Bf genes in cotyledon is led
The expression of the gene of Bi is caused, so as to promote the synthesis of cucurbitacin C.
Using similar method, the Agrobacterium containing Csa5G157230 genes is cultivated to OD600About 1.0, then with note
Penetrate buffer and be diluted to OD600About 0.8 or so, Agrobacterium is injected the cucumber fruits of or so 2 each moons with the syringe with syringe needle
In.Fruit injection site is collected after three weeks, coherent detection is done.As a result as shown in Figure 9 B.Expression of the Bt genes in fruit causes
The expression of the gene of Bi, so as to promote the synthesis of cucurbitacin C.
Although above the present invention is described in detail with a general description of the specific embodiments,
On the basis of the present invention, it can be made some modifications or improvements, this will be apparent to those skilled in the art.Cause
This, these modifications or improvements, belong to the scope of protection of present invention without departing from theon the basis of the spirit of the present invention.
Claims (9)
1. transcription factor Csa5G157230 of regulation and control cucumber cucurbitacine C synthesis, its aminoacid sequence such as SEQ ID No.4 are participated in
It is shown.
2. the gene of transcription factor Csa5G157230 described in claim 1 is encoded.
3. gene as claimed in claim 2, it is characterised in that its nucleotide sequence is as shown in SEQ ID No.3.
4. the carrier containing gene described in Claims 2 or 3.
5. the engineering bacteria containing gene described in Claims 2 or 3.
6. application of the gene described in Claims 2 or 3 in the bitterness synthesis of regulation and control Fructus Cucumidis sativi.
7. application of the gene described in Claims 2 or 3 in without bitterness Fructus Cucumidis sativi molecular breeding.
8. a kind of method of the transient expression gene in plant, it is characterised in that using agriculture bacillus mediated method, will by right
Ask the carrier described in 4 to proceed in plant, obtain genes of interest great expression.
9. method according to claim 8, it is characterised in that the plant includes Fructus Cucumidis sativi, Nicotiana tabacum L..
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310701070.5A CN103739685B (en) | 2013-12-18 | 2013-12-18 | Transcription factor Csa5G157230 participating in regulation of synthesis of cucumber cucurbitacine C and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310701070.5A CN103739685B (en) | 2013-12-18 | 2013-12-18 | Transcription factor Csa5G157230 participating in regulation of synthesis of cucumber cucurbitacine C and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103739685A CN103739685A (en) | 2014-04-23 |
| CN103739685B true CN103739685B (en) | 2017-04-26 |
Family
ID=50496769
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310701070.5A Active CN103739685B (en) | 2013-12-18 | 2013-12-18 | Transcription factor Csa5G157230 participating in regulation of synthesis of cucumber cucurbitacine C and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103739685B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104357441B (en) * | 2014-10-10 | 2017-08-01 | 中国农业科学院蔬菜花卉研究所 | The SNP marker related to cucumber fruits bitter taste character and its application |
| CN106749572B (en) * | 2016-12-08 | 2019-11-12 | 中国农业科学院蔬菜花卉研究所 | Participate in the transcription factor and its application of regulation muskmelon bitter principle synthesis |
| CN106518994B (en) * | 2016-12-08 | 2019-05-24 | 中国农业科学院蔬菜花卉研究所 | Participate in the transcription factor and its application of regulation watermelon bitter principle synthesis |
| CN109183158B (en) * | 2018-08-31 | 2021-11-23 | 中国烟草总公司郑州烟草研究院 | Construction method of full-length transcription factor yeast single hybrid library |
| CN114805511B (en) * | 2022-03-21 | 2023-03-24 | 云南师范大学 | Transport protein of cucumber bitter substance cucurbitacin C and application thereof |
-
2013
- 2013-12-18 CN CN201310701070.5A patent/CN103739685B/en active Active
Non-Patent Citations (1)
| Title |
|---|
| The genome of the cucumber, Cucumis sativus L.;Sanwen Huang et al.;《nature genetics》;20091101;第41卷(第12期);1275-9 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103739685A (en) | 2014-04-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Duan et al. | Natural variation in the promoter of GSE5 contributes to grain size diversity in rice | |
| CN103739685B (en) | Transcription factor Csa5G157230 participating in regulation of synthesis of cucumber cucurbitacine C and application thereof | |
| CN110317829B (en) | Transcription factor participating in regulation and control of synthesis of muskmelon bitter principle and application thereof | |
| CN112375130B (en) | Corn ear length gene and molecular marker and application thereof | |
| Yang et al. | Distinct regulatory changes underlying differential expression of TEOSINTE BRANCHED1-CYCLOIDEA-PROLIFERATING CELL FACTOR genes associated with petal variations in zygomorphic flowers of Petrocosmea spp. of the family Gesneriaceae | |
| US20220396805A1 (en) | Dna sequence for regulating maize leaf angle, and mutant, molecular markers, detection primers, and use thereof | |
| CN107190092B (en) | Molecular marker, primer pair, molecular marker method and application for identifying flowering morning and evening of common head cabbage | |
| CN102432679B (en) | Rice extensin OsPEX1 and application thereof | |
| WO2022000835A1 (en) | Cloning and application of peanut flowering habit gene ahfh1 and allelic variation thereof | |
| CN103483435B (en) | Gene cluster participating in synthesis of cucumber cucurbitacine C and application thereof | |
| CN106399323A (en) | Paddy rice leaf color regulation and control gene YL1 and use thereof | |
| CN103755791B (en) | Participate in transcription factor Csa5G156220 and its application of regulation cucumber cucurbitacine C synthesis | |
| CN114181950B (en) | Gene for controlling plum blossom single and double valve characters, molecular marker and application thereof | |
| CN107574171B (en) | Corn salt-resistant major QTL and related gene, molecular marker and application thereof | |
| CN101413006B (en) | Drought-induced rice flower specific promoter and use thereof | |
| CN106518994B (en) | Participate in the transcription factor and its application of regulation watermelon bitter principle synthesis | |
| CN112210616B (en) | InDel molecular marker primer related to length traits of rice grains and application thereof | |
| Du et al. | De novo transcriptomic analysis to identify differentially expressed genes during the process of aerenchyma formation in Typha angustifolia leaves | |
| CN102876687A (en) | SM gene for regulating and controlling cotton trichome, and application thereof | |
| CN114230648B (en) | Application of rice gene PANDA in improving plant yield | |
| CN104031928A (en) | Rice root elongation control gene OsKASI and encoded protein | |
| CN111454973B (en) | Application of candidate gene of eggplant fruit color epistatic P gene locus | |
| CN101646773A (en) | Woody plants having improved growth characteristics and method for making the same | |
| CN117660489B (en) | Peanut seed coat color regulation related gene AhPSC1 and related application thereof | |
| CN105567856B (en) | A kind of genotype detection method of the fad2 genes of cabbage type rape |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |