CN103720748A - Regulation and control of caulis spatholobi on hepcidin and application of caulis spatholobi - Google Patents
Regulation and control of caulis spatholobi on hepcidin and application of caulis spatholobi Download PDFInfo
- Publication number
- CN103720748A CN103720748A CN201210384580.XA CN201210384580A CN103720748A CN 103720748 A CN103720748 A CN 103720748A CN 201210384580 A CN201210384580 A CN 201210384580A CN 103720748 A CN103720748 A CN 103720748A
- Authority
- CN
- China
- Prior art keywords
- caulis spatholobi
- hepcidin
- purposes
- serum
- iron deficiency
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention relates to regulation and control of caulis spatholobi on hepcidin and application of caulis spatholobi. The technical scheme shows that caulis spatholobi or an extract thereof has extremely excellent effect on controlling relevant diseases caused by hepcidin hypersecretion; and by inhibiting expression of iron regulatory protein hepcidin, iron deficiency and other relevant diseases caused by overexpression of hepcidin are avoided.
Description
Technical field
The invention belongs to field of pharmacology; More specifically, the present invention relates to Caulis Spatholobi (Caulis Spatholobi) to the regulation and control of Hepcidin and application thereof.
Background technology
Ferrum is one of micro elements needed by human, and iron metabolism Balance disorders can cause iron deficiency or ferrum overload in body.The ferrum of hepatic secretion adjusts plain Hepcidin by controlling the absorption of ferrum and the balance that recycling maintains ferrum stable state in body.The low-level Hepcidin that genetic defect causes is key factor [the Weiss G.Genetic mechanisms and modifying factors in hereditary hemochromatosis.Nature Reviews Gastroenterology & Hepatology 2009 that development occurs primary hemochromatosis; 7:50-8]; And at intractable iron deficiency anemia (IRIDA) [Du X, She E, Gelbart T, et al.The serine protease TMPRSS6is required to sense iron deficiency.Science 2008; 320:1088 – 92; Finberg KE, Heeney MM, Campagna DR, et al.Mutations in TMPRS S6cause iron-refractory iron deficiency anemia (IRIDA) .Nat Genet 2008; 40:569-71] and chronic inflam matory anemia (ACI) [Roy CN, Andrews NC.Anemia of inflammation:the Hepcidin link.Curr Opin Hematol 2005; 12:107-11] in the high expressed of Hepcidin be disease treatment brings certain difficulty.
Therefore, regulate Hepcidin to express, all significant to the treatment of Iron metabolism disorder disease.
Summary of the invention
The object of the present invention is to provide Caulis Spatholobi (Caulis Spatholobi) to the regulation and control of Hepcidin and application thereof.
In a first aspect of the present invention, provide the purposes of a kind of Caulis Spatholobi (Caulis Spatholobi), for the preparation of the compositions of Hepcidin level and rising ferro concentration in serum in reduction body.
In a preference, described compositions is the disease for preventing, alleviate or treat iron deficiency disease or being pathological characters by Hepcidin supersecretion also.
Intractable iron deficiency anemia (IRIDA)), chronic inflam matory anemia (ACI), renal anemia in another preference, described iron deficiency disease comprises: iron deficiency anemia (comprising:.
In another preference, described iron deficiency disease is that Hepcidin crosses the iron deficiency disease that expression causes.
In another preference, described compositions also for:
Reduce gene---the expression of HAMP gene of coding Hepcidin; Or
Reduce the phosphorylation level of Smad albumen (being preferably Smad1/5/8 albumen);
Suppress the stimulation that BMP6 expresses Hepcidin; Or
Suppress the inducing action that IL-6 expresses Hepcidin.
In another preference, described compositions also for:
Rising Concentration of Serum Ferritin And; Or
Improve serum transferrin saturation.
In another preference, described Caulis Spatholobi is selected from lower group:
(a) Caulis Spatholobi medical material (being preferably the stem of Caulis Spatholobi (or being called rattan)) or its crushed products; Or
(b) water of Caulis Spatholobi or extractive with organic solvent.
In another preference, described Caulis Spatholobi medical material is the stem of Spatholobus suberectus Dunn.
In another preference, the water extract of described Caulis Spatholobi is prepared as follows:
By the Caulis Spatholobi medical material 1-10 hour that is soaked in water, boil rear decoction 1-5 hour, filter and collect medicinal liquid; Collecting medicinal residues repeats to decoct step 0-3 time; Merge medicinal liquid, concentrating under reduced pressure.
In another aspect of this invention, a kind of Chinese medicine preparation for reducing Hepcidin level in body and rising ferro concentration in serum is provided, it prepares by the following method: by the Caulis Spatholobi medical material 1-10 hour that is soaked in water, boil rear decoction 1-5 hour, filter and collect medicinal liquid; Collecting medicinal residues repeats to decoct step 0-3 time; Merge medicinal liquid, concentrating under reduced pressure.
In another aspect of this invention, provide a kind of method that reduces the interior Hepcidin level of body and rising ferro concentration in serum, comprise step: the Caulis Spatholobi of using effective dose to the object of needs.
Other side of the present invention, due to disclosure herein, is apparent to those skilled in the art.
Accompanying drawing explanation
Fig. 1, Caulis Spatholobi decocting liquid vitro inhibition HAMP express.
(A) 16 kinds of Chinese herbs impact on Bel7402 Huh7 cell Hepcidin mrna expression.Drug level 20 μ g/mL, be 12 hours action time.Wherein the effect of Caulis Spatholobi decocting liquid inhibition HAMP gene is the most obvious, and expression is only 40% of matched group.
(B) Caulis Spatholobi decocting liquid suppresses the mass action curve that HepG2 cell Hepcidin expresses, and drug treating time is 12 hours.
(C) Caulis Spatholobi decocting liquid suppresses the time effect curve that HepG2 cell Hepcidin expresses, and drug level is 200 μ g/mL.
(D), in HepG2 cell, variable concentrations Caulis Spatholobi decocting liquid suppresses pSmad1/5/8 albumen Western blot result and quantitative analysis.
The HepG2 cell HAMP that Fig. 2, Caulis Spatholobi decocting liquid suppress BMP6 induction expresses.
(A) Caulis Spatholobi decocting liquid (20-400 μ g/mL) suppresses the Hepcidin mrna expression (0 point) of BMP6 (10ng/mL, 12 hours) induction.
(B) Western Blot analyzes phosphorylated protein Smad1/5/8 expression and quantitative.
The HepG2 cell HAMP that Fig. 3, Caulis Spatholobi decocting liquid suppress IL-6 induction expresses.
(A) IL-6 (50ng/mL) or BMP6 (10ng/mL) individual processing are after 6 hours, and Hepcidin mrna expression amount raises respectively 2 times and 7 times; After 12 hours, IL-6 processed group Hepcidin mrna expression amount drops to 0.8 times of Normal group with Caulis Spatholobi water decoction (200 μ g/mL) effect, and BMP6 is reduced to 0.25 times.Caulis Spatholobi water decoction is better than IL-6 to the inhibitory action of BMP6.
(B) Western blot analyzes pSmad1/5/8 and phosphorylation Stat3.
(C) quantitative analysis pSmad1/5/8 protein expression level.
(D) quantitative analysis phosphorylation Stat3 protein expression level.
Fig. 4, Caulis Spatholobi decocting liquid suppress HAMP1 gene expression and the mobilization of increase ferrum in Mice Body.
(A) C57BL/6 mouse liver Hepcidin mrna expression amount (Caulis Spatholobi dosage 21.6g/Kg feedstuff), the last taking medicine the 5th day, Hepcidin expression obviously reduced (P<0.05), within 10-15 days, progressively returned to normal.
(B) ferro concentration in serum raises: within the 5th day, be increased to 2 times of normal group, be subsequently slow decreasing trend, more still have significant difference (P<0.05) with matched group.
(C) hepatic tissue iron content reduces: every group of decline of administration group surpasses 10 μ g/g, relatively has statistical significance (P<0.05) with matched group.
(D) spleen tissues: have no significant change trend.
Fig. 5, Caulis Spatholobi water decoction reduce human serum Hepcidin level.
(A) serum Hepcidin content: round dot represents healthy volunteer, square frame or triangle represent IDA patient.Take after Caulis Spatholobi the 5th day, serum Hepcidin significantly declines (P<0.01), on the rise subsequently, but still lower than (P<0.05) before taking medicine.
(B) ferro concentration in serum.
(C) serum transferrin saturation.
(D) serum ferritin: 3 healthy volunteers raise obviously, and 5 IDA patients have no significant change.
The specific embodiment
Can lead anemogenic factor a lot, comprise malnutrition, infection, genetic defect etc. factor.Wherein, the anemia that chronic inflammatory disease, haemolysis, hematopoietic disorder, iron deficiency, shortage folic acid/vitamin B12 etc. cause is comparatively common.Iron deficiency anemia is a class of anemia.
The inventor is through research for a long time and widely, by finding that based on cell line selection and by animal, human experimentation Caulis Spatholobi (stem of Spatholobus suberectus Dunn) (or its extract) has extremely excellent effect for control iron deficiency relevant disease, and without any side effect.Described Caulis Spatholobi can suppress the expression that ferrum is adjusted albumen Hepcidin, thereby can avoid expressing because Hepcidin crosses the iron deficiency disease causing.Based on this, completed the present invention.
Caulis Spatholobi (Caulis Spatholobi) or its extract
Caulis Spatholobi: the plant that is Dicotyledoneae, bean order, pulse family, Millettia.Peel of stem fiber can be made the raw material of synthetic cotton, papermaking and braiding; Rattan hyoscine, the effectiveness of have circulation of qi promoting, Fufeng, invigorating blood circulation; Root is used as medicine, and has the function of relaxing muscles and tendons to promote blood circulation, also has the effect of parasite killing.Rattan and root are containing phenolic constituent, aminoacid, saccharide, resin.
As optimal way of the present invention, described Caulis Spatholobi is: the stem of Caulis Spatholobi (or being called rattan).
Term " compositions of the present invention " refers to the compositions that contains Caulis Spatholobi or its extract or the compositions being substantially comprised of Caulis Spatholobi or its extract.Described extract includes but not limited to: water extract or aqueous organic solvent; Be preferably water extract.
As used herein, described " aqueous organic solvent " refers to conventional for extract the water-soluble solvent of active component from Chinese medicine, and it is safety or does not have virose.For example, described " aqueous organic solvent " is selected from alcohols or ketone, as ethanol, methanol, acetone etc.
As optimal way of the present invention, the water extract of described Caulis Spatholobi is prepared as follows: by the Caulis Spatholobi medical material 1-10 hour that is soaked in water, boil rear decoction 1-5 hour, filter and collect medicinal liquid; Collecting medicinal residues repeats to decoct step 0-3 time; Merge medicinal liquid, concentrating under reduced pressure.
Purposes
In order to prove the purposes of Caulis Spatholobi, the inventor has screened 16 kinds of Chinese herbal medicine, finds that Caulis Spatholobi decocting liquid obviously suppresses the expression of hepatoma cell line Hepcidin in vitro by reducing the phosphorylation of pSmad1/5/8 signal path.Further animal experiment confirms, when Caulis Spatholobi decocting liquid suppresses liver Hepcidin expression, can reduce liver iron, increases Peripheral Blood concentration of iron.In healthy volunteer, Caulis Spatholobi decocting liquid can increase serum levels of iron, Concentration of Serum Ferritin And and improve transferrins saturation, thereby improves iron metabolism.These results, for Caulis Spatholobi treatment Hepcidin rising disease provides theoretical foundation, have also started and take the Chinese herbal treatment method that Hepcidin is target spot simultaneously.
It is the hormone of iron balance in a kind of control agent that ferrum is adjusted albumen Hepcidin, and it is maintaining ferrum important role stable equilibrium.Hepcidin is by liver specific expression, and by with iron transfer albumen (Ferroportin) combination, induce it that thereby transhipment that degraded reduces ferrum occurs, and finally realize the adjusting that the macrophage ferrum of ferrum in intestinal absorption or liver, spleen and bone marrow discharges.The generation of Hepcidin and chronic inflam matory anemia (wherein Hepcidin abnormal expression raises), intractable iron deficiency anemia (wherein Hepcidin abnormal expression raises), renal anemia (wherein Hepcidin abnormal expression raises) is closely related.
Anemia of chronic disease is a kind of Iron metabolism disorder disease causing under long-term inflammatory conditions due to body.This sick cause of disease is that the inflammatory factor in body raises Hepcidin expression.Hepcidin is considered to regulate the hormone of iron metabolism, and it acts on iron transfer albumen (Ferroporlin), makes the degraded of the latter's endocytosis, has reduced the interior ferrum of small intestine cells to sanguimotor transhipment, and then has affected ferrum absorption.High inflammatory factor state during chronic disease can promote hepatocyte high expressed Hepcidin, the Iron metabolism disorder while causing anemia of chronic disease by JAK2/STAT3 approach.
The invention provides the purposes of the extract of Caulis Spatholobi or Caulis Spatholobi, for the preparation of the compositions that reduces Hepcidin; Or, for the preparation of the compositions of prevention, alleviation or treatment iron deficiency disease.Intractable iron deficiency anemia (IRIDA)), ACD, chronic inflam matory anemia (ACI), renal anemia described iron deficiency disease comprises: iron deficiency anemia (comprising:.
Compositions
As used herein, term " compositions of the present invention " comprises pharmaceutical composition and dietary supplement (as Halth-care composition), as long as they contain Caulis Spatholobi or its extract as the active component that improves ferro concentration in serum.
Conventionally, described dietary supplement, containing 1-60wt%, is preferably Caulis Spatholobi or its extract of 9-30wt%; (b) acceptable carrier or excipient on food.
The present invention also provides a kind of pharmaceutical composition, contains: (a) Caulis Spatholobi of effective dose (as 0.0001-50wt%) or its extract; And (b) pharmaceutically acceptable carrier or excipient.
In the present invention, term " contains " and represents that various compositions can be applied in mixture of the present invention or compositions together.Therefore, term " mainly by ... form " and " by ... composition " be included in during term " contains ".
In the present invention, " pharmaceutically acceptable " composition is to be applicable to people and/or animal and the material that has rational benefit/risk ratio without excessive bad side reaction (as toxicity, stimulation and allergy).
As used herein, term " pharmaceutically acceptable carrier " refers to be used for the treatment of the carrier of agent administration, comprises various excipient and diluent.This term refers to some medicament carriers like this: they itself are not necessary active component, and after using, there is no undue toxicity.Suitable carrier is well known to those of ordinary skill in the art.In Remington ' s Pharmaceutical Sciences (Mack Pub.Co., N.J.1991), can find the abundant description about pharmaceutically acceptable excipient.On combination of Chinese medicine is learned, acceptable carrier can contain liquid, as water, saline, glycerol and ethanol.In addition, in these carriers, also may there is complementary material, as filler, lubricant, fluidizer, wetting agent or emulsifying agent, correctives, pH buffer substance etc.
From being easy to the position of preparation and administration, preferred pharmaceutical composition is solid-state composition, especially the capsule of tablet and solid-filling or liquid filling.The oral administration of pharmaceutical composition is preferred.
The dosage form of pharmaceutical composition of the present invention can be diversified, so long as the dosage form that can make active component effectively arrive in mammalian body is all fine.Such as being selected from: tablet, capsule, powder, granule, syrup, solution, suspension or aerosol.Wherein Caulis Spatholobi or its extract may reside in the carrier or diluent of suitable solid or liquid.
Caulis Spatholobi of the present invention or its extract also can be stored in the disinfector that is suitable for injection or instils.Conventionally, in pharmaceutical composition of the present invention, active constituents in vine stem of Spatholobus suberectus accounts for the 1-60wt% of gross weight, is preferably 9-30wt%, and all the other are the materials such as pharmaceutically acceptable carrier and other additive.
Administering mode and dosage form
Pharmaceutical composition of the present invention can be made by conventional method the dosage form of any routine.
Conventionally; when described Caulis Spatholobi or its extract are during for such use; they can with one or more pharmaceutically acceptable carrier or mixed with excipients; as solvent, diluent etc.; and can be with following form oral administration: tablet, capsule, dispersible powder, granule or suspension (containing 0.05-5% suspending agent according to appointment), syrup (containing 10-50% sugar according to appointment) and elixir (containing having an appointment 20-50% ethanol), or carry out parenteral administration with sterile injectable solution or form of suspension (containing the 0.05-5% suspending agent of having an appointment waiting in oozing medium).For example, these pharmaceutical preparatioies can contain the approximately 1-60wt% mixing with carrier, are conventionally about the active component of 9-30wt%.
The effective dose of active component used can change with the order of severity of the pattern of medicine used, administration and disease to be treated.Yet, conventionally, when Caulis Spatholobi of the present invention or its extract every day give with the dosage of about 0.0001-100mg/kg the weight of animals, can obtain gratifying effect, preferably with the dosage separating for 1-3 time, give every day, or with slow release form administration.For most of large mammal, the accumulated dose of every day is about 0.01-1000mg, is preferably about 1-500mg.Be applicable to dosage form for oral administration, comprise Caulis Spatholobi or its extract with solid-state or the intimately mixed about 1-200mg of liquid pharmaceutically acceptable carrier.This dosage of scalable is to provide optimal treatment to reply.For example, an urgent demand by treatment situation, can give the dosage that several times separate every day, or dosage is reduced pari passu.
Described Caulis Spatholobi or its extract can be by oral and intravenous, intramuscular or the administrations such as subcutaneous; Oral administration preferably.Solid-state carrier comprises: starch, lactose, dicalcium phosphate, microcrystalline Cellulose, sucrose and kaolin, and liquid carrier comprises: sterilized water, Polyethylene Glycol, nonionic surfactant and edible oil (as Semen Maydis oil, Oleum Arachidis hypogaeae semen and Oleum sesami), as long as be applicable to the characteristic of active component and required specific administration mode.In pharmaceutical compositions, normally used adjuvant also can advantageously be included, and for example flavoring agent, pigment, antiseptic and antioxidant are as vitamin E, vitamin C, BHT and BHA.
Described Caulis Spatholobi or its extract also can parenteral or intraperitoneal administrations.Also can in glycerol, liquid, Polyethylene Glycol and the mixture in oil thereof, prepare dispersion liquid.Under conventional storage and service condition, in these preparations, contain antiseptic to prevent microbial growth.
The medicament forms that is adapted to injection comprises: aseptic aqueous solution or dispersion liquid and aseptic powder (for prepare aseptic injectable solution or dispersion liquid temporarily).In all situations, these forms must be aseptic and must be that fluid is discharged fluid to be easy to syringe.Under manufacture and condition of storage, must be stable, and must be able to prevent the pollution effect of microorganism (as antibacterial and fungus).Carrier can be solvent or disperse medium, wherein contains just like water, alcohol (as glycerol, propylene glycol and liquid polyethylene glycol), their suitable mixture and vegetable oil.
Caulis Spatholobi or its extract also can with other active component or medication combined administration.
When two or more medication combined administration, generally have and be better than two kinds of medicines individually dosed effects respectively.
Major advantage of the present invention is:
(1) action target spot of having found first Caulis Spatholobi is that ferrum is adjusted albumen Hepcidin, and it has extremely excellent effect for control iron deficiency relevant disease, and without any side effect.Caulis Spatholobi pharmacological action is strong, has fabulous prospect in medicine.
(2) can from plant, obtain Caulis Spatholobi extract, in, taking convenience low in toxicity, also thering is source abundant, cheap, the simple advantage of preparation technology.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment are only not used in and limit the scope of the invention for the present invention is described.The experimental technique of unreceipted actual conditions in the following example, writes molecular cloning experiment guide, the third edition, Science Press, the condition described in 2002, or the condition of advising according to manufacturer conventionally as J. Pehanorm Brooker etc. according to normal condition.Unless otherwise indicated, otherwise percentage ratio and umber calculate by weight.
Unless otherwise defined, the same meaning that all specialties of using in literary composition and scientific words and one skilled in the art are familiar.In addition, any method similar or impartial to described content and material all can be applicable in the present invention.The use that better implementation method described in literary composition and material only present a demonstration.
I. materials and methods
1, the preparation of Chinese crude drug water decoction
All Chinese crude drugs are all purchased from Shanghai Wan Shicheng traditional Chinese medicines Products Co., Ltd (2010), and the place of production and medicinal part refer to table 1.Accurately take various Chinese crude drug 20g, distilled water 1L soaking at room temperature medical material 2h, big fire is boiled rear little fire and is decocted 2h, filters and collects medicinal liquid, injects 1L distilled water in medicinal residues, continues to decoct 2h, filters and collects medicinal liquid.The medicinal liquid of twice collection is merged, be evaporated to 40g/L (being equivalent to 0.04 gram of every milliliter contained) concentration.Before using, through 0.22 μ m pin hole filter (Μ illpore), filter.
The title of table 1, Chinese crude drug, the place of production and agents area
2, cell strain
Human hepatoma cell strain Huh7 and HepG2 are available from ATCC.Condition of culture: containing the DMEM high glycoform culture medium (GIBCO) of 10% (v/v) FBS (GIBCO), 37 ℃, 5% (v/v) CO
2saturated humidity incubator.
3, CCK-8 cell toxicity test
Cell Counting Kit 8 (CCK-8) cell counting detection kit is provided by Dojindo company.(contained cell quantity is 1 * 10 in 96 orifice plates, to add the cell suspension of 100 μ l
5individual).By culture plate incubator preculture 24 hours (at 37 ℃, 5% (v/v) CO
2condition under).To every hole, add the test substance of 10 μ l variable concentrations.Culture plate is hatched in incubator to one section of reasonable time (for example: 6,12,24 or 48 hours).To every hole, add 10 μ l CCK-8 solution, continue to cultivate after 1-4 hour, by microplate reader, measure the absorbance at 450nm place.
4, laboratory animal
7 week age, SPF level C57BL/6 female mice was purchased from Shanghai Slac Experimental Animal Co., Ltd., and SPF environment is raised.Normal feedstuff AIN-76A (iron content 0.9mg/Kg, Research Diets, Inc) adapted to nursing after one week, and by body weight random packet, 8 every group, matched group and experimental group are distinguished feed normal feedstuff and contained the mixed fodder of Caulis Spatholobi crude drug 21.6g/Kg.Respectively at the 0th, 5,10,15 days, after the intraperitoneal anesthesia of 5% (w/v) chloral hydrate, heart blood sampling (separation of serum in time), and collect liver spleen tissue (liquid nitrogen preservation).
Caulis Spatholobi crude drug: purchased from Shanghai Wan Shicheng pharmaceutcal corporation, Ltd, lot number 20100311.
5, RNA extracts and Realtime-PCR
Trizol (Life Technologies) method is extracted the RNA of cell and tissue, and concrete operations by specification carries out.On Nanodrop 1000Spectrophotometer, detect RNA purity (OD260/OD280 ≈ 1.9-2.1) and RNA concentration (ng/ μ l), adjust RNA concentration to 1 μ g/ μ l.2.0 μ gRNA are after DNase (Promega) processes, and M-MLV reverse transcription (Promega) and Oligo (dT) 18 primers (Takara Bio Inc.) carry out reverse transcription.In CFX96Real-Time System (Bio-Rad), carry out Realtime PCR, detection volume is 10ul, and reagent adopts iQ SYBR Green Supermix (Bio-Rad), and primer sequence is as follows:
HAMP：
Forward: CAGCTGGATGCCCATGTTC;
Reverse: CAGCAGCCGCAGCAGAA;
GAPDH：
Forward: CATGAGAAGTATGACAACAGCCT;
Reverse: AGTCCTTCCACGATACCAAAGT;
Mice Hamp1:
Forward: GCACCACCTATCTCCATCAACA;
Reverse: TTCTTCCCCGTGCAAAGG;
Mice Actb (β-actin):
Forward: AAATCGTGCGTGACATCAAAGA;
Reverse: GCCATCTCCTGCTCGAAGTC.
6、Western?blot
With after the RIPA lysate that contains PMSF (Sigma-Aldrich) and inhibitors of phosphatases (PhosSTOP, Roche) (green skies biotechnology research institute) cell lysis or tissue, extract total protein.Cell protein is got 30ug, and hepatic tissue albumen is got 100ug, after 10%SDS-PAGE gel electrophoresis, is transferred to pvdf membrane, 4 ℃ of overnight incubation of this film and specific antibody.Wash 3 times, resist (anti-rabbit or anti-mouse IgG 1:4000, Proteintech Group) incubated at room after 1 hour with two of peroxidase labelling, Westernblot test kit (ECL system, Pierce, Thermo Scientific) colour developing.Primary antibodie used is as follows: Rabbit anti-pSmad1/5/8antibody (1:1000; Cell Signaling Technology), Rabbit anti-Smad1antibody (1:1000; Cell Signaling Technology), Rabbit anti-pStat3antibody (1:1000; Cell Signaling Technology) and Mouse anti-β-actin (1:2000; Sigma-Aldrich).
7, tested crowd
8, serum levels of iron, ferritin assay method
Serum levels of iron (Serum Iron) is measured: conventional ferrous piperazine end-point method (reagent: upper seascape source Medical Devices Co., Ltd.);
Ferritin is measured: conventional immune turbidimetry (reagent: upper seascape source Medical Devices Co., Ltd.);
Hemoglobinometry: BECKMANCOULTER Beckman Ku Erte COULTER Ac.T5diff (OV/CP) blood analyser, conventional method is measured;
Transferrins saturation (TS) is measured: ferrous piperazine end-point method, first measure unsaturation iron-binding capacity (UIBC) (reagent: go up seascape source Medical Devices Co., Ltd.), TS=Serum Iron/ (UIBC+Serum Iron).
9, statistical method
Statistics used adopts R software analysis, and experimental data represents with Mean ± SD.Between cell and zooperal group, relatively adopt Tukey ' s check (ANOVA).Evaluate Caulis Spatholobi decocting liquid the 0th, the impact on crowd's serum parameters in 5 and 14 days, first adopts Kruskal-Wallis non parametric tests, the Wilcoxon that then matches between each group check.With P<0.05, think there is statistical significance.
II. embodiment
The record of 2005 editions and 2010 editions < < Chinese Pharmacopoeia > > of experimental basis, selects 16 kinds of Chinese herbal medicine (referring to table 1).Ferrum is one of essential trace element of body hemopoietic, so whether the medicine that the inventor imagines these anemias have by suppressing Hepcidin, improves iron metabolism state, thus the effect of performance treatment anemia.
First select Huh7 cell, Chinese herbal decoction adds in cell culture fluid, and final concentration is 20 μ g/mL, after 12 hours, abandons supernatant, PBS rinsing 3 times, and Trizol method is extracted RNA, and Realtime-PCR detects Hepcidin encoding gene---HAMP gene expression amount.Every kind of Chinese medicine is established 3 multiple holes at every turn, and experiment repeats 3 times.Result is as Figure 1A, and the inventor finds that Caulis Spatholobi decocting liquid can significantly suppress the expression of Hepcidin in Huh7 cell.
This result is also confirmed in another hepatoma cell line HepG2 cell, and the degree that Caulis Spatholobi water decoction inhibition Hepcidin expresses is relevant to dosage and action time.When Caulis Spatholobi decocting liquid concentration is 200 μ g/mL, the expression of HAMP gene is only 5% of matched group, as Figure 1B.After Caulis Spatholobi effect 3 hours, HAMP expression starts sharply to decline, and processes after 12-24 hour, and expression is only 10% of matched group, as Fig. 1 C.The demonstration of Western Blot result, pSmad1/5/8 protein expression level also significantly reduces, and as Fig. 1 D, this prompting Caulis Spatholobi decocting liquid is by reducing phosphorylation level inhibition Hepcidin mrna expression of Smad1/5/8 albumen.
The HAMP that embodiment 2, Caulis Spatholobi decocting liquid suppress BMP6 induction expresses
BMP6 is direct stimulant [the Andriopoulos B Jr of Hepcidin under physiological condition, Corradini E, Xia Y, et al.BMP6is a key endogenous regulator of Hepcidin expression and iron metabolism.Nat Genet 2009; 41:482-7], the inhibition of the Hepcidin of BMP6 induction being expressed in order to inquire into Caulis Spatholobi decocting liquid, the inventor joins the Caulis Spatholobi water decoction of variable concentrations (20-400 μ g/mL) and BMP6 (10ng/mL) in the culture fluid of HepG2 cell simultaneously, cultivate after 12 hours, detect Hepcidin mrna expression amount.
As a result, BMP6 can make Hepcidin mrna expression amount be elevated to 6 times of normal value, as Fig. 2 A.Add the Caulis Spatholobi decocting liquid of variable concentrations can weaken the stimulation (20-40 μ g/mL) of BMP6, even make the inducing action disappearance (100-400 μ g/mL) of BMP6 to Hepcidin, the expression of Hepcidin mRNA is only 3% of normal value, as Fig. 2 A.
The demonstration of Western Blot result, along with the increase of Caulis Spatholobi concentration, pSmad1/5/8 protein expression level also significantly reduces, as Fig. 2 B.
The HAMP that embodiment 3, Caulis Spatholobi decocting liquid suppress IL-6 induction expresses
Cytokine IL-6 mainly activates Hepcidin by JAK-Stat signal path and expresses [Nemeth E.IL-6mediates hypoferremia of inflammation by inducing the synthesis of the iron regulatory hormone Hepcidin.J Clin Invest 2004 under inflammatory conditions; 113:1271-6; Pietrangelo A, Dierssen U, Valli L, et al.STAT3Is Required for IL-6-gp 130-Dependent Activation of Hepcidin In Vivo.Gastroenterology 2007; 132:294-300].
In order to evaluate Caulis Spatholobi water decoction inhibitory action to Hepcidin under inflammatory conditions, the inventor in HepG2 cell, detects Hepcidin mrna expression amount by Caulis Spatholobi decocting liquid (200 μ g/mL) and IL-6 (50ng/mL) combined effect after 12 hours.Result is to suppress BMP6 similar, and the Hepcidin that Caulis Spatholobi can suppress IL-6 induction expresses, and makes expression be reduced to 80% of normal value by original 2 times, as Fig. 3 A.
Western Blot result shows, pSmad1/5/8 protein expression level significantly reduces, and phosphorylation Stat3 protein expression level increases, as Fig. 3 B, prompting Caulis Spatholobi decocting liquid suppresses the effect that IL-6 induction Hepcidin expresses, not to play a role by direct inhibition Stat path, but indirectly realize by inhibition Smad path.
After 7 week age C57BL/6 female mice random packet, feed is containing the mixed fodder of Caulis Spatholobi crude drug 21.6g/Kg.Respectively at administration the 0th, after 5,10 and 15 days, detect liver organization Hepcidin mRNA(Hamp1 gene code) expression, serum levels of iron, hepatic tissue and spleen Iron In Tissue situation of change.
Found that, administration the 5th day, it is the most obvious that mouse liver Hepcidin expresses decline, is only 45% of matched group; Along with the prolongation of administration time, Hamp1 expresses and returns to gradually normally, as Fig. 4 A.Serum levels of iron was increased to 2 times of normal group in the time of the 5th day, was subsequently slow decreasing trend, as Fig. 4 B, more still had significant difference (P<0.05) with matched group.Caulis Spatholobi is processed rear hepatic tissue ferrum and declines over 10 μ g/g, as Fig. 4 C, relatively has statistical significance (P<0.05) with matched group.But spleen Iron In Tissue has no significant change, as Fig. 4 D.
Caulis Spatholobi is the medicine for the treatment of anemia conventional on tcm clinical practice, and in order to inquire into its inhibition to human body Hepcidin, the inventor has recruited iron deficiency anemia (IDA) patients of 3 healthy volunteers and the treatment of 5 application Caulis Spatholobis.Collect the peripheral blood that they take Caulis Spatholobi front and back, detect serum Hepcidin expression and hemoglobin, iron metabolism index improvement situation.Found that, after taking Caulis Spatholobi the 5th day, serum Hepcidin significantly declined (P<0.01), on the rise subsequently, but still lower than (P<0.05) before taking medicine, as Fig. 5 A.This may be because serum levels of iron (Fig. 5 B) and the transferrins saturation Hepcidin feedback that (Fig. 5 C) cause that raises recovers.In 3 volunteers, serum ferritin increases (Fig. 5 D) along with the prolongation of administration time.
The above results consistent with results of animal (Fig. 4 A-B), illustrates that Caulis Spatholobi decocting liquid can suppress the expression of Hepcidin in body and improve body iron metabolism.
All documents of mentioning in the present invention are all quoted as a reference in this application, just as each piece of document, are quoted as a reference separately.In addition should be understood that those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.
Claims (10)
1. a purposes for Caulis Spatholobi (Caulis Spatholobi), is characterized in that, for the preparation of the compositions of Hepcidin level and rising ferro concentration in serum in reduction body.
2. purposes as claimed in claim 1, is characterized in that, described compositions is the disease for preventing, alleviate or treat iron deficiency disease or being pathological characters by Hepcidin supersecretion also.
3. purposes as claimed in claim 2, is characterized in that, described iron deficiency disease comprises: iron deficiency anemia, chronic inflam matory anemia, renal anemia.
4. purposes as claimed in claim 2 or claim 3, is characterized in that, described iron deficiency disease is that Hepcidin crosses and expresses the iron deficiency disease causing.
5. purposes as claimed in claim 1, is characterized in that, described compositions also for:
Reduce gene---the expression of HAMP gene of coding Hepcidin; Or
Reduce the phosphorylation level of Smad albumen;
Suppress the stimulation that BMP6 expresses Hepcidin; Or
Suppress the inducing action that IL-6 expresses Hepcidin.
6. purposes as claimed in claim 1, is characterized in that, described compositions also for:
Rising Concentration of Serum Ferritin And; Or
Improve serum transferrin saturation.
7. purposes as claimed in claim 1, is characterized in that, described Caulis Spatholobi is selected from lower group:
(a) Caulis Spatholobi medical material or its crushed products; Or
(b) water of Caulis Spatholobi or extractive with organic solvent.
8. purposes as claimed in claim 7, is characterized in that, the water extract of described Caulis Spatholobi is prepared as follows:
By the Caulis Spatholobi medical material 1-10 hour that is soaked in water, boil rear decoction 1-5 hour, filter and collect medicinal liquid; Collecting medicinal residues repeats to decoct step 0-3 time; Merge medicinal liquid, concentrating under reduced pressure.
9. for reducing a Chinese medicine preparation for Hepcidin level in body and rising ferro concentration in serum, it prepares by the following method: by the Caulis Spatholobi medical material 1-10 hour that is soaked in water, boil rear decoction 1-5 hour, filter and collect medicinal liquid; Collecting medicinal residues repeats to decoct step 0-3 time; Merge medicinal liquid, concentrating under reduced pressure.
10. a method that reduces the interior Hepcidin level of body and rising ferro concentration in serum, is characterized in that, comprises step: the Caulis Spatholobi of using effective dose to the object of needs.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210384580.XA CN103720748A (en) | 2012-10-11 | 2012-10-11 | Regulation and control of caulis spatholobi on hepcidin and application of caulis spatholobi |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210384580.XA CN103720748A (en) | 2012-10-11 | 2012-10-11 | Regulation and control of caulis spatholobi on hepcidin and application of caulis spatholobi |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103720748A true CN103720748A (en) | 2014-04-16 |
Family
ID=50445210
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210384580.XA Pending CN103720748A (en) | 2012-10-11 | 2012-10-11 | Regulation and control of caulis spatholobi on hepcidin and application of caulis spatholobi |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103720748A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105168209A (en) * | 2015-09-21 | 2015-12-23 | 浙江大学 | Application of HDAC1 inhibitor in preparing medicine for regulating and controlling hepcidin expression |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1785279A (en) * | 2005-11-16 | 2006-06-14 | 广州陈李济药厂 | Blood supplementing iron supplementing medicineal preparation and its preparation method |
-
2012
- 2012-10-11 CN CN201210384580.XA patent/CN103720748A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1785279A (en) * | 2005-11-16 | 2006-06-14 | 广州陈李济药厂 | Blood supplementing iron supplementing medicineal preparation and its preparation method |
Non-Patent Citations (6)
| Title |
|---|
| 周秋丽，等: "《现代中药基础研究与临床》", 30 June 2012 * |
| 孙雪峰等: "EPO对铁调节蛋白Hepcidin表达影响的研究", 《中国实验血液学杂志》 * |
| 杨正民: "应用中药治疗仔猪缺铁性贫血", 《养殖技术顾问》 * |
| 罗霞等: "鸡血藤煎剂对小鼠红细胞增殖的影响", 《中国中药杂志》 * |
| 陈东辉等: "鸡血藤煎剂对小鼠骨髓细胞增殖的影响", 《中国中药杂志》 * |
| 陈茵等: "健脾补血口服液对缺铁性贫血大鼠铁生物利用率的影响", 《中药药理与临床》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105168209A (en) * | 2015-09-21 | 2015-12-23 | 浙江大学 | Application of HDAC1 inhibitor in preparing medicine for regulating and controlling hepcidin expression |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hu et al. | L-arginine modulates glucose and lipid metabolism in obesity and diabetes | |
| US10441602B2 (en) | Human gastrointestinal microbiome modulating composition and methods of use | |
| EP2011500B1 (en) | Fat accumulation inhibitor for the treatment of metabolic syndrome | |
| KR20080105470A (en) | Food composition containing ginseng fruit extract for preventing and improving obesity | |
| Al-Waili | Intravenous and intrapulmonary administration of honey solution to healthy sheep: effects on blood sugar, renal and liver function tests, bone marrow function, lipid profile, and carbon tetrachloride-induced liver injury | |
| US9931367B2 (en) | Uses of cistanche tubulosa extract and isoacteoside in protecting muscle | |
| JP2019210269A (en) | Composition for treating diabetic disease | |
| JP3113878B2 (en) | Pharmaceutical composition for promoting recovery of animals treated with bone marrow transplantation | |
| KR20170023910A (en) | Pharmaceutical Compositions for Prevention or Treatment of nonalcoholic fatty liver disease Comprising Quercetin-3-O-glucoside | |
| CN103720748A (en) | Regulation and control of caulis spatholobi on hepcidin and application of caulis spatholobi | |
| JP2015218145A (en) | TNF-α PRODUCTION INHIBITOR | |
| EP3860615B1 (en) | Oral composition comprising b-escin and the use thereof | |
| KR20150107938A (en) | Composition for Improving Memory and Cognitive Function Comprising Psyllium husk | |
| KR101811210B1 (en) | Composition for treatment, improvement or prevention of Diabetes comprising extract of fruit of Sorbus commixta as an effective component | |
| KR20150032223A (en) | Composition comprising monoacetyldiacylglycerol compound for promoting differentiation or proliferation of erythroid cells | |
| CN115177658B (en) | Composition for reducing blood sugar | |
| KR102507569B1 (en) | Preparation Method of Gynostemma pentaphyllum Leaves Extract and Gynostemma pentaphyllum Leaves Extract Using The Same | |
| JP2015003873A (en) | Adiponectin production promoter | |
| US8637096B2 (en) | Compositions and method for enhancing insulin activity | |
| KR20140037513A (en) | A composition comprising a crude extract or purified fraction extract of plantago asiatica for treating or preventing hyperlipidemia and obesity | |
| KR101613252B1 (en) | Compositions for Preventing or Treating Obesity and Fatty Liver Containing Ariginase Inhibitors | |
| WO2022113693A1 (en) | Therapeutic agent for muscular dystrophy, central venous nutrition composition, inflammation inhibitor for muscle tissue, and anti-inflammatory food composition for muscular dystrophy | |
| KR101890853B1 (en) | A composition for prevention or treatment of obesity comprising protamine and chitooligosaccharide | |
| CN103405493A (en) | Application of black bean and extractive of same in manufacture of preparation for inhibiting expression of hepcidin | |
| KR101113978B1 (en) | Composition for improving erectile dysfunction and erection maintenance comprising the extract of Polygala tenuifolia as an active ingredient |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20140416 |