CN103705918B

CN103705918B - Porcine epidemic diarrhea resisting virus hyper-immune serum and preparation method thereof

Info

Publication number: CN103705918B
Application number: CN201310722570.7A
Authority: CN
Inventors: 侯艳红; 王贵华; 赵亚荣; 于萍萍; 刘明明; 满坤; 陈翠云; 卢会英
Original assignee: Beijing Kemufeng Biological Pharmaceutical Co ltd; Fuzhou Da Bei Nong Biotech Co ltd; ANIMAL MEDICINE RESEARCH CENTER OF BEIJING DABEINONG SCIENCE & TECHNOLOGY GROUP; Beijing Dabeinong Technology Group Co Ltd
Current assignee: ANIMAL MEDICINE RESEARCH CENTER OF BEIJING DABEINONG SCIENCE & TECHNOLOGY GROUP; Beijing Biomedical Technology Center Of Zhaofenghua Biotechnology Nanjing Co ltd; Beijing Kemufeng Biological Pharmaceutical Co ltd; Zhaofenghua Biotechnology Fuzhou Co ltd; Zhaofenghua Biotechnology Nanjing Co ltd; Beijing Dabeinong Biotechnology Co Ltd
Priority date: 2013-12-24
Filing date: 2013-12-24
Publication date: 2019-08-06
Anticipated expiration: 2033-12-24
Also published as: CN103705918A

Abstract

The invention discloses using the inactivated vaccine of ZJ08 plants of CGMCC No.7806 of Porcine epidemic diarrhea virus to grow up binary pig for immunogen immune 50-60 age in days, it is immunized three times, is prepared for hyper-immune serum.Hyper-immune serum character prepared by the present invention is good, and no bacterium, mould, mycoplasma and exogenous virus pollution, high specificity, safety is good, and artificial challenge's cure rate is up to 100%.Serum neutralization titer is 2⁶More than, serum is dispensed, -70 DEG C, storage life 12 months.

Description

Porcine epidemic diarrhea resisting virus hyper-immune serum and preparation method thereof

Technical field

The present invention relates to a kind of preparation method of antiviral serum, specifically a kind of porcine epidemic diarrhea resisting virus height exempts from blood It is clear and preparation method thereof.

Background technique

Pig epidemic diarrhea (Porcine epidemic diarrhea, PED) be cause diarrhea of pigs one kind it is acute, connect Venereal disease toxicity enteric infectious disease is touched, characterized by watery diarrhea, vomiting, dehydration and loss of appetite.PEDV can continue in swinery In the presence of various age pigs are susceptible.The disease incidence of suckling piglets, shelving pigs and fattening pigs is especially tight with suckling pig up to 100% Weight, case fatality rate is up to 100%.The disease is a kind of virosis, there is no effective therapeutic agent method at present.Epidemic disease is inoculated with to pregnant sow Seedling, piglet can obtain resistance colostrum in a manner of passive immunity, but with the disappearance of maternal antibody or irregular, The resistance of piglet is gradually reduced or difference, the neurological susceptibility of popularity diarrhea also show difference, once morbidity, results in huge Economic loss.Using hyper-immune serum to carry out mass treatment is to make piglet adaptive immune power in a manner of passive immunity, reaches guarantor Protect the purpose of piglet.So far, this method is feasible.But clinically popular Porcine epidemic diarrhea virus strain one Denier morphs, and the hyper-immune serum therapeutic effect thus prepared will weaken, and the morbidity and mortality for infecting pig just will increase.

Summary of the invention

To solve the above-mentioned problems, the present invention provides a kind of porcine epidemic diarrhea resisting virus hyper-immune serum and its preparation side Method.

Firstly, the present invention provides a kind of porcine epidemic diarrhea resisting virus hyper-immune serum, for Porcine epidemic diarrhea virus The inactivated vaccine of ZJ08 plants of CGMCC No.7806 is immunogene, and serum is separated from immune swine and is made.

Wherein, the inactivated vaccine of the ZJ08 plants of CGMCC No.7806 of Porcine epidemic diarrhea virus is by pig popularity ZJ08 plants of diarrhea virus inactivations are prepared with oil adjuvant emulsification.

The present invention also provides the preparation methods of the porcine epidemic diarrhea resisting virus hyper-immune serum, include the following steps:

1) it is immunized: growing up binary using the inactivated vaccine of porcine epidemic diarrhea virus as immunogen immune 50-60 age in days Pig, immune for the first time: the total 4ml of intramuscular injection, second is immune: it carries out within 14 days after first time is immune, immunizing dose 8ml, point Two o'clock injection, third time are immune: carrying out within 14 days after immune at second, immunizing dose 16ml, point 3 points of injections；

2) it takes a blood sample: 15~21 days after last time is immune, detecting neutralize antibody titers, reach 2⁹When above, it is sterile to kill pig Bloodletting；

3) solidification blood: being divided into 1-3 square centimeters of fritter with disinfection knife, filters out serum by serum separation and preparation, packing In sterile saline bottle, remaining is placed in -70 DEG C of preservations.

Of the invention ZJ08 plants of PEDV are that applicant causes from the velogen strain that the morbidity pig farm of Zhejiang one is separated to by 105 generations The pig epidemic diarrhea virus attenuated strain obtained after weak is current domestic PEDV epidemic strain, which stablizes, peace Entirely, immunogenicity is good, can resist at present the attack of clinically popular velogen strain, and protective rate is up to 90% or more.

The PEDV 105-145 being separated to is named as ZJ08 plants of Porcine epidemic diarrhea virus for PEDV weakening strain, is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center；Preservation address is: BeiChen West Road, Chaoyang District, BeiJing City 1 Institute 3, Institute of Microorganism, Academia Sinica, deposit number are CGMCC No. 7806, and the preservation time is June 28 in 2013 Day.

The present invention has successfully manufactured experimently out the hyper-immune serum of porcine epidemic diarrhea resisting virus, and physical behavior is good, no bacterium, Mould and mycoplasma growth, no exogenous virus pollution, neutralize antibody titers are 2⁶Times or more.Test result shows this serum not But antibody titer with higher, but also there is very strong specificity, the requirement of detection serum standards is complied fully with, to comment Valence vaccine immunity effect provides powerful.Serum capability assessment the result shows that, hyper-immune serum cure rate prepared by the present invention It is higher.

Detailed description of the invention

Fig. 1 is PEDV CPE picture (400 ×).

Fig. 2 is that PEDV separates poison S gene PCR testing result.In figure, 1: sample；2: negative control；M: DNA Marker DL2000。

Fig. 3 is that PEDV separates poison M gene PCR testing result.In figure, 1: sample；2: negative control；M: DNA Marker DL2000。

Fig. 4 is that PEDV separates poison M Phylogenetic analysis result.

Fig. 5 is that PEDV separates poison ORF3 gene PCR testing result.In figure, 1: sample；2: negative control；M: DNA Marker DL2000。

Fig. 6 is different generation PEDV ORF3 sequence alignment results.

Fig. 7 show hyper-immune serum and swine fever virus (CSFV) Immunofluorescence test result of the invention.Wherein, A is to connect The cell hole of kind PEDV hyper-immune serum and CSFV mixture；B is the cell hole of inoculating cell maintaining liquid.

Specific embodiment

The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention..

The preparation of 1 ZJ08 plants of immunogenes of Porcine epidemic diarrhea virus of embodiment

It takes Zhejiang pig farm pig epidemic diarrhea positive small intestine appropriate, intestinal mucosa and content is scraped, according to the ratio of 1:5 PBS is added in (weight: volume), and multigelation 3 times, centrifuging and taking supernatant, 0.22 μm of membrane filtration is added final concentration of 20 in filtrate The pancreatin of μ g/ml, 37 DEG C are handled 1.5 hours.

The Vero cell of single layer is covered in inoculation according to a conventional method, and according to 10% ratio virus inoculation, 37 DEG C are adsorbed 1 hour, Supply cell maintenance medium (pancreatin containing 10 μ g/ml), 37 DEG C of incubator cultures.Then occurs obvious, stable CPE when reaching for 17 generation Variation, cell circle contracting, particle increase, and poly- heap is in grape cluster sample, and damage and fall off (Fig. 1) occurs in cell.

Detection primer pair: forward primer 5 '-GGATACTTTGGCCTCTTGTG-3 ' is designed according to S gene；Reverse primer For 5 '-CGCACTCGGATTACTCACAGC -3 ', 95 DEG C of initial denaturation 5min, 95 DEG C of 45s, 50 DEG C of 1min, 72 DEG C of 2min After carrying out 32 circulations, 72 DEG C of 5min extend.PEDV amplified fragments are 484bp.As a result see Fig. 2.

According to the primer of the gene order design amplification M gene order of PEDV in GenBank:

PEDV-M-F: GTCTTACATGCGAATTGACC

PEDV-M-R: GGCATAGAGAGATAATGGCA

The size of the M genetic fragment of amplification are as follows: as a result 808 bp are shown in Fig. 3, sequence is as shown in SEQ ID No.5.

The result shows that PEDV(ZJ08 plants) and classical such as Britain CV777 plants of Reference Strains, Belgium Brl/87 plants, South Korea KPD-9F plants with Japan JMe2 plants etc. compare, not on an evolutionary branching, have occurred that apparent variation (Fig. 4), be state Interior newfound epidemic strain.

Expand the primer of ORF3 sequence are as follows:

ORF3-F: TCCTAGACTTCAACCTTACG

ORF3-R: GGTGACAAGTGAAGCACAGA

The size of the segment of the ORF3 of amplification are as follows: 833 bp(Fig. 5).

By Porcine epidemic diarrhea virus on Vero cell 100 generation of continuous passage, and carried out clone purification in this process, It then proceedes to be passaged to for 145 generations on Vero cell.145th generation virus is subjected to RT-PCR detection, amplification S genetic fragment is 484bp.ZJ08 plants of ORF3 gene orders of PEDV start the missing that 49 nucleotide occurs suddenly in ORF3 gene in the 105th generation, the In 105 generations, 125 generations, 145 generations, keep stablizing 49 nucleotide (Fig. 6) of missing, and sequence is as shown in SEQ ID No.6.

Sterile, mycoplasma is carried out to the 105th ~ 145 generation virus by existing " Chinese veterinary pharmacopoeia " annex and exogenous virus is examined, As a result without bacterium, mould, mycoplasma and exogenous virus pollution.

105 ~ 145 weak generation weakening strain kind poison are caused to be named as ZJ08 plants of PEDV separation, microbial preservation number is CGMCC No. 7806；The preservation time is on June 28th, 2013；Depositary institution: China Committee for Culture Collection of Microorganisms Common micro-organisms center；Preservation address is: Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3, Chinese Academy of Sciences's microbe research Institute.

Take the 125th generation of PEDV ZJ08 strain and cell maintenance medium be inoculated into the ratio of 1:50 covered with single layer Vero it is thin On born of the same parents, 37 DEG C of cultures are placed in, virus is harvested when lesion occurs in 80% cell, measure malicious valence, (viral level 10⁷TCID₅₀/ Ml), 0.3% formaldehyde is added, is placed in 37 DEG C of constant incubators and is inactivated for 24 hours, during which shakes for several times, 3 times of amount oil assistants are added Agent is prepared into inactivated vaccine through emulsification, and 4 DEG C save backup.

The preparation of 2 serum of embodiment

1) immune programme

It is immune for the first time: the total 4ml of intramuscular injection.

Second immune: carrying out within 14 days after first time is immune, immunizing dose 8ml, a point two o'clock is injected.

Third time is immune: carrying out within 14 days after immune at second, immunizing dose 16ml, point 3 points of injections.

2) it takes a blood sample

15~21 days after last time is immune, (after first taking a blood sample 1 time, serum titer, then bloodletting are surveyed using experimental method is neutralized It is lethal, be spaced 3~4), health examination is carried out to pig, without any disease patient, is not fed with material within first 12 hours in blood sampling, but unlimited System drinking-water.Knife killing pig, access site skin degerming are first filled into shallow basin moise-heat sterilization after cleaning of blood in advance.Sterile bloodletting.

3) serum separation and preparation

Serum is separated using condensation pressurization naturally.Solidification blood is divided into 1 square centimeter of fritter with disinfection knife, is filtered out Serum is sub-packed in the normal saline bottle that the capacity by moise-heat sterilization is 500 milliliters, and every bottle of taking-up 20ml is tested, remaining is set It is saved in -70 DEG C.

Immunogene, last time immunity inoculation are prepared into oil adjuvant emulsification after ZJ08 plants of Porcine epidemic diarrhea virus inactivations Its neutralize antibody titers of 15 daily inspections afterwards, reach 2⁶More than.Subsequent sterile blood sampling according to a conventional method and separation serum, and to serum Semi-finished product have carried out pure property and have examined.The result shows that being grown in the serum of preparation without bacterium, mould and mycoplasma, no external source disease Poison pollution, meets the requirements.

The measurement of 3 serum titer of embodiment

Tested hyper-immune serum is diluted by 1:2,1:16,1:32 ... 1:512 with DMEM, each dilution serum is added Amount titre is 200 TCID₅₀ZJ08 plants of the PEDV of/0.1ml, 37 DEG C neutralize 1 hour, and 96 holes of Vero cell monolayer are covered in inoculation 6 hole of cell plates, every 100 μ l of hole, while setting 6 hole of virus positive control cell not neutralized and only inoculating cell maintaining liquid feminine gender is right 6 hole of photo cell, 37 DEG C of 5% CO₂Incubator culture 3~5 days, CPE is observed daily, and neutralization group and negative control group cell hole are equal Cytopathy should not occur, and cytopathy should occur in virus control group cell.Can protect 50% cell that lesion does not occur Serum highest extension rate, the neutralization titer as the serum.As it can be seen from table 1 the porcine epidemic diarrhea resisting virus of preparation Hyper-immune serum neutralization titer is 2⁶More than.How this also applies hyper-immune serum to provide foundation for after in vaccine potency assessment.

The anti-PEDV hyper-immune serum titration result of table 1

+: it represents cell and lesion occurs；: it represents cell and does not occur lesion

4 specific assay of embodiment

By tested serum with 2 times of DMEM nutrient solution dilute, respectively with 200TCID₅₀/0.1ml PEDV、 TGEV、CSFV、 PRV and PRRSV mixed in equal amounts is set 37 DEG C and is neutralized 1 hour, and the mixed liquor after neutralization is inoculated with the proliferative cell of above-mentioned virus respectively, It is followed successively by Vero, ST, PK, ST, Marc-145 cell monolayer, 96 porocyte plates, 6 hole, every 100 μ l of hole, while setting the disease not neutralized Malicious 6 hole of positive control cell and only 6 hole of inoculating cell maintaining liquid negative control cell, 37 DEG C of 5% CO2 incubator culture 3~5 Day, CPE is observed daily, and cytopathy should all not occur in neutralization group and negative control group cell hole, right without neutralization group and virus Cytopathy should occur according to group cell, swine fever virus is tested using immunofluorescence method.

Specificity experiments the result shows that, which can only neutralize with PEDV, and the inoculation of mixture after neutralization is thin Do not occur cytopathy after born of the same parents, after the mixture inoculating cell of other several serum and virus other than swine fever group, occurs Cytopathy.It is inoculated with the PK cell of serum swine fever mixture, fluorescence occurs (as schemed using the every hole of immunofluorescence assay 7).Neutralization cannot occur for the above results explanation, the hyper-immune serum and TGEV, CSFV, PRV and PRRSV, serum it is special Property is very strong.

5 safety examination of embodiment

It is each that serum 0.5ml is subcutaneously injected with 18~22g of weight small white mouse 5, it observes 10, work should all be good for.As a result table Bright: 10 days after the serum Mice Inoculated, mouse is still strong to live, without any clinical symptoms.

6 efficacy test of embodiment

Pig 30 with 14 ages in days with source without pig epidemic diarrhea neutralizing antibody, it is divided into three groups: first groups 10, every head Oral p55 plants of 1000 × MID/ml pig epidemic diarrhea (it is virulent that Fujian Academy provides the 4th generation tissue) 1ml, is injected simultaneously Serum 2ml prepared by the present invention；Second group 10, every oral p55 plants of (Fujian of 1000 × MID/ml Porcine epidemic diarrhea virus It is virulent that academy of agricultural sciences, province provides the 4th generation tissue) 1ml, while injecting by the Harbin PEDV attenuated vaccine strain CV777(veterinary institute Give, by Harbin veterinary institute by causing weak to form by Belgian PEDV is virulent) the hyper-immune serum 2ml(serum of preparation Potency is identical as the present invention)；Third group 10, only take orally p55 plants of (the Fujian Province's agricultures of 1000 × MID/ml Porcine epidemic diarrhea virus It is virulent that institute, section provides the 4th generation tissue) 1ml conduct control.Typical symptom of diarrhea should be occurred after injection by compareing pig in 1~3 day, and 7 In a few days at least 8 death.And first group and second group each 10 pig, it observes 7, at least 80% is strong living for qualification.Efficacy test knot Fruit (table 2) compares pig and occurs typical symptom of diarrhea in 3 days after injection, 10 all death in 7 days.And 10 of first group Pig is observed 7, all strong to live.Second group of pig is observed 7, and 3 death show hyper-immune serum prepared by the present invention to clinically Isolated p55 plants of therapeutic effects of PEDV are more preferable.

2 hyper-immune serum efficacy test result of table

Group	It is inoculated with species	Test piglet number	Observing time	Morbidity number	Cure rate
						1	PEDV(V-ZJ08 plants)+serum of the present invention	10	7	0	100%
2	PEDV(V-ZJ08 plants)+PEDV classics vaccine strain preparation serum	10	7	3	70%
						3	PEDV(V-ZJ08 plants)	10	7	10	-

The test of 7 storage life of embodiment

It is saved under the conditions of ZJ08 plants of hyper-immune serums of Porcine epidemic diarrhea virus are placed in -70 DEG C, in 1,3,6,9,12,15 A month measurement serum titer is carried out according to the method in embodiment 3.

The result shows that being saved 15 months under the conditions of -70 DEG C, serum neutralization titer 2^6.9, the serum keeping phase is set to -70 12 months (see Table 3)s are saved under the conditions of DEG C.

The titration result of -70 DEG C of 3 serum of table preservation different times

The different holding times

1 month

3 months

6 months

9 months

12 months

15 months

Serum neutralization titer

2^6.8

2^6.9

2^6.8

2^6.9

2^7.0

2^6.9

The above is only a preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art For member, without departing from the technical principles of the invention, several improvements and modifications can also be made, these improvements and modifications Also it should be regarded as protection scope of the present invention.

Sequence table

<110>BeiJing DaBei farm Science Group Co., Ltd's animal medicine research center

Fuzhou Dabeinong Bioisystech Co., Ltd

Beijing Ke Mufeng Biology Pharmacy Co., Ltd

BeiJing DaBei farm Science Group Co., Ltd

<120>porcine epidemic diarrhea resisting virus hyper-immune serum and preparation method thereof

<130>

<160> 6

<170> PatentIn version 3.3

<210> 1

<211> 20

<212> DNA

<213>artificial sequence

<400> 1

gtcttacatg cgaattgacc 20

<210> 2

<211> 20

<212> DNA

<213>artificial sequence

<400> 2

ggcatagaga gataatggca 20

<210> 3

<211> 20

<212> DNA

<213>artificial sequence

<400> 3

tcctagactt caaccttacg 20

<210> 4

<211> 20

<212> DNA

<213>artificial sequence

<400> 4

ggtgacaagt gaagcacaga 20

<210> 5

<211> 681

<212> DNA

<213>PEDV M gene

<400> 5

atgtctaacg gttttattcc cgttgatgag gtgattgaac accttagaaa ctggaatttc 60

acatggaata tcatactgac gatactactt gtagtgcttc agtatggcca ttacaagtac 120

tctgtgttct tgtatggtgt caagatggct attctatgga tactttggcc tcttgtgttg 180

gcactgtcac tttttgatgc atgggctagc ttccaggtca actgggtctt tttcgctttc 240

agcatcctta tggcttgcat cactcttatg ctgtggataa tgtattttgt caatagcatt 300

cggttgtggc gcaggacaca ttcttggtgg tctttcaatc ctgaaactga cgcgcttctc 360

actacttctg tgatgggccg acaggtctgc attccagtgc ttggagcacc aactggtgta 420

acgctaacac tccttagtgg tacattgttt gtagagggct ataaggttgc tactggcgta 480

caggtaagtc aattgcctga tttcgtcaca gtcgccaagg ccactacaac aattgtctat 540

ggacgtgttg gtcgttcagt caatgcttca tctggcactg gttgggcttt ctatgtccgg 600

tcaaaacacg gcgactactc agctgtgagt aatccgagtg cggttctcac agatagtgag 660

aaagtgcttc atttagtcta a 681

<210> 6

<211> 626

<212> DNA

<213> PEDV ZJ08 ORF3

<400> 6

atgtttcttg gactttttca atacacgatt gacacagttg tcaaagatgt ctcaaagtct 60

gctaacttgt ctttggatgc tgtccaagag ttggagctca atgtagttcc aattagacaa 120

gcttcaaatg tgacgggttt tcttttcacc agtgttttta tctacttctt tgcactgttt 180

aaagcgtctt ctttgaggcg caattatatt atgttggcag cgcgttttgc tgtcattgtt 240

ctttttgttg cacacttatt ggcaggcttt gtttagtctg cttttactcc tggcgctata 300

aaaatgcgct ctttattatc tttaatacta cgacactttc tttcctcaat ggtaaagcag 360

cttattatga cggcaaatcc attgtgattt tagaaggtgg tgaccattac atcacttttg 420

gcaactcttt tgttgctttc gttagtagca ttgacttgta tctagctata cgtgggcggc 480

aagaagccga cctacagctg ttgcgaactg ttgagcttct tgatggcaag aagctttatg 540

tcttttcgca acatcaaatt gttggcatta ctaatgctgc atttgactca attcaactag 600

acgagtatgc tacaattagt gaatga 626

Claims

1. a kind of porcine epidemic diarrhea resisting virus hyper-immune serum, for ZJ08 plants of CGMCC of Porcine epidemic diarrhea virus The inactivated vaccine of No.7806 is immunogene, and serum is separated from immune swine and is made.

2. hyper-immune serum as described in claim 1, which is characterized in that described ZJ08 plants of CGMCC of Porcine epidemic diarrhea virus The inactivated vaccine of No.7806 is that ZJ08 plants of Porcine epidemic diarrhea virus inactivations and oil adjuvant emulsification are prepared.

3. the preparation method of hyper-immune serum of any of claims 1 or 2 comprising following steps:

1) it is immunized: with the inactivated vaccine of Porcine epidemic diarrhea virus ZJ08 plants of CGMCC No.7806 of any of claims 1 or 2 It grows up binary pig for immunogen immune 50-60 age in days, immune for the first time: the total 4ml of intramuscular injection, second immune: in first time It carries out within 14 days after immune, immunizing dose 8ml, a point two o'clock is injected, and third time is immune: carrying out within 14 days after immune at second, be immunized Dosage 16ml, point 3 points of injections；

2) it takes a blood sample: 15~21 days after last time is immune, detecting neutralize antibody titers, reach 2⁹When above, the sterile bloodletting of pig is killed；

3) serum separation and preparation: with the fritter for sterilizing knife solidification blood being divided into 1-3 square centimeters, serum is filtered out, nothing is sub-packed in In bacterium normal saline bottle, remaining is placed in -70 DEG C of preservations.