CN103736103B - The application of antioncogene ATOH8 and encoding proteins thereof - Google Patents
The application of antioncogene ATOH8 and encoding proteins thereof Download PDFInfo
- Publication number
- CN103736103B CN103736103B CN201310741165.XA CN201310741165A CN103736103B CN 103736103 B CN103736103 B CN 103736103B CN 201310741165 A CN201310741165 A CN 201310741165A CN 103736103 B CN103736103 B CN 103736103B
- Authority
- CN
- China
- Prior art keywords
- atoh8
- cell
- tumor
- dna
- artificial sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0693—Tumour cells; Cancer cells
- C12N5/0695—Stem cells; Progenitor cells; Precursor cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
- C12N2506/30—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from cancer cells, e.g. reversion of tumour cells
Landscapes
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Developmental Biology & Embryology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses the application of antioncogene ATOH8 and encoding proteins thereof.Inventor has found a kind of new antioncogene ATOH8, show with external functional study analysis in body, in its generation in cancer, evolution, there is important function, ATOH8 can promote differentiation of stem cells and reduce cancer stem cell to the drug resistance of chemotherapeutics, further, the induction iPSCs formation that is expressed as of reticent ATOH8 provides new effective way.The present invention is that tumor disease provides new diagnosis, Therapeutic Method and medicine sorting platform.
Description
Technical field
The invention belongs to biological technical field, relate to the application of a kind of new antioncogene and encoding proteins thereof, particularly the application of antioncogene ATOH8 and encoding proteins thereof.
Background technology
Hepatocarcinoma is the fifth-largest cancer in the world, and it affects the life of people up to a million every year.The long-term surviving of operating method to liver cancer patient brings hope, but is only applicable to small part eligible patients.Hepatocarcinoma is diagnosed usually late, and there occurs metastasis and extension.For most of liver cancer patient, survival rate only has about about 6 months.For the patient of No operation indication, chemotherapy is main Therapeutic Method.And the chemotherapy the average survival time rate of hepatocarcinoma patient only has 4 months.Therefore, exploitation is biomarker diagnostic method more reliably, the target drug of more effective treatment and prognosis recovery by the urgent need to.
Scientist has provided existence and the importance thereof that a lot of conclusive evidence confirms tumor stem cell, and tumor stem cell and normal stem cell have a lot of similarity, has numerous identical surface marker, and all has the ability of self renewal and differentiation.In addition, tumor stem cell has very strong oncogenicity.To contribute to the more effective cancer diagnosis/treatment means of exploitation to the further understanding of tumor stem cell characteristic, therefore oncologist and scientists are devoted to mechanism and its Drug resistance of solution of studying hepatic carcinoma stem cell.Recently, the team that Hong Kong University Guan Xinyuan teaches has found the liver-cancer stem cell using CD133 as label in the world for the first time.Similar report is also successively found by other scientists and reports, as CD90 and CD24 is also found by the surface marker as liver-cancer stem cell.Nonetheless, so far the research of tumor stem cell surface marker is also known little about it.
The somatic cell that reprogrammed has been broken up becomes pluripotent stem cell and has great importance in the research in regenerative medicine field.2007 induced multi-potent stem cells (iPSC) discovery be in the research process of human diseases (comprising hereditary and the hepatocarcinoma of liver) revolutionary character progress.IPSCs to the method for hepatocyte directed differentiation also for tumor disease provides new research platform and medicine sorting platform.
Summary of the invention
The object of the present invention is to provide the application of a kind of new antioncogene ATOH8 (atonalhomolog8, atonality homology material 8) and encoding proteins thereof.The present invention have studied the expression characteristic of ATOH8 in tumor tissues particularly hepatocarcinoma and regulatory mechanism thereof, research ATOH8 New function and the new opplication of ATOH8 is provided.
The application of albumen in the medicine preparing Therapeutic cancer of ATOH8 gene and/or its coding, and as the application of the auxiliary diagnosis of cancer and/or the sensitivity Detection novel targets of Index for diagnosis.
The albumen of ATOH8 gene and/or its coding preparation have the growth of inhibition tumor cell, the migration of inhibition tumor cell, the Tumor formation of inhibition tumor cell and/or inducing apoptosis of tumour cell effect preparation in application.
The albumen of ATOH8 gene and/or its coding becomes the application in tumor stem cell in the non-tumor stem cell reprogrammed of induced cancer.
Preferably, described cancer is hepatocarcinoma.
The albumen of ATOH8 gene and/or its coding is preparing the application in induced multi-potent stem cells.
For a test kit for cancer diagnosis and/or Index for diagnosis, the PCR primer containing specific amplification ATOH8 gene DNA chain and/or its cDNA chain, or the antibody of anti-ATOH8 albumen.Preferably, described cancer is hepatocarcinoma.
Be used for the treatment of hepatocarcinoma cancer, suppress the growth of tumor cells of hepatocellular carcinoma, suppress the migration of tumor cells of hepatocellular carcinoma, the Tumor formation of suppression tumor cells of hepatocellular carcinoma and/or the pharmaceutical composition of induction tumor cells of hepatocellular carcinoma apoptosis, this pharmaceutical composition contains: the albumen of ATOH8 gene and/or its coding, and medically acceptable pharmaceutic adjuvant.
The invention has the beneficial effects as follows:
Inventor has found a kind of new antioncogene ATOH8 in tumor cells of hepatocellular carcinoma, find in 242 routine tissue of patient samples, ATOH8 in hepatocarcinoma patient more than 48% low expression, and with the problem significant correlation such as the low and relapse rate of the survival rate of primary hepatocarcinoma patient is high.In body and external functional study analysis shows, ATOH8 can suppress the growth of hepatoma carcinoma cell, migration and transfer.More infusive, ATOH8 can promote hepatoma cell apoptosis and increase the sensitivity of hepatoma carcinoma cell to chemotherapeutics.And, ATOH8 can suppress the expression of stem cell versatility gene and stem cell relevant biomarkers thing, these versatility genes keep at the embryonic stem cell of people having great importance in the process of its versatility, and inducing somatic reprogrammed can become induced multi-potent stem cells, further research confirms, ATOH8 is low expression in induced multi-potent stem cells.In sum, this research finds that ATOH8 is the important mortifier of stem cell related gene, in the generation, evolution of cancer, there is important function, ATOH8 can promote differentiation of stem cells and reduce cancer stem cell to the drug resistance of chemotherapeutics, and, the induction iPSCs formation that is expressed as of reticent ATOH8 provides new effective way, and the present invention is that tumor disease provides new diagnosis, Therapeutic Method and medicine sorting platform.
Accompanying drawing explanation
Fig. 1 shows RNA-seq high-flux sequence and analyzes the expression of ATOH8 in hepatocarcinoma patient cancer beside organism and cancerous tissue.
Fig. 2 shows the expression of ATOH8 in 242 routine hepatocarcinoma patient cancer beside organisms and cancerous tissue.
Fig. 3 shows the low expression of ATOH8 and the low dependency of hepatocarcinoma patient survival rate.
Fig. 4 shows the impact of ATOH8 on stem cell related gene expression.
The luciferase reporter gene detection method that shows Fig. 5 detects ATOH8 to the inhibitory action of stem cell related gene.
Fig. 6 shows electrophoretic mobility experimental result.
Fig. 7 shows the impact of ATOH8 process LAN on the growth of tumor cell, Clone formation, Colony forming, transfer ability.
Fig. 8 shows ATOH8 process LAN to the impact becoming tumor ability in the invasive ability of hepatoma carcinoma cell, body.
Fig. 9 shows reticent ATOH8 becomes hepatic carcinoma stem cell by the Common tumors cell reprogrammed of hepatocarcinoma.
Figure 10 shows reticent ATOH8 can promote that reprogramming of somatic cells becomes induced multi-potent stem cells.
Figure 11 shows ATOH8 and improves the sensitivity of hepatoma carcinoma cell for chemotherapeutics.
Detailed description of the invention
Below in conjunction with specific embodiment, set forth content of the present invention further.The experimental technique of unreceipted actual conditions in the following example, usually conveniently condition, e.g., " Molecular Cloning: A Laboratory guide " condition described in (third edition), or according to the condition that manufacturer advises.
Embodiment 1ATOH8 lowers at Expression In Hepatocellular Carcinoma
1.RNA-seq high-flux sequence
Carry out high-flux sequence by the RNA of the cancer beside organism of the cancerous tissue and correspondence thereof that extract 3 pairs of hepatocarcinoma patients, find ATOH8 whole low expression in the cancerous tissue of 3 couples of patients.Result is as shown in Figure 1: it is 41 that 448N (41) represents that 448 sample cancer beside organisms are measured reading in the sample; It is 1 that 448T (1) represents that 448 sample cancerous tissues are measured reading in the sample; It is 29 that 473N (29) represents that 473 sample cancer beside organisms are measured reading in the sample; It is 3 that 473T (3) represents that 473 sample cancerous tissues are measured reading in the sample; It is 39 that 510N (39) represents that 510 sample cancer beside organisms are measured reading in the sample; It is 3 that 510T (3) represents that 510 sample cancerous tissues are measured reading in the sample.
2.qRT-PCR detects the expression of ATOH8 in the clinical samples of hepatocarcinoma patient
Design qRT-PCR primer (primer sequence is SEQIDNO.5 and SEQIDNO.6 in table 2).According to the result of qRT-PCR, it is the low expression of ATOH8 that the definition expression of ATOH8 in cancer beside organism exceedes its expression 4 times in cancerous tissue.Result is presented in the cancerous tissue of 242 routine hepatocarcinoma patients more than 48% low expression (see Fig. 2).
3.ATOH8 is low, and expression has clinical meaning
Carry out statistical analysis discovery by SPSS, the clinical data of hepatocarcinoma patient and the ATOH8 expression in clinical sample, in, body low to the survival rate of hepatocarcinoma patient, AFP expresses low differentiation that is too high and hepatocarcinoma relevant (see Fig. 3 and table 1).
The correlation circumstance of table 1 clinical data and ATOH8 expression
apartial data cannot use, and adds up with available data;
bthe expression of ATOH8 in cancer beside organism exceedes its expression 4 in cancerous tissue and is doubly defined as the low expression of ATOH8;
*significant difference (P < 0.05).
Embodiment 2ATOH8 is to the inhibitory action of stem cell versatility gene
1, the cell strain of stable ATOH8 process LAN is built
Hepatoma cell strain Huh7 (Hokkaido, Japan university) and PLC8024 (Wuhan Virology Institute,Chinan academy of Sciences) is by DMEM culture medium (DMEM; GibcoBRL) hyclone (GibcoBRL) being aided with 10% is cultivated the CO2 gas incubator of 37 DEG C.
1. the expression plasmid of ATOH8 is built
With the cDNA full length sequence of pcr amplification ATOH8, primer sequence is as follows:
F：CGCAAATGGGCGGTAGGCGTG(SEQIDNO.1)；
R：ACCGAGGAGAGGGTTAGGGAT(SEQIDNO.2)。
The ATOH8 full length sequence of purification is building up to pLenti6/V5-
on expression vector (Invitrogen, K4950-00), obtain ATOH8 expression plasmid pLenti6-ATOH8.
2. transfecting hepatoma cells
Utilize Lipofectamine2000 (Invitrogen respectively, 11668) and the packaging plasmid (Invitrogen, K4975-00) optimized the pLenti6-ATOH8 obtained and pLenti6 empty carrier (pLenti6-vector) are in contrast proceeded to 293FT cell.And after 12 hours, change DMEM culture medium (DMEM; GibcoBRL) hyclone (GibcoBRL) of 10% is aided with.48 hours and 72 h before harvest slow virus supernatants, and transduction enters Huh7 and PLC8024 cell line.
With blasticidin S (6ug/mL; Sigma-aldrich) screening can obtain cell strain 8024-ATOH8 and Huh7-ATOH8 of stable ATOH8 process LAN for about 2 weeks, and compared with control cells strain is respectively 8024-Vec and Huh7-Vec.
2, the cell strain of stable ATOH8 silence is built
Hepatoma cell strain QSG7701 (Wuhan Virology Institute,Chinan academy of Sciences) is by DMEM culture medium (DMEM; GibcoBRL) hyclone (FBS) (GibcoBRL) that be aided with 10% cultivates the CO2 gas incubator of 37 DEG C.
With ATOH8-shRNA (sh4, the TGTGCTCAACCATCTGCTT (SEQIDNO.3) of specific stable expression; Sh7, GGTGCCGTGCTACTCATAT (SEQIDNO.4)) and negative control (psiHIV-Ct1) provided by GeneCopoeia company, utilize Lipofectamine2000 (Invitrogen, 11668) and optimize packaging plasmid (GeneCopoeia, HPK-LvTR) ATOH8-shRNA and psiHIV-Ct1 is in contrast proceeded to 293FT cell.And after 12 hours replaced medium DMEM culture medium (DMEM; GibcoBRL) hyclone (GibcoBRL) of 10% is aided with.48 hours and 72 h before harvest slow virus supernatants, and transduction enters QSG7701 cell line.
Transfection screened with the puromycin (OriGene) of 3 μ g/mL cell strain 7701-sh4,7701-sh7 of within about 2 weeks, obtaining stable ATOH8 silence after 48 hours, and compared with control cells strain 7701-Ct1.
3, the expression of stem cell related gene is detected
The total serum IgE of ATOH8 process LAN and reticent hepatoma carcinoma cell and compared with control cells thereof is extracted with TRIzol test kit (invitrogen).By test kit operating instruction, get 2 μ gRNA reverse transcription PCRs test kit (Clontech) and synthesize cDNA.The ABIPRISM7900HT quantitative real time PCR Instrument of cDNA its product American AB I company after pcr amplification detects in real time to ATOH8 gene transcription level and quantitatively.
The process LAN of result display ATOH8 can suppress the expression of stem cell related gene, as Sox2, Nanog, Oct4, AFP, CD133 and CD24 (Fig. 4 A).And the expression of reticent ATOH8 will promote the expression (see Fig. 4 B) of these stem cell related genes.
The primer that stem cell related gene expression detects is in table 2.
The primer that table 2 related gene expression detects
4, the method for luciferase reporter gene detection and electrophoretic mobility experiment (EMSA) is utilized to prove whether ATOH8 can be bundled on E-box and bHLHmotifs of the promoter region of stem cell related gene.
1. luciferase reporter gene detection method
The promoter sequence of cloning Oct4, Nanog and CD133 of about 2kb, on carrier pGL3-enhancervector (Promega, E1771), obtains pGL3-Otc4, pGL3-Nanog, pGL3-CD133.Cloning primer sequence is in table 3.The promoter of Oct4, Nanog and SOX2 that fluorescence mycin carrier builds is blended in by 10: 10: l, pLenti6-ATOH8 and renilla luciferase (Promega, E2241) enter Huh7 cell line with Lipofectamine2000 transfection according to operating instruction simultaneously.PGL3-ctl (pGL3-contro1) carrier (Promega, E1741) as the positive control of experiment, pGL3-enhancer carrier (Promega, E1771) is as the negative control of experiment, and renilla luciferase is as internal reference.And in transfection after 48 hours, test kit (Promega, E2920) microplate reader measures the expression of fluorescence mycin and the expression of internal reference renilla luciferase to utilize Dual-Luciferase to report.The promoter that result display ATOH8 acts on Oct4, Nanog and CDl33 suppresses the expression (as shown in Figure 5) of Oct4, Nanog and CDl33.
The promoter sequence of table 3Oct4, Nanog and CD133 builds primer
2. electrophoretic mobility experiment (EMSA)
The albumen be combined with DNA is extracted with nucbuster Protein Extraction Reagent kit (NucBusterTMProteinExactionKit, MERCK).With DIG-labeleddUTP (Roche) labeled nucleotide probe (probe sequence is in table 4), probe PCR purification kit (Qiagen) purification.The reaction of this combination is at non-denaturing polyacrylamide gel and is transferred on nylon membrane (AmershamPharmaciaBiotech), is detected the binding site of ATOH8 and Oct4 by cold competitive reaction.Complex UVcrosslinker toasts 3 minutes.Corresponding Protein-DNA mixtures is detected with fluorescence detection reagent kit (Roche) and BioMaxLightfilm (Kodak).
Table 4 probe sequence
The results show ATOH8 is combined the expression (see Fig. 6) suppressing Oct4 by the binding site on the promoter sequence of Oct4.
Embodiment 3ATOH8 is to the inhibitory action of the growth of hepatoma carcinoma cell, migration and transfer
In the present embodiment, experimental group cell used is PLC8024 and the Huh7 cell line (8024-ATOH8, Huh7-ATOH8) through the process LAN ATOH8 of pLenti6-ATOH8 process described in embodiment 2, and matched group cell used is PLC8024 and the Huh7 cell line (8024-Vec, Huh7-Vec) of empty vectors pLenti6-vector process.
1, cell growth assay
By the change of the cell growth rate of the content detection process LAN ATOH8 of XTT.Experimental implementation is carried out according to cell proliferation XTT test kit (Roche, Mannheim) description.Be summarized as follows: by experimental group cell or cellular control unit by 1 × 10
4individual/hole is inoculated in 24 well culture plates, adds every 24 hours the XTT labelling mixture that final concentration is 100 μ l0.3mg/mL in one group of cell, and cultivate after 4 hours and measure OD value by microplate reader (Tecan), this tests parallel repetition 3 times.Result shows that the process LAN of ATOH8 suppresses the growth (Fig. 7 A) of tumor cells of hepatocellular carcinoma.
2, colony formation
Experimental group cell or cellular control unit are inoculated in 6 orifice plates, every hole 1 × 10
3individual.After cellar culture 2 to 3 week, with Giemsa staining, counting Survival clone (> 50 cell/clones), this tests parallel repetition 3 times, calculating mean value and standard deviation.As seen in figure 7 c, display ATOH8 suppresses the clonality of hepatoma carcinoma cell to experimental result.
3, soft-fractrue rock mass experiment
Soft-fractrue rock mass experiment is the experiment without seating surface multiplication capacity of the detection cell that is most widely used.By 1 × 10
4individual experimental group cell or cellular control unit are seeded in the culture medium containing 0.4% agar respectively, and are laid on the culture medium curing gel containing 0.6% agar.Colonies numbers after 2 to 4 weeks, and calculate colony-forming efficiency (colony-forming efficiency=colony number/plant cell number × 100%), this tests parallel repetition 3 times.Result display ATOH8 suppresses the Colony forming ability (Fig. 7 B) (in Fig. 7, abscissa V represents matched group, and AT represents the strain of ATOH8 overexpressing cell) of hepatoma carcinoma cell.
4, scratch experiment
In order to prove the impact of ATOH8 on cell invasion ability, this experiment is used for reference cell in vitro and to be caused injury Healing Experiments model, utilizes classical cell scarification to measure the transfer movement characteristic of tumor cell.On the experimental group cultivated in vitro or matched group cell monolayer, cut is to wound, and cellar culture is by contrast experiment's group and matched group after 24 to 48 hours, and evaluate the effect that ATOH8 affects Nasopharyngeal neoplasms ability, this tests parallel repetition 3 times.Experiment shows that the process LAN of ATOH8 reduces the cell transfer ability (Fig. 7 D) of hepatoma carcinoma cell.
5, matrigel invasion experiment
ATOH8 is detected by matrigel invasion experiment the impact of cell invasion ability.By 5 × 10
4the cell of individual experimental group or matched group is inoculated in respectively containing serum-free medium and is coated with (BectonDickinsonLabware) in the upper room of BD matrigel, upper room is placed in the lower room containing complete medium, the all experimental implementation of cellar culture after 24 hours are carried out in strict accordance with test kit (BectonDickinsonLabware) description, counting enters the cell concentration of lower room, and this tests parallel repetition 3 times.Result shows that the process LAN of ATOH8 reduces the cell invasion ability (Fig. 8 A) of hepatoma carcinoma cell.
6, tumor formation in nude mice
By 1 × 10
6individual experimental group cell or cellular control unit are expelled to the left and right survey back of nude mice about 10 4 week ages respectively.The formation of tumor and the size of tumor in latter 2 months is injected in monitoring.The process LAN of experimental result display ATOH8 reduces the body interior one-tenth tumor ability (Fig. 8 B) of hepatoma carcinoma cell.
Conclusion:
The process LAN of ATOH8 significantly suppress the growth of hepatoma carcinoma cell, propagation, cell transfer and invasive ability; And the in vivo test of animal also demonstrate that the process LAN of ATOH8 obviously weakens the one-tenth tumor ability of hepatoma carcinoma cell.
The Common tumors cell reprogrammed of hepatocarcinoma is become hepatic carcinoma stem cell by the silence of embodiment 4ATOH8
1, ATOH8 silence promotes the quantity of liver-cancer stem cell labelling CD133 positive cell.
Expression due to reticent ATOH8 can promote the expression of liver-cancer stem cell labelling CD133, so we think that the silence of ATOH8 can improve the quantity of CD133 positive cell in hepatoma cell line.By the ratio of flow cytomery CD133 in the hepatoma cell line (QSG7701, Be17402, Huh7 and PLC8024) and matched group thereof of ATOH8 silence.Result of study display ATOH8 can significantly improve the quantity of CD133 positive cell in hepatoma cell line, and the process LAN of ATOH8 considerably reduces the quantity (Fig. 9 A) of CD133 positive cell simultaneously.Especially there is CD133 positive cell hardly in QSG7701 cell line, and the cell mass ratio of the CD133 positive is promoted to about 10% by the silence of ATOH8.In figure, red block diagram shATOH8 represents the cell strain of ATOH8 silence; Lycoperdon polymorphum Vitt block diagram+ATOH8 represents the cell strain of ATOH8 high expressed; Blue block diagram ct1 represents negative control.
The cell of the CD133 positive 2, induced by the silence of ATOH8 has and in stronger body with external becomes tumor ability.
We utilize the method for airflow classification to sub-elect the cell mass of the CD133 positive and CD133 feminine gender.Experimental result finds that the cell of these CD133 positives occurred by the induction of ATOH8 silence has stronger tumor and becomes tumor ability (Fig. 9 B-D).
The cell of the CD133 positive 3, induced by the silence of ATOH8 has the characteristic of tumor stem cell.
1. class stem cell spheres forms experiment and confirms that the cell of these CD133 positives has the ability (Fig. 9 E) of tumor stem cell self renewal.
2. utilize the cell mass of the short differentiation agent atRA process CD133 positive and CD133 feminine gender, and confirm that the CD133 positive has the ability (Fig. 9 F, G) of tumor stem cell differentiation by RT-PCR detection hepatocarcinoma differentiation associated gene albumin, CK8, CK18, AFP, NANOG and OCT4 etc. (amplimer is as shown in table 2).
3. the experiment of chemotherapeutics Drug resistance confirms that the cell of the CD133 positive has the ability (Fig. 9 H) of stronger anti-chemotherapeutics.
Conclusion:
Common tumor cells of hepatocellular carcinoma reprogrammed is become hepatic carcinoma stem cell by the silence of ATOH8, and these are had the characteristic of all tumor stem cells by the tumor stem cell of reprogrammed.
The silence of embodiment 5ATOH8 promotes that reprogramming of somatic cells becomes induced multi-potent stem cells
The silence expressed due to ATOH8 can improve the ratio of the CD133 positive cell with tumor stem cell characteristic, and this research thinks that the disappearance of ATOH8 or silence can improve the formation efficiency of induced multi-potent stem cells.
1, in the somatic cell in mature and stable induced multi-potent stem cells and source thereof, detect the expression of ATOH8.
The result display detected by RT-qPCR, ATOH8 remarkable low expression (Figure 10 A) in induced multi-potent stem cells in the somatic cell (A153, G2F1, hNF1, SF002) in 4 pairs of induced multi-potent stem cells and source thereof.
2, the silence of ATOH8 is for the impact of induced multi-potent stem cells reprogrammed process.
Simultaneously by reprogrammed 4 factor (SOX2, KLF4, OCT4 and c-MYC, be called for short SKOM) enter the epithelial fibroblast cells of people with the shRNA (sh4, sh7) of ATOH8 or the process LAN plasmid transfection of ATOH8, the silence of alkaline phosphatase staining result display ATOH8 can promote the efficiency (Figure 10 B) of induced multi-potent stem cells reprogrammed Clone formation, and process LAN ATOH8 can suppress the process (Figure 10 C) of reprogrammed.
Conclusion:
The silence of ATOH8 improves the efficiency of induced multi-potent stem cells reprogrammed Clone formation, and confirms that common tumor cells of hepatocellular carcinoma reprogrammed can be become hepatic carcinoma stem cell by the silence of ATOH8 from the side.And ATOH8 is a gene promoting cell differentiation, may be relevant to differentiation of stem cells.
Embodiment 6ATOH8 improves the sensitivity of hepatoma carcinoma cell for chemotherapeutics
Silence due to ATOH8 can improve the resistance of hepatoma cell line for chemotherapeutics, therefore ATOH8 improve hepatoma carcinoma cell for chemotherapeutics sensitivity in have very large meaning.
1, chemotherapeutics (the cis-pair of two chlorine platinum of ammonia and 5-fluorouracil) is utilized to process the strain of ATOH8 overexpressing cell.And use XTT cell growth assay, detect the impact of ATOH8 for the half-inhibition concentration (IC50) of chemotherapeutics.Result display ATOH8 significantly improves the sensitivity (Figure 11 A) of hepatoma cell strain for tumor chemotherapeutic drug.
2, liver in situ tumor model evaluation ATOH8 antitumous effect and chemotherapeutic sensitivity effect thereof is utilized.
In order to detect the inhibitory action of ATOH8 to hepatocarcinoma further, we simulate the naturally-occurring process of hepatocarcinoma better by carrying out tumor in situ inoculation to nude mice.The tumor that Huh7 inoculates is cut into 1mm by us
3fritter, and be embedded in the subcutaneous of different nude mice, wait to grow to about 1cm
3the tumor of homogeneous size carries out grouping experiment.First group of slow virus of only injecting in tumor with blank Vec; Second group of slow virus of only injecting in tumor with ATOH8 process LAN; In tumor, inject the slow virus with blank Ct1 along the two chlorine platinum (CDDP) of a pair of ammonia for 3rd group in nude mice abdominal cavity injection simultaneously; In tumor, inject the slow virus with ATOH8 process LAN for 4th group at nude mice abdominal cavity injection CDDP simultaneously; 5th group of slow virus of injecting in tumor nude mice abdominal cavity injects 5-fluorouracil (5-FU) while with blank Ct1; In tumor, inject the slow virus with ATOH8 process LAN for 6th group at nude mice abdominal cavity injection 5-FU simultaneously.Result display (Figure 11 B) only injection can reduce the speed of growth of tumor with the slow virus of ATOH8, and injects the apoptosis that significantly can promote tumor with the slow virus of ATOH8 and chemotherapeutics simultaneously.
Conclusion:
All confirm that ATOH8 can significantly improve the sensitivity of hepatoma carcinoma cell for chemotherapeutics with experiment in vitro in body, there is far-reaching clinical treatment meaning.
<110> Tumor Hospital Attached to Zhongshan Univ.
The application of <120> antioncogene ATOH8 and encoding proteins thereof
<130>
<160>40
<170>PatentInversion3.5
<210>1
<211>21
<212>DNA
<213> artificial sequence
<400>1
cgcaaatgggcggtaggcgtg21
<210>2
<211>21
<212>DNA
<213> artificial sequence
<400>2
accgaggagagggttagggat21
<210>3
<211>19
<212>DNA
<213> artificial sequence
<400>3
tgtgctcaaccatctgctt19
<210>4
<211>19
<212>DNA
<213> artificial sequence
<400>4
ggtgccgtgctactcatat19
<210>5
<211>20
<212>DNA
<213> artificial sequence
<400>5
caggtgccgtgctactcata20
<210>6
<211>20
<212>DNA
<213> artificial sequence
<400>6
agtcactccttgcgcttctt20
<210>7
<211>20
<212>DNA
<213> artificial sequence
<400>7
cgaccatctgccgctttgag20
<210>8
<211>20
<212>DNA
<213> artificial sequence
<400>8
ccccctgtcccccattccta20
<210>9
<211>19
<212>DNA
<213> artificial sequence
<400>9
tggacagttacgcgcacat19
<210>10
<211>21
<212>DNA
<213> artificial sequence
<400>10
cgagtaggacatgctgtaggt21
<210>11
<211>21
<212>DNA
<213> artificial sequence
<400>11
aaggtcccggtcaagaaacag21
<210>12
<211>20
<212>DNA
<213> artificial sequence
<400>12
cttctgcgtcacaccattgc20
<210>13
<211>23
<212>DNA
<213> artificial sequence
<400>13
agactgaaaaccctcttgaatgc23
<210>14
<211>21
<212>DNA
<213> artificial sequence
<400>14
gtcctcactgagttggcaaca21
<210>15
<211>21
<212>DNA
<213> artificial sequence
<400>15
gctcctacccacgcagattta21
<210>16
<211>22
<212>DNA
<213> artificial sequence
<400>16
tggtggcattagttggatttgg22
<210>17
<211>21
<212>DNA
<213> artificial sequence
<400>17
atcgctctcctgctaacagtc21
<210>18
<211>19
<212>DNA
<213> artificial sequence
<400>18
gcactgtgacgttctggga19
<210>19
<211>22
<212>DNA
<213> artificial sequence
<400>19
tggatgcagaacttgacaacgt22
<210>20
<211>23
<212>DNA
<213> artificial sequence
<400>20
atacctgctacgacagtcgtggt23
<210>21
<211>22
<212>DNA
<213> artificial sequence
<400>21
cagaagtcctacaaggtgtcca22
<210>22
<211>21
<212>DNA
<213> artificial sequence
<400>22
ctctggttgaccgtaactgcg21
<210>23
<211>22
<212>DNA
<213> artificial sequence
<400>23
tcgcaaatactgtggacaatgc22
<210>24
<211>21
<212>DNA
<213> artificial sequence
<400>24
ttggcgaggtcctgagatttg21
<210>25
<211>20
<212>DNA
<213> artificial sequence
<400>25
ctcttagctgagtgtcccgc20
<210>26
<211>20
<212>DNA
<213> artificial sequence
<400>26
ctgatcgtcttcgaacctcc20
<210>27
<211>28
<212>DNA
<213> artificial sequence
<400>27
ttcccccgggccccgcagagtcccttac28
<210>28
<211>31
<212>DNA
<213> artificial sequence
<400>28
gccgctcgaggcattggcaaatcaaaactgt31
<210>29
<211>28
<212>DNA
<213> artificial sequence
<400>29
aacccccgggcgaggatcaacccagccc28
<210>30
<211>30
<212>DNA
<213> artificial sequence
<400>30
gccgctcgagagtatcgggatgggaatgcc30
<210>31
<211>28
<212>DNA
<213> artificial sequence
<400>31
aacccccgggtctcctgtctcagcctcc28
<210>32
<211>28
<212>DNA
<213> artificial sequence
<400>32
gccgctcgagtccttcctattcccaaac28
<210>33
<211>50
<212>DNA
<213> artificial sequence
<400>33
aggctctgcacatcccagctgtctggaatcactcccacacctccatgttc50
<210>34
<211>50
<212>DNA
<213> artificial sequence
<400>34
aggctctgcacatccaagctgtctggaatcactcccacacctccatgttc50
<210>35
<211>34
<212>DNA
<213> artificial sequence
<400>35
ataagcacaatggccagctgctcccttatgcctt34
<210>36
<211>34
<212>DNA
<213> artificial sequence
<400>36
ataagcacaatggcaagccgctcccttatgcctt34
<210>37
<211>41
<212>DNA
<213> artificial sequence
<400>37
atgggtgtcccgtggccagctgtcttcatcttggtggcatc41
<210>38
<211>41
<212>DNA
<213> artificial sequence
<400>38
atgggtgtcccgtggcaagccgtcttcatcttggtggcatc41
<210>39
<211>48
<212>DNA
<213> artificial sequence
<400>39
gtctacaaggcagtggggttgcagctgtgttcacttctcggcctttaa48
<210>40
<211>48
<212>DNA
<213> artificial sequence
<400>40
gtctacaaggcagtggggttgaagccgtgttcacttctcggcctttaa48
Claims (4)
1.ATOH8 the application of albumen in the medicine preparing Hepatoma therapy of gene and/or its coding.
2., for a test kit for diagnosing cancer of liver and/or Index for diagnosis, described test kit contains: the PCR primer of specific amplification ATOH8 gene DNA chain and/or its cDNA chain, or the antibody of anti-ATOH8 albumen.
3. be used for the treatment of the pharmaceutical composition of hepatocarcinoma, this pharmaceutical composition contains: the albumen of ATOH8 gene and/or its coding, and medically acceptable pharmaceutic adjuvant.
The albumen of 4.ATOH8 gene and/or its coding is in the preparation auxiliary diagnosis of hepatocarcinoma and/or the application of Index for diagnosis test kit.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510929129.5A CN105420195B (en) | 2013-12-27 | 2013-12-27 | Tumor suppressor gene ATOH8 and its coding albumen are preparing the application in iPSC |
| CN201310741165.XA CN103736103B (en) | 2013-12-27 | 2013-12-27 | The application of antioncogene ATOH8 and encoding proteins thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310741165.XA CN103736103B (en) | 2013-12-27 | 2013-12-27 | The application of antioncogene ATOH8 and encoding proteins thereof |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510929129.5A Division CN105420195B (en) | 2013-12-27 | 2013-12-27 | Tumor suppressor gene ATOH8 and its coding albumen are preparing the application in iPSC |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103736103A CN103736103A (en) | 2014-04-23 |
| CN103736103B true CN103736103B (en) | 2016-02-17 |
Family
ID=50493215
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510929129.5A Active CN105420195B (en) | 2013-12-27 | 2013-12-27 | Tumor suppressor gene ATOH8 and its coding albumen are preparing the application in iPSC |
| CN201310741165.XA Active CN103736103B (en) | 2013-12-27 | 2013-12-27 | The application of antioncogene ATOH8 and encoding proteins thereof |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510929129.5A Active CN105420195B (en) | 2013-12-27 | 2013-12-27 | Tumor suppressor gene ATOH8 and its coding albumen are preparing the application in iPSC |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN105420195B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105435248B (en) * | 2015-12-09 | 2018-04-27 | 哈尔滨工业大学 | A kind of multi-functional bismuth selenide nano-complex, its preparation method and application |
| CN107557470A (en) * | 2017-10-12 | 2018-01-09 | 浙江大学 | A kind of detection method using people MUC13 as hepatocellular carcinoma specific markers |
| CN109536639B (en) * | 2018-11-22 | 2022-02-22 | 中山大学肿瘤防治中心（中山大学附属肿瘤医院、中山大学肿瘤研究所） | Application of EB virus latent membrane protein in preparation of nasopharyngeal carcinoma differentiation induction treatment diagnostic reagent |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130323835A1 (en) * | 2009-07-15 | 2013-12-05 | Zirus, Inc. | Mammalian Genes Involved in Infection |
| SG10201504220YA (en) * | 2010-06-02 | 2015-07-30 | Agency Science Tech & Res | Method for inducing pluripotency in human somatic cells with prdm14 or nfrkb |
-
2013
- 2013-12-27 CN CN201510929129.5A patent/CN105420195B/en active Active
- 2013-12-27 CN CN201310741165.XA patent/CN103736103B/en active Active
Non-Patent Citations (4)
| Title |
|---|
| Anaplastic oligodendrogliomas with 1p19q codeletion have a proneural gene expression profile;François Ducray等;《Molecular Cancer》;20080520;第7卷(第41期);1-17 * |
| Sequence and epigenetic determinants in the regulation of the Math6 gene by Neurogenin3;G. Pujadas 等;《Differentiation》;20110930;第82卷(第2期);66-76 * |
| The transcription factor ATOH8 is regulated by erythropoietic activity and regulates HAMP transcription and cellular pSMAD1,5,8 levels;Neeta Patel 等;《British Journal of Haematology》;20131116;第164卷;586-596 * |
| 胚胎发育基因Twist在宫颈癌中的研究进展;文丹 等;《蛇志》;20120430;第24卷(第4期);396-398 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105420195B (en) | 2019-05-21 |
| CN103736103A (en) | 2014-04-23 |
| CN105420195A (en) | 2016-03-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Liu et al. | IL-33/ST2 pathway contributes to metastasis of human colorectal cancer | |
| Ahmed et al. | Ovarian cancer stem cells: Molecular concepts and relevance as therapeutic targets | |
| Sato et al. | EGFR inhibitors prevent induction of cancer stem-like cells in esophageal squamous cell carcinoma by suppressing epithelial-mesenchymal transition | |
| Zhou et al. | miR-503 regulates metastatic function through Rho guanine nucleotide exchanger factor 19 in hepatocellular carcinoma | |
| Bao et al. | Targeting CSCs within the tumor microenvironment for cancer therapy: a potential role of mesenchymal stem cells | |
| EP2749568A1 (en) | Cell dna synthesis prevention and cell proliferation inhibition polypeptide and use thereof | |
| Li et al. | LncRNA‐MEG3 inhibits cell proliferation and invasion by modulating Bmi1/RNF2 in cholangiocarcinoma | |
| Deng et al. | Long non-coding RNA HOTTIP promotes tumor growth and inhibits cell apoptosis in lung cancer | |
| An et al. | The transcription factor Krüppel-like factor 5 promotes cell growth and metastasis via activating PI3K/AKT/Snail signaling in hepatocellular carcinoma | |
| CN105079821A (en) | Application of long noncoding RNA HNF1A-AS1 ((hepatocyte nuclear factor-1Alpha Antisense 1) in preparation of drugs for treating human malignant solid tumors | |
| CN103736103B (en) | The application of antioncogene ATOH8 and encoding proteins thereof | |
| Wang et al. | Exosomal‑miR‑10a derived from colorectal cancer cells suppresses migration of human lung fibroblasts, and expression of IL‑6, IL‑8 and IL‑1β | |
| Li et al. | Loss of periplakin expression is associated with the tumorigenesis of colorectal carcinoma | |
| Bai et al. | Up-regulation of long non-coding RNA LOXL1-AS1 functions as an oncogene in cervical squamous cell carcinoma by sponging miR-21 | |
| Shen et al. | LncRNA GASAL1 promotes hepatocellular carcinoma progression by up-regulating USP10-stabilized PCNA | |
| Liu et al. | FOXN2 suppresses the proliferation and invasion of human hepatocellular carcinoma cells. | |
| Luo et al. | MiR-22-3p regulates the proliferation and invasion of Wilms' tumor cells by targeting AKT3. | |
| Ma et al. | Oncosuppressive role of MicroRNA-205–3p in gastric cancer through inhibition of proliferation and induction of senescence: Oncosuppressive role of MicroRNA-205 in gastric cancer | |
| CN104774929A (en) | Applications of miR-455-3p in diagnosis, treatment and prognosis of esophageal squamous cancer | |
| CN104726584B (en) | Applications of the miR 425 in the diagnosis, treatment and prognosis of tumour | |
| CN116926193B (en) | Tumor immunotherapy prognosis evaluation preparation and application of ANO1 targeting agent in preparation of tumor prognosis improving medicine | |
| Wahbi et al. | Evaluation of in vitro and in vivo personalized cancer treatment assays for oral squamous cell carcinoma | |
| Fang et al. | hsa‑miR‑5580‑3p inhibits oral cancer cell viability, proliferation and migration by suppressing LAMC2 | |
| CN103003445A (en) | Method of determining the metastatic potential of a tumor | |
| Feng et al. | High expression of SDF‑1 and VEGF is associated with poor prognosis in patients with synovial sarcomas |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |