CN103710457B - Dual-gene micro RNA fluorescent quantitative internal reference and application of primer in shellfish development samples - Google Patents
Dual-gene micro RNA fluorescent quantitative internal reference and application of primer in shellfish development samples Download PDFInfo
- Publication number
- CN103710457B CN103710457B CN201410002991.7A CN201410002991A CN103710457B CN 103710457 B CN103710457 B CN 103710457B CN 201410002991 A CN201410002991 A CN 201410002991A CN 103710457 B CN103710457 B CN 103710457B
- Authority
- CN
- China
- Prior art keywords
- gene
- mir
- internal reference
- dual
- mirna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
- 239000002679 microRNA Substances 0.000 title claims abstract description 75
- 108091070501 miRNA Proteins 0.000 title claims abstract description 58
- 235000015170 shellfish Nutrition 0.000 title claims abstract description 23
- 238000011161 development Methods 0.000 title claims abstract description 14
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 47
- 230000014509 gene expression Effects 0.000 claims abstract description 32
- 108091078326 miR-71 stem-loop Proteins 0.000 claims abstract description 20
- 108091091149 miR-8 stem-loop Proteins 0.000 claims abstract description 20
- 238000000034 method Methods 0.000 claims abstract description 15
- 108700011259 MicroRNAs Proteins 0.000 claims description 20
- 241000237502 Ostreidae Species 0.000 claims description 15
- 235000020636 oyster Nutrition 0.000 claims description 15
- 238000003753 real-time PCR Methods 0.000 claims description 13
- 238000011002 quantification Methods 0.000 claims description 7
- 238000002474 experimental method Methods 0.000 claims description 5
- 238000011068 loading method Methods 0.000 claims description 2
- 108020004688 Small Nuclear RNA Proteins 0.000 abstract description 12
- 102000039471 Small Nuclear RNA Human genes 0.000 abstract description 12
- 108020004565 5.8S Ribosomal RNA Proteins 0.000 abstract description 5
- 238000004445 quantitative analysis Methods 0.000 abstract description 3
- 238000012163 sequencing technique Methods 0.000 abstract description 3
- 238000012216 screening Methods 0.000 abstract description 2
- 239000000523 sample Substances 0.000 description 23
- 238000006243 chemical reaction Methods 0.000 description 14
- 238000001228 spectrum Methods 0.000 description 10
- 238000012360 testing method Methods 0.000 description 8
- 108091032973 (ribonucleotides)n+m Proteins 0.000 description 7
- 108010000912 Egg Proteins Proteins 0.000 description 7
- 102000002322 Egg Proteins Human genes 0.000 description 7
- 210000004681 ovum Anatomy 0.000 description 7
- 239000002299 complementary DNA Substances 0.000 description 6
- 238000010195 expression analysis Methods 0.000 description 6
- 108091080995 Mir-9/mir-79 microRNA precursor family Proteins 0.000 description 5
- 238000013461 design Methods 0.000 description 5
- 108091047084 miR-9 stem-loop Proteins 0.000 description 5
- 210000002966 serum Anatomy 0.000 description 5
- IJGRMHOSHXDMSA-UHFFFAOYSA-N Atomic nitrogen Chemical compound N#N IJGRMHOSHXDMSA-UHFFFAOYSA-N 0.000 description 4
- 108091032955 Bacterial small RNA Proteins 0.000 description 4
- 230000003321 amplification Effects 0.000 description 4
- 238000011160 research Methods 0.000 description 4
- 108091027559 Mir-96 microRNA Proteins 0.000 description 3
- 239000011543 agarose gel Substances 0.000 description 3
- 230000015572 biosynthetic process Effects 0.000 description 3
- 238000010805 cDNA synthesis kit Methods 0.000 description 3
- 238000004422 calculation algorithm Methods 0.000 description 3
- 239000003153 chemical reaction reagent Substances 0.000 description 3
- 230000002068 genetic effect Effects 0.000 description 3
- 108091086713 miR-96 stem-loop Proteins 0.000 description 3
- 108091070961 miR-96-3 stem-loop Proteins 0.000 description 3
- 239000000203 mixture Substances 0.000 description 3
- 238000003199 nucleic acid amplification method Methods 0.000 description 3
- 238000003786 synthesis reaction Methods 0.000 description 3
- 241000237519 Bivalvia Species 0.000 description 2
- 108090000790 Enzymes Proteins 0.000 description 2
- 102000004190 Enzymes Human genes 0.000 description 2
- 238000002123 RNA extraction Methods 0.000 description 2
- 238000004458 analytical method Methods 0.000 description 2
- 238000013459 approach Methods 0.000 description 2
- 238000009395 breeding Methods 0.000 description 2
- 230000001488 breeding effect Effects 0.000 description 2
- 235000020639 clam Nutrition 0.000 description 2
- 230000000295 complement effect Effects 0.000 description 2
- 238000005138 cryopreservation Methods 0.000 description 2
- 239000000284 extract Substances 0.000 description 2
- 238000000605 extraction Methods 0.000 description 2
- 230000004720 fertilization Effects 0.000 description 2
- 238000001914 filtration Methods 0.000 description 2
- 238000010230 functional analysis Methods 0.000 description 2
- 239000003292 glue Substances 0.000 description 2
- 239000001046 green dye Substances 0.000 description 2
- 230000009027 insemination Effects 0.000 description 2
- 238000012177 large-scale sequencing Methods 0.000 description 2
- 239000007788 liquid Substances 0.000 description 2
- 239000000463 material Substances 0.000 description 2
- 108091084079 miR-12 stem-loop Proteins 0.000 description 2
- 108091059202 miR-1992 stem-loop Proteins 0.000 description 2
- 108091007431 miR-29 Proteins 0.000 description 2
- 108091059456 miR-92-1 stem-loop Proteins 0.000 description 2
- 108091084336 miR-92-2 stem-loop Proteins 0.000 description 2
- 229910052757 nitrogen Inorganic materials 0.000 description 2
- 102000039446 nucleic acids Human genes 0.000 description 2
- 108020004707 nucleic acids Proteins 0.000 description 2
- 150000007523 nucleic acids Chemical class 0.000 description 2
- 238000010839 reverse transcription Methods 0.000 description 2
- 238000005070 sampling Methods 0.000 description 2
- 102000040650 (ribonucleotides)n+m Human genes 0.000 description 1
- 241000208340 Araliaceae Species 0.000 description 1
- 241000251522 Cephalochordata Species 0.000 description 1
- 206010009944 Colon cancer Diseases 0.000 description 1
- 108091030146 MiRBase Proteins 0.000 description 1
- 241000237852 Mollusca Species 0.000 description 1
- 241000237536 Mytilus edulis Species 0.000 description 1
- 238000012408 PCR amplification Methods 0.000 description 1
- 235000005035 Panax pseudoginseng ssp. pseudoginseng Nutrition 0.000 description 1
- 235000003140 Panax quinquefolius Nutrition 0.000 description 1
- 239000013614 RNA sample Substances 0.000 description 1
- 102000006382 Ribonucleases Human genes 0.000 description 1
- 108010083644 Ribonucleases Proteins 0.000 description 1
- 241000242678 Schistosoma Species 0.000 description 1
- 108020004566 Transfer RNA Proteins 0.000 description 1
- 108060008682 Tumor Necrosis Factor Proteins 0.000 description 1
- 102000000852 Tumor Necrosis Factor-alpha Human genes 0.000 description 1
- 238000000137 annealing Methods 0.000 description 1
- 238000009360 aquaculture Methods 0.000 description 1
- 244000144974 aquaculture Species 0.000 description 1
- 238000004364 calculation method Methods 0.000 description 1
- 238000012512 characterization method Methods 0.000 description 1
- 239000012295 chemical reaction liquid Substances 0.000 description 1
- 208000029742 colonic neoplasm Diseases 0.000 description 1
- 238000012350 deep sequencing Methods 0.000 description 1
- 238000004925 denaturation Methods 0.000 description 1
- 230000036425 denaturation Effects 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 238000001962 electrophoresis Methods 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 239000003337 fertilizer Substances 0.000 description 1
- 235000008434 ginseng Nutrition 0.000 description 1
- 230000002779 inactivation Effects 0.000 description 1
- 238000004519 manufacturing process Methods 0.000 description 1
- 235000013372 meat Nutrition 0.000 description 1
- 108020004999 messenger RNA Proteins 0.000 description 1
- 235000020638 mussel Nutrition 0.000 description 1
- 238000010606 normalization Methods 0.000 description 1
- 235000008935 nutritious Nutrition 0.000 description 1
- 238000012856 packing Methods 0.000 description 1
- 230000001766 physiological effect Effects 0.000 description 1
- 230000001124 posttranscriptional effect Effects 0.000 description 1
- 238000002360 preparation method Methods 0.000 description 1
- 230000001737 promoting effect Effects 0.000 description 1
- 238000012797 qualification Methods 0.000 description 1
- 238000012207 quantitative assay Methods 0.000 description 1
- 238000003762 quantitative reverse transcription PCR Methods 0.000 description 1
- 239000011535 reaction buffer Substances 0.000 description 1
- 238000004153 renaturation Methods 0.000 description 1
- 150000003384 small molecules Chemical class 0.000 description 1
- 239000000344 soap Substances 0.000 description 1
- 239000000243 solution Substances 0.000 description 1
- 238000013518 transcription Methods 0.000 description 1
- 230000035897 transcription Effects 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the field of molecular biology, in particular to a dual-gene micro RNA (miRNA) fluorescent quantitative internal reference and application of a primer in shellfish development samples. The two genes (miR-71 and miR-8) are selected by the strict internal reference screening procedure and are the most stable miRNA genes in different development stages of shellfish miRNA, the expression stability of the two genes in different development stages is superior to that of common miRNA internal reference genes snRNA U6, snRNA U1 and 5.8S RNA. Two miRNAs are selected randomly, the dual-gene miRNA is used as the internal reference for carrying out fluorescent quantitative analysis in development samples, the expression results are highly accordance with the miRNA sequencing expression profile, and the reliability and the stability of the dual-gene internal reference are proved.
Description
Technical field
The present invention relates to biology field, specifically one is applicable to carry out microRNA(miRNA in shellfish development sample) the quantitative internal reference of dual-gene miRNA of expression analysis and primer thereof.
Background technology
Shellfish, belong to the lamellibranchiata (or Bivalvia) in Mollusca, common kind has oyster, mussel, clam, razor clam etc.Existing kind about 10,000 kinds, wherein 80% moves in ocean.The equal edible of most kind in shellfish, the meat fertilizer of a lot of shellfish is tender, tasty, nutritious, has very high economic worth, is aquaculture object important in the world.
MicroRNA is the small molecules non-coding single stranded RNA that a class extensively exists in organic sphere, be about 21 ~ 24nt, it is by degraded or suppress complementary said target mrna to carry out posttranscriptional gene expression regulation, and wide expression in each developmental stage and different histoorgans of biology, participate in biological various physiological activities, because of its importance in biology, the research of scientist to miRNA both at home and abroad in recent years is extraordinarily paid attention to.The development promoting shellfishery is contributed to the research of shellfish miRNA.65 miRNA(miRBase20 have only been reported in shellfish), and temporarily not can be used for the quantitative reference gene report of miRNA.
At present large scale sequencing is mainly contained to the expression analysis of miRNA, gene chip and real time fluorescent quantitative method.Large scale sequencing and gene chips are high throughput method, and cost is very high, are unsuitable for the functional analysis of a small amount of miRNA.And based on the miRNA relative quantification method of SYBR Green dye fluorescence quantitative PCR, see document: [Shi R, Chiang VL (2005) Facile means for quantifyingmicroRNA expression by real-time PCR.Biotechniques255039:519-525.] there is operation relatively simple, cost is lower, highly sensitive advantage, extensively by the welcome of researchist.And in relative method quantitative fluorescent PCR, the selection of internal reference is particularly important.Due in different samples small RNA(<200nt) with total serum IgE ratio variant, the extraction efficiency reason not equal in long RNA of small RNA, miRNA or snRNA that miRNA expression analysis internal reference used recommendation is suitable with miRNA clip size etc. are as internal reference.The object of this invention is to provide a kind of quantitative internal reference being applicable to carry out microRNA expression analysis in shellfish development sample.
Summary of the invention
The object of this invention is to provide a kind of dual-gene internal reference and the application of primer in shellfish development sample thereof.That is, a kind ofly in shellfish development sample, the quantitative analysis of microRNA Dual-gene micro RNA fluorescent quantitative internal reference gene (miR-71 and miR-8) used and primer thereof is carried out based on the relative quantification method in quantitative fluorescent PCR.
For achieving the above object, the technical solution used in the present invention is:
Dual-gene micro RNA fluorescent quantitative internal reference and the application of primer in shellfish development sample thereof, two shellfish genes in Dual-gene micro RNA fluorescent quantitative internal reference are that miR-71 has base sequence and miR-8 in sequence table SEQ ID No:1 and has base sequence in sequence table SEQ ID No:2.
Described two shellfish gene miR-71 and miR-8 grow stably express in sample (that is, expression amount change is little) in the difference of shellfish, can as reference gene in relative quantification method real-time fluorescence quantitative PCR.
Use the microRNA of two stably express as dual-gene internal reference simultaneously; The expression amount Ct value of dual-gene internal reference is, miR-71 and miR-8 gene grows the arithmetical mean of the expression amount Ct value in sample at certain; Corrected the experimental error in loading process by this dual-gene internal reference, the accuracy of experiment can be improved.
Application according to claim 1, is characterized in that: the Auele Specific Primer of reference gene miR-71 used is: 5 '-GGGTGAAAGACATGGGTAGTGAGAT-3 '; The Auele Specific Primer of miR-8 is: 5 '-GGGTAATACTGTCAGGTAAAGATGTC-3 '.
Concrete steps are:
A. the acquisition of candidate's miRNA sequence: obtain the miRNA sequence for doing expression analysis from data with existing storehouse or other source (as database website miRBase, high-flux sequence etc.).
B. design of primers: the candidate's miRNA sequence according to obtaining designs the corresponding special primer of this miRNA (amplified production is single, is specially solubility curve peak single, and the agarose gel test strip of 3% is single).
The preparation of c.PCR template: after collecting sample, use TRIzol(reagent, city is purchased from Invitrogen company) extract total serum IgE, use One Step
cDNA is inverted to after miRNA cDNA Synthesis Kit (test kit, city is purchased from TaKaRa company) adds polyA tail to specifications.As the template of quantitative fluorescent PCR.
D. quantitative fluorescent PCR reaction: carry out in ABI7500FAST real-time PCR instrument with the dual-gene internal reference that is combined as of miR-71, miR-8 with the corresponding special primer of miRNA and universal reverseprimer (being provided by above-mentioned TaKaRa test kit).Obtain the expression data Ct value of each gene.
E. the relative expression quantity in each template is obtained: result adopts 2
-△ △ Ctmethod calculates, △ △ Ct=(Ct
miRNA-Ct
internal reference)
sample2-(Ct
miRNA-Ct
internal reference)
sample1.
F. follow-up functional analysis is carried out according to expression.
Tool of the present invention has the following advantages:
1. the present invention can be applicable to the expression analysis of a small amount of miRNA, and operation is relatively simple, and cost is lower, highly sensitive.
2. two genes that this research is chosen are through that strict internal reference screening procedure selects, in growth sample, express the most stable miR-96 gene in shellfish miRNA, its miRNA reference gene snRNA U6 growing the stability in sample and be better than commonly using, snRNA U1 and 5.8S RNA(is shown in embodiment 2).
3., using dual-gene miRNA as internal reference, the expression of results made and the miRNA express spectra that checks order is identical, and demonstrates the reliability and stability (see embodiment 3) of this dual-gene internal reference.
Accompanying drawing illustrates:
Fig. 1 .miR-9, m0315 order-checking express spectra result (left side) and relative quantification result (right side) comparison diagram.(E, ovum; B, blastaea; T, trochophore; D, D shape larva; U, shell top larva; P, eyebot larvae).
Embodiment
In the following examples, the invention will be further elaborated, but the present invention is not limited thereto.Experimental article that the present invention adopts is all from commercial, and English mark used is packing of product title.
The information miR-71 of sequence table (1) SEQ ID NO1
Sequence signature length: 22nt
Type: nucleic acid
Chain: strand
Topological framework: linear
Molecule type: RNA
Property name: microRNA(1-22)
Source: long oyster
Sequence description: UGAAAGACAUGGGUAGUGAGAU
The information miR-8 of sequence table (2) SEQ ID NO2
Sequence signature length: 23nt
Type: nucleic acid
Chain: strand
Topological framework: linear
Molecule type: RNA
Property name: microRNA(1-23)
Source: long oyster
Sequence description: UAAUACUGUCAGGUAAAGAUGUC
Embodiment 1
The selection of candidate's reference gene: we have carried out microRNA order-checking to long oyster different development stage sample, obtain microRNA and the express spectra thereof of some new qualifications.Based on miRNA express spectra data, we have chosen 6 more stable microRNA of expression alternatively gene (that is, miR-8, miR-12, miR-29, miR-71, miR-92, miR-1992).Simultaneously by conventional microRNA reference gene 5.8S RNA, snRNA U6 and snRNA U1 alternatively gene.
MiRNA sequence (see table one) and the order-checking express spectra of long oyster provide RNA sample by us, the result provided after BGI-Shenzhen's sequencing analysis.Below the method for degree of depth sequencing analysis is briefly introduced, detailed content is see document [Huang J, Hao P, Chen H, Hu W, YanQ, et al. (2009) Genome-wide identification of Schistosoma japonicummicroRNAs using a deep-sequencing approach.Plos One4:e8206].
Check order experiment material used: obtained each developmental stage larva of oyster in 2011 by the normal artificial insemination of Lao East Sea treasure seed stock breeding station.Cultivate in 25 ± 2 DEG C of filtering seas, grow after D shape larva (24h) and start bait micro-algae of throwing something and feeding.Judge the developmental stage at oyster larva place with observation by light microscope, get 8, the growth sample of different time points: ovum s.E, blastaea s.B, trochophore s.T1, trochophore s.T2, D shape larva s.D, shell top larva s.U, eyebot larvae s.P1, eyebot larvae s.P2 are respectively at after fertilization 0h, 4.5h, 11.5h, 13.5h, 17.5h, 8.5d, 18d, the sampling of 22d bolting silk is placed in cryopreservation tube, in direct plunge into Liquid Nitrogen, is stored in-80 DEG C of refrigerators after-196 DEG C of quick-frozens.
RNA extraction method is with embodiment 2.The Small RNA order-checking Illumina order-checking platform of BGI-Shenzhen carries out.From sample RNA, first cut glue reclaim 18-30nt RNAs, connect 5 ' successively and become cDNA with reverse transcription after the sequence measuring joints of 3 ', with small RNA PCR primer 1 and 2 (Illumina) pcr amplification 15 circulation.Remove joint, polluted sequence and inferior quality sequence after checking order with Illumina Genome Analyzer, remaining clean reads SOAP comparison software corresponds on long oyster genome.The exon will predicted before corresponding to again, tumor-necrosis factor glycoproteins, rRNAs, the reads of tRNAs and snRNAs removes, with being specifically designed to the software MIREAP differentiating miRNA in degree of depth order-checking, see document: [Chen X, Li Q, Wang J, Guo X, Jiang X, et al. (2009) Identification and characterization of novel amphioxus microRNAs by Solexasequencing.Genome Biology10:R78.], in long oyster genome, predict miRNA front body structure, obtain the miRNA of candidate.Calculate the miRNA expression amount in each sample with reads per million (RPM), form express spectra.
According to the miRNA express spectra data that BGI-Shenzhen gives, calculate each miRNA grows expression amount in the sample variation coefficient (CV) in difference.The variation coefficient (CV)=standard deviation (stdev)/average (mean).Have chosen CV value less, namely express more stable 6 microRNA(miR-8, miR-12, miR-29, miR-71, miR-92, miR-1992) alternatively gene.Also by conventional microRNA reference gene 5.8S RNA, snRNA U6 and snRNA U1 alternatively gene.
Embodiment 2
Through quantitative fluorescent PCR assessment candidate reference gene expression stability: design special primer according to candidate gene sequence, quantitative fluorescent PCR is carried out in growth sample, obtain the expression data-Ct value (threshold cycle, the cycle number that when fluorescent signal each reaction tubes in arrive the thresholding of setting experience) of each candidate gene at each developmental stage.After being changed with formula 2-Ct by Ct Value Data, screen with internal reference the stationary value that the most frequently used excel algorithm NormFinder calculates each candidate gene, stationary value is less, represents genetic expression more stable.The specific algorithm of NormFinder and principle are see document [ANDERSEN, C.L., JENSEN, J.L. & ORNTOFT, T.F.2004Normalization ofreal-time quantitative reverse transcription-PCR data:A model-based varianceestimation approach to identify genes suited for normalization, applied tobladder and colon cancer data sets.Cancer Research, 64:5245-5250].Select two microRNA that stationary value is minimum, as the quantitative internal reference of dual-gene microRNA after combination.Its specific embodiments is as follows:
1, experiment material: obtained each developmental stage larva of oyster by the normal artificial insemination of Lao East Sea treasure seed stock breeding station in 2012.Cultivate in 22 ± 2 DEG C of filtering seas, grow after D shape larva (26h) and start bait micro-algae of throwing something and feeding.The developmental stage at oyster larva place is judged with observation by light microscope, get 13, the growth sample of different time points: ovum E, blastaea B, trochophore T1, trochophore T2, trochophore T3, D shape larva D1, D shape larva D2, shell top larva U1, shell top larva U2, shell top larva U3, shell top larva U4, shell top larva U5, eyebot larvae P is respectively at after fertilization 0h, 4.5h, 8.5h, 10.5h, 12.5h, 18.5h, 2d, 3d, 7d, 15d, 19d, 26d, 34d, the sampling of 38d bolting silk is placed in cryopreservation tube, in direct plunge into Liquid Nitrogen,-80 DEG C of refrigerators are stored in after-196 DEG C of quick-frozens.
2, RNA extracts: use TRIzol(reagent, city is purchased from Invitrogen company) step to specifications extraction total serum IgE.
3, the synthesis of the first chain cDNA: use One Step
cDNA is inverted to, as quantitative fluorescent PCR template after the total serum IgE that step 2 obtains is added polyA tail by miRNA cDNASynthesis Kit (test kit, city is purchased from TaKaRa company) to specifications.
1) reaction system of 20 μ l is prepared: 10 μ l2 × miRNA Reaction Buffer Mix, 2 μ l0.1%BSA, 2 μ l miRNA
rT Enzyme Mix, 1 μ l total serum IgE, 5 μ l RNaseFree dH
2o (providing by above-mentioned TaKaRa test kit).
2) reaction conditions in Bio-Rad PCR instrument (PCR instrument, city is purchased from Bio-Rad company): 37 DEG C (tailing and reverse transcription 60min), 85 DEG C (inactivation 5sec of enzyme).
3) in the inverse transcription reaction liquid obtained, RNase Free H is added
2o(city is purchased from TaKaRa company) complement to 100 μ l.
4, design of primers: go out corresponding Auele Specific Primer according to gene order Primer Premier5 software design.Because miRNA reverse primer universal reverse primer is general, by test kit One Step
miRNA cDNA Synthesis Kit (test kit, city is purchased from TaKaRa company) provides.The special primer of miRNA just seems especially important.In order to ensure the Tm value (annealing temperature) of primer at about 60 DEG C, can several bases G be added at 5 ' end of miRNA sequence or add several base A at 3 ' end.The miR-96 gene sequence that the present invention is used and primer sequence are as table one.The synthesis of Shanghai Sani company is given after design of primers is good.
The miR-96 gene sequence that table one, the present invention are used and primer sequence
5, PCR reaction: carry out in ABI7500FAST real-time PCR instrument (PCR instrument, city is purchased from ABI company).3 repetitions are done in each PCR reaction.Reaction terminates the expression data-Ct value of each candidate gene of rear acquisition at each developmental stage.
1) 20 μ l reaction systems: 10 μ l2 ×
green PCR Master Mix (reagent, city is purchased from ABI company), 7.2 μ l H
2o, 2 μ l cDNA templates (obtaining in step 3), 0.4 μM of forward primer (gene-specific primer), 0.4 μM of reverse primer.
2) pcr amplification program is: 95 DEG C (denaturation 2min); 95 DEG C (sex change 3sec), 60 DEG C (renaturation 30sec) circulates 40 times; Instrument makes solubility curve automatically.
The solubility curve generated after PCR reaction by observing ABI7500FAST real-time PCR instrument is that simple spike judges that the primer is without non-specific amplification; In the agarose gel of 3%, by ultraviolet see glue instrument take pictures after 150V electrophoresis 25min by the PCR primer of 2 μ l, observe band single, thus determine that the primer is without non-specific amplification further.
6, the Ct Value Data formula 2 will obtained in step 5
-Ctafter conversion, screen with internal reference the stationary value (see table two) that the most frequently used excel algorithm NormFinder calculates each candidate gene, stationary value is less, represents genetic expression more stable.Select two microRNA(miR-71 and miR-8 that stationary value is minimum), as the quantitative internal reference of dual-gene microRNA after combination.NormFinder calculation stability value is used again together with the expression data of gene after these two gene C t are worth arithmetical mean number conversion, show that the stationary value of this dual-gene internal reference is 0.188, be better than all candidate's internal references, comprise conventional miRNA reference gene snRNA U6, snRNA U1 and 5.8S RNA.
Table two, the candidate gene stationary value calculated by NormFinder.
Stationary value is less, represents this genetic expression stability higher.
Embodiment 3
Dual-gene combination is as internal reference, and the expression amount Ct value of this dual-gene internal reference is, miR-71 and miR-8 gene grows the arithmetical mean of the expression amount Ct value in sample at certain.By the method based on SYBR Green dye fluorescence quantitative PCR, 2 long oyster miRNA(miR-9 and m0315 to random selecting) in 13 growth samples, carry out relative quantitative assay, see document: [Shi R, Chiang VL (2005) Facile means for quantifying microRNA expression by real-time PCR.Biotechniques255039:519-525.].Find to use this dual-gene fluorescent quantitative PCR result as internal reference to be identical with order-checking express spectra result, demonstrate the reliability and stability of this dual-gene internal reference.
The relative quantification of long oyster miRNA:
Grow the acquisition of sample, the synthesis of RNA extraction and the first chain cDNA is with embodiment 2.The corresponding special primer of quantitative PCR reaction miRNA and universal reverse primer (being provided by TaKaRa test kit) carry out in ABI7500FAST real-time PCR instrument.Concrete PCR reaction system and amplification program are with embodiment 2.3 repetitions are established in each reaction, and the PCR primer agarose gel of 3% is determined without non-specific amplification.
Experimental result: this experiment is to 2 of random selecting long oyster miRNA(miR-9, m0315) and dual-gene internal reference (miR-71 and miR-8), totally 4 genes do quantitative fluorescent PCR, obtain its Ct value (see table three) in each growth sample.The expression amount Ct value of dual-gene internal reference is, miR-71 and miR-8 gene grows the arithmetical mean of the expression amount Ct value in sample at certain.With dual-gene (miR-71 and miR-8) for internal reference, adopt 2
-△ △ Ctmethod calculates, △ △ Ct=(Ct
miRNA-Ct
in ginseng)
sample2-(Ct
miRNA-Ct
internal reference)
sample1, the results are shown in Table four.Fluorescent quantitation result is identical (see figure 1) with order-checking express spectra result (see table five), demonstrates the reliability and stability of this dual-gene internal reference.
Table three, different expression data-Ct mean value (E, ovum of growing each gene in sample; B, blastaea; T, trochophore; D, D shape larva; U, shell top larva; P, eyebot larvae)
Table four, relative quantification method fluorescent quantitative PCR result: miR-9, m0315 are relative to expression amount (E, the ovum in ovum; B, blastaea; T, trochophore; D, D shape larva; U, shell top larva; P, eyebot larvae)
Order-checking express spectra data (unit: RPM, E, the ovum of table five, miR-9, m0315; B, blastaea; T, trochophore; D, D shape larva; U, shell top larva; P, eyebot larvae)
Claims (3)
1. Dual-gene micro RNA fluorescent quantitative internal reference and the application of primer in shellfish development sample amounts is analyzed thereof, is characterized in that: two shellfish genes in Dual-gene micro RNA fluorescent quantitative internal reference are miR-71 and miR-8; MiR-71 is base sequence in sequence table SEQ ID No:1, and miR-8 is base sequence in sequence table SEQ ID No:2, and described shellfish is long oyster;
The Auele Specific Primer of reference gene miR-71 used is: 5 '-GGGTGAAAGACATGGGTAGTGAGAT-3 '; The Auele Specific Primer of miR-8 is: 5 '-GGGTAATACTGTCAGGTAAAGATGTC-3 '.
2. application according to claim 1, is characterized in that: described two shellfish gene miR-71 and miR-8 grow stably express in sample in the difference of shellfish, can as reference gene in relative quantification method real-time fluorescence quantitative PCR.
3. application according to claim 1, is characterized in that: use the microRNA of two stably express as dual-gene internal reference simultaneously; The expression amount Ct value of dual-gene internal reference is, miR-71 and miR-8 gene grows the arithmetical mean of the expression amount Ct value in sample at certain; Corrected the experimental error in loading process by this dual-gene internal reference, the accuracy of experiment can be improved.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410002991.7A CN103710457B (en) | 2014-01-03 | 2014-01-03 | Dual-gene micro RNA fluorescent quantitative internal reference and application of primer in shellfish development samples |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410002991.7A CN103710457B (en) | 2014-01-03 | 2014-01-03 | Dual-gene micro RNA fluorescent quantitative internal reference and application of primer in shellfish development samples |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103710457A CN103710457A (en) | 2014-04-09 |
| CN103710457B true CN103710457B (en) | 2015-03-11 |
Family
ID=50403808
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410002991.7A Expired - Fee Related CN103710457B (en) | 2014-01-03 | 2014-01-03 | Dual-gene micro RNA fluorescent quantitative internal reference and application of primer in shellfish development samples |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103710457B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104073557B (en) * | 2014-06-11 | 2015-12-09 | 中国科学院海洋研究所 | The reference gene of long oyster Poly (I:C) stress tests fluorescent quantitation and primer thereof and application |
| CN107190062B (en) * | 2017-06-05 | 2020-10-23 | 南京农业大学 | Screening and application of fluorescent quantitative reference genes of pear fruits in different development periods |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103484465A (en) * | 2012-06-11 | 2014-01-01 | 中国科学院海洋研究所 | Shellfish sn RNA U6 gene, primer, and applications thereof |
-
2014
- 2014-01-03 CN CN201410002991.7A patent/CN103710457B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103484465A (en) * | 2012-06-11 | 2014-01-01 | 中国科学院海洋研究所 | Shellfish sn RNA U6 gene, primer, and applications thereof |
Non-Patent Citations (2)
| Title |
|---|
| Genome-Wide Identification of Schistosoma japonicum MicroRNAs Using a Deep-Sequencing Approach;Jian Huang等;《PLoS ONE》;20091231;第4卷(第12期);第1－9页 * |
| Identification and Characterization of MicroRNAs in Pearl Oyster Pinctada martensii by Solexa Deep Sequencing;Yu Jiao et al;《Mar Biotechnol》;20130724;第16卷;第52－64页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103710457A (en) | 2014-04-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Jax et al. | Avian transcriptomics: opportunities and challenges | |
| US20220033805A1 (en) | High-throughput single-nuclei and single-cell libraries and methods of making and of using | |
| CN103789301B (en) | The Auele Specific Primer of Portunus trituberculatus Miers microsatellite marker and screening method | |
| CN104131107A (en) | Method for high-throughput screening of maize reference gene | |
| CN104351096B (en) | A kind of Misgurnus auguillicaudatus fine-variety breeding method | |
| CN109563543A (en) | The method for generating nucleic acid library | |
| CN103370412A (en) | RNA stability enhancer | |
| CN109852710A (en) | One kind SNP marker relevant to grouper ammonia tolerance and application thereof | |
| CN105624322A (en) | Method for developing SSR (Simple Sequence Repeat) molecular mark of nibea albiflora for population identification | |
| CN103710457B (en) | Dual-gene micro RNA fluorescent quantitative internal reference and application of primer in shellfish development samples | |
| CN102876777B (en) | The special primer of brown croaker EST microsatellite marker and screening method | |
| CN103555847A (en) | Method for paternity identification of tilapia mossambica | |
| CN104073557B (en) | The reference gene of long oyster Poly (I:C) stress tests fluorescent quantitation and primer thereof and application | |
| CN103194441B (en) | Method for obtaining miRNA (Ribose Nucleic Acid) candidate target gene and special reverse transcription primer for method | |
| CN107849566A (en) | For detecting the method and kit of powdery mildew | |
| CN103740823B (en) | A kind of Dual-gene micro RNA fluorescent quantitative internal reference and the application of primer in shellfish tissue sample thereof | |
| CN108998538A (en) | A kind of spot Ji SNP marker and its screening technique and application | |
| Baldrich et al. | Ligation bias is a major contributor to nonstoichiometric abundances of secondary siRNAs and impacts analyses of microRNAs | |
| CN106520758A (en) | Screening and identifying method of miRNAs (micro Ribonucleic Acids) of fetal fibroblasts of Saanen dairy goats | |
| CN103484465B (en) | Shellfish sn RNA U6 gene, primer, and applications thereof | |
| Mitrus et al. | Characterisation of cross-amplified microsatellite markers in the red-breasted flycatcher Ficedula parva | |
| CN105177142A (en) | Hippocampus erectus microsatellite markers and screening method thereof | |
| CN110042169A (en) | A kind of T. grubii group specific molecular marker primer, kit and identification method | |
| Lv et al. | RETRACTED: Research progress in the estimation of postmortem interval (PMI) using non-coding RNA (ncRNA) markers | |
| Sun et al. | Identification and quantification of small RNAs |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150311 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |