CN103705918A - Porcine epidemic diarrhea virus resistant hyper-immune serum and preparation method thereof - Google Patents

Abstract

The invention discloses hyper-immune serum prepared by immunizing a hybridized pig with the age of 50-60 days by taking an inactivated vaccine of porcine epidemic diarrhea virus ZJ08 strain CGMCC No.7806 as an immunogen due to immunization for three times. The prepared hyper-immune serum is high in properties, high in specificity and high in safety and is not polluted by bacteria, moulds, mycoplasma and exogenous viruses, and the artificial infection cure rate is 100 percent. The neutralization titer of the serum is over 26, the serum is separately filled at the temperature of minus 70 DEG C, and the retention period is 12 months.

Description

Porcine epidemic diarrhea resisting virus hyper-immune serum and preparation method thereof

Technical field

The present invention relates to a kind of preparation method of antiviral serum, specifically a kind of porcine epidemic diarrhea resisting virus hyper-immune serum and preparation method thereof.

Background technology

Porcine epizootic diarrhea (Porcine epidemic diarrhea, PED) is a kind of acute, the viral infectious intestinal disease of contact that causes diarrhea of pigs, with watery diarrhea, vomiting, dehydration and appetite, drops to feature.PEDV can be in swinery sustainable existence, the equal susceptible of various age pig.The sickness rate of suckling pig, feeder pig and growing and fattening pigs can reach 100%, and especially serious with suckling pig, case fatality rate reaches 100%.This disease is a kind of virosis, there is no at present effective medicine method.Give in-pig vaccination, piglet can obtain resistance in the mode of passive immunity by colostrum, but along with the disappearance of maternal antibody or uneven, the resistance of piglet declines gradually or is different, the susceptibility of popularity diarrhoea also shows difference, once morbidity, just causes huge economic loss.Adopting hyper-immune serum to carry out mass treatment is that mode with passive immunity makes piglet adaptive immune power, reaches the object of protection piglet.So far, this method is feasible.Once but popular Porcine epidemic diarrhea virus strain morphs clinically, the hyper-immune serum therapeutic effect of preparation will weaken thus, the M & M of infected pigs will increase.

Summary of the invention

In order to address the above problem, the invention provides a kind of porcine epidemic diarrhea resisting virus hyper-immune serum and preparation method thereof.

First, the invention provides a kind of porcine epidemic diarrhea resisting virus hyper-immune serum, it is immunogen for take the inactivated vaccine of Porcine epidemic diarrhea virus ZJ08 strain CGMCC No.7806, and from immune swine, separation of serum makes.

Wherein, the inactivated vaccine of described Porcine epidemic diarrhea virus ZJ08 strain CGMCC No.7806 is for to be prepared from Porcine epidemic diarrhea virus ZJ08 strain deactivation and oily adjuvant emulsion.

The preparation method of the porcine epidemic diarrhea resisting virus hyper-immune serum described in the present invention also provides, comprises the steps:

1) immunity: take described Porcine epidemic diarrhea virus inactivated vaccine as the immunogen immune 50-60 age in days binary pig that grows up, immunity for the first time: intramuscular injection is 4ml altogether, immunity for the second time: carried out at immune latter 14 days for the first time, immunizing dose 8ml, divide 2 injections, immunity for the third time: carried out immunizing dose 16ml, minute 3 injections at immune latter 14 days for the second time;

2) blood sampling: latter 15～21 days of last immunity, detect NAT, reach 2 ⁹when above, kill the aseptic blood-letting of pig;

3) serum separation and preparation: solidification blood is divided into the fritter of 1-3 square centimeter with sterilization cutter, leaches serum, be sub-packed in physiological saline solution bottle, all the other are placed in-70 ℃ of preservations.

PEDV ZJ08 of the present invention strain is the pig epidemic diarrhea virus attenuated strain that applicant's virulent strain that one morbidity pig farm is separated to from Zhejiang obtains after a little less than 105 generations caused; it is current domestic PEDV epidemic strain; this vaccine strain virulence is stable; safety; immunogenicity is good; can resist the attack of popular virulent strain clinically at present, protective rate reaches more than 90%.

The PEDV 105-145 being separated to, for PEDV weakening strain called after Porcine epidemic diarrhea virus ZJ08 strain, is preserved in to China Committee for Culture Collection of Microorganisms's common micro-organisms center; Preservation address is: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, and Institute of Microorganism, Academia Sinica, deposit number is CGMCC No. 7806, the preservation time is on June 28th, 2013.

The present invention has successfully manufactured experimently out the hyper-immune serum of porcine epidemic diarrhea resisting virus, and its physical behavior is good, without antibacterial, mycete and mycoplasma growth, without exogenous virus, pollutes, and NAT is 2 ⁶doubly.Result of the test shows, this serum not only has higher antibody titer, but also has very strong specificity, and the requirement of serum standard for coincidence detection completely provides powerful for evaluating vaccine immunity effect.Serum effect assessment result shows, hyper-immune serum cure rate prepared by the present invention is higher.

Accompanying drawing explanation

Fig. 1 is PEDV CPE picture (400 *).

Fig. 2 is the separated malicious S gene PCR testing result of PEDV.In figure, 1: sample; 2: negative control; M:DNA Marker DL2000.

Fig. 3 is the separated malicious M gene PCR testing result of PEDV.In figure, 1: sample; 2: negative control; M:DNA Marker DL2000.

Fig. 4 is the separated malicious M Phylogenetic analysis result of PEDV.

Fig. 5 is the separated malicious ORF3 gene PCR testing result of PEDV.In figure, 1: sample; 2: negative control; M:DNA Marker DL2000.

Fig. 6 is different generation PEDV ORF3 sequence alignment results.

Figure 7 shows that hyper-immune serum of the present invention and swine fever virus (CSFV) immunofluorescence testing result.Wherein, A is the cell hole of inoculation PEDV hyper-immune serum and CSFV mixture; B is the cell hole of inoculating cell maintenance medium.

The specific embodiment

Following examples are used for illustrating the present invention, but are not used for limiting the scope of the invention.

The immunogenic preparation of embodiment 1 Porcine epidemic diarrhea virus ZJ08 strain

Get the positive small intestinal of Zhejiang Pig Farm epidemic diarrhea appropriate, scraping intestinal mucosa and content, according to the ratio of 1:5 (weight: volume) add PBS, multigelation 3 times, centrifuging and taking supernatant, 0.22 μ m membrane filtration, in filtrate, adding final concentration is the pancreatin of 20 μ g/ml, processes 1.5 hours for 37 ℃.

The Vero cell of monolayer is covered with in inoculation according to a conventional method, the ratio virus inoculation according to 10%, and 37 ℃ adsorb 1 hour, supply cell maintenance medium (containing the pancreatin of 10 μ g/ml), and 37 ℃ of incubators are cultivated.While reaching for the 17th generation, occur that obvious, stable CPE changes, the contracting of cell circle, granule increases, and poly-heap is grape cluster sample, and there is damage and come off (Fig. 1) in cell.

According to S gene design, detect primer pair: forward primer is 5 '-GGATACTTTGGCCTCTTGTG-3 '; Reverse primer is 5 '-CGCACTCGGATTACTCACAGC-3 ', 95 ℃ of denaturation 5min, and 95 ℃ of 45s, 50 ℃ of 1min, 72 ℃ of 2min carry out after 32 circulations, and 72 ℃ of 5min extend.PEDV amplified fragments is 484bp.The results are shown in Figure 2.

According to the gene order of PEDV in GenBank, design the primer of amplification M gene order:

PEDV-M-F: GTCTTACATGCGAATTGACC

PEDV-M-R: GGCATAGAGAGATAATGGCA

The size of the M genetic fragment of amplification is: 808 bp, the results are shown in Figure 3, and sequence is as shown in SEQ ID No.5.

Result shows, PEDV(ZJ08 strain) compare as Britain CV777 strain, Belgian Brl/87 strain, Korea S KPD-9F strain and Japanese JMe2 strain etc. with classical Reference Strains, not on an evolutionary branching, there is obvious variation (Fig. 4), be domestic newfound epidemic strain.

The primer of amplification ORF3 sequence is:

ORF3-F: TCCTAGACTTCAACCTTACG

ORF3-R: GGTGACAAGTGAAGCACAGA

The size of the fragment of the ORF3 of amplification is: 833 bp(Fig. 5).

By Porcine epidemic diarrhea virus 100 generations of continuous passage on Vero cell, and carried out clone purification in this process, then continued to be passaged to 145 generations on Vero cell.By the 145th generation virus carry out RT-PCR detection, amplification S genetic fragment is 484bp.PEDV ZJ08 strain ORF3 gene order starts ORF3 gene in the 105th generation and occurs suddenly the disappearance of 49 nucleotide, and the 105th generation, 125 generations, 145 generations keep stable disappearance 49 nucleotide (Fig. 6), and sequence is as shown in SEQ ID No.6.

By existing < < Chinese veterinary pharmacopoeia > > appendix to 105th ~ 145 generation virus carry out aseptic, mycoplasma and exogenous virus check, result is without antibacterial, mycete, mycoplasma and exogenous virus pollute.

Separation is caused to 105 ~ 145 weak generation weakening strain kind poison called after PEDV ZJ08 strains, and its microbial preservation number is CGMCC No. 7806; The preservation time is on June 28th, 2013; Depositary institution: China Committee for Culture Collection of Microorganisms's common micro-organisms center; Preservation address is: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica.

Get the 125th generation of PEDV ZJ08 strain and cell maintenance medium and be inoculated on the Vero cell that covers with monolayer in the ratio of 1:50, be placed in 37 ℃ of cultivations, when pathological changes appears in 80% cell, results virus, measures malicious valency, and (viral level is 10 ⁷tCID ₅₀/ ml), add 0.3% formaldehyde, be placed in 37 ℃ of constant incubator 24h and carry out deactivation, during shake for several times, add 3 times of gauging adjuvants, through emulsifying, be prepared into inactivated vaccine, 4 ℃ save backup.

Embodiment 2 serum preparations

1) immune programme for children

Immunity for the first time: intramuscular injection is 4ml altogether.

Immunity for the second time: carried out immunizing dose 8ml, minute 2 injections at immune latter 14 days for the first time.

Immunity for the third time: carried out immunizing dose 16ml, minute 3 injections at immune latter 14 days for the second time.

2) blood sampling

After last immunity 15～21 days, (first take a blood sample after 1 time, in employing and experimental technique survey serum titer, then blood-letting is lethal, 3～4 days, interval), pig is carried out to physical examination, without any disease patient, in the first 12 hours not feed material of taking a blood sample, but water restriction not.First by knife killing pig, feed position skin degerming, fill shallow basin vapor sterilization after cleaning of blood in advance.Aseptic blood-letting.

3) serum separation and preparation

Adopt the nature pressurization separation of serum that condenses.With sterilization cutter, solidification blood is divided into the fritter of 1 square centimeter, leaches serum, the capacity through vapor sterilization of being sub-packed in is in the normal saline bottle of 500 milliliters, and every bottle to take out 20ml tested, and all the other are placed in-70 ℃ of preservations.

After Porcine epidemic diarrhea virus ZJ08 strain deactivation, be prepared into immunogen with oily adjuvant emulsion, its NAT of 15 daily inspections after last immunity inoculation, reaches 2 ⁶above.Sterile blood sampling and separation of serum according to a conventional method subsequently, and serum semi-finished product have been carried out to pure property check.Result shows, in the serum of preparation, without antibacterial, mycete and mycoplasma growth, without exogenous virus, pollutes, and all meets the requirements.

Embodiment 3 serum titers are measured

With DMEM, tested hyper-immune serum is pressed to 1:2,1:16,1:32 ... 1:512 dilution, it is 200 TCID that each dilution factor serum all adds equivalent titre ₅₀the PEDV ZJ08 strain of/0.1ml, in 37 ℃ and 1 hour, 96 porocyte plate 6 holes that Vero cell monolayer is covered with in inoculation, every hole 100 μ l establish virus-positive control cells 6 holes that do not neutralize and inoculating cell maintenance medium negative control cell 6 holes only, 37 ℃ of 5% CO simultaneously ₂incubator is cultivated 3～5, observes CPE every day, and cytopathy all should not appear in neutralization group and negative control group cell hole, and cytopathy should appear in virus control group cell.Can protect 50% cell that the highly diluted multiple of serum of pathological changes does not occur, as the neutralization of this serum, tire.As can be seen from Table 1, the neutralization of the porcine epidemic diarrhea resisting of preparation virus hyper-immune serum is tired 2 ⁶above.This also provides foundation for how applying hyper-immune serum in vaccine potency assessment later.

The anti-PEDV hyper-immune serum of table 1 titration result

+: represent that pathological changes appears in cell;-: represent that pathological changes does not appear in cell

Embodiment 4 specificity checks

By 2 times of dilutions of DMEM nutritional solution for tested serum, respectively with 200TCID ₅₀/ 0.1ml PEDV, TGEV, CSFV, PRV and PRRSV mixed in equal amounts, put in 37 ℃ and 1 hour, mixed liquor after neutralization is inoculated respectively the proliferative cell of above-mentioned virus, be followed successively by Vero, ST, PK, ST, Marc-145 cell monolayer, 96 porocyte plate 6 holes, every hole 100 μ l, establish virus-positive control cells 6 holes that do not neutralize and inoculating cell maintenance medium negative control cell 6 holes only simultaneously, 37 ℃ of 5% CO2 incubator cultivated 3～5, observe CPE every day, all should not there is not cytopathy in neutralization group and negative control group cell hole, and do not neutralize group and virus control group cell should there is cytopathy, swine fever virus adopts immunofluorescence method to test.

Specificity experimental result shows, this hyper-immune serum can only neutralize with PEDV, after the mixture inoculating cell after neutralization, does not occur cytopathy, after other several serum and viral mixture inoculating cell, except swine fever group, all occurred cytopathy.The PK cell of inoculation serum swine fever mixture, adopts the every hole of immunofluorescence assay all to occur fluorescence (as Fig. 7).The above results explanation, all can not there is neutralization in this hyper-immune serum and TGEV, CSFV, PRV and PRRSV, and the specificity of serum is very strong.

Embodiment 5 safety examinations

With 5 of body weight 18～22g white mice, each subcutaneous injection serum 0.5ml, observes 10, all should be good for work.Result shows: after this serum Mice Inoculated 10 days, mice is strong living still, without any clinical symptoms.

Embodiment 6 efficacy tests

With 14 ages in days with source without 30 of the pigs of porcine epizootic diarrhea neutralizing antibody, be divided into three groups: first group 10, every draught animals takes 1000 * MID/ml porcine epizootic diarrhea p55 strain (Fujian Academy provides the 4th generation tissue strong poison) 1ml, injects serum 2ml prepared by the present invention simultaneously; Second group 10, every draught animals takes 1000 * MID/ml Porcine epidemic diarrhea virus p55 strain (Fujian Academy provides the 4th generation tissue strong poison) 1ml, inject by PEDV attenuated vaccine strain CV777(Harbin veterinary institute simultaneously and give, by Harbin veterinary institute, a little less than the strong poison of Belgian PEDV is caused, formed) the hyper-immune serum 2ml(serum titer prepared is identical with the present invention); The 3rd group 10,1ml in contrast in only oral 1000 * MID/ml Porcine epidemic diarrhea virus p55 strain (Fujian Academy provides the 4th generation tissue strong poison).Should after injection, in 1～3 day, there is typical symptom of diarrhea, at least 8 death in 7 days in contrast pig.And first group and second group of each 10 pig are observed 7, at least 80% strong living as qualified.Efficacy test result (table 2), there is typical symptom of diarrhea in injecting in latter 3 days in contrast pig, 10 all death in 7 days.And 10 pigs of first group are observed 7, all strong alive.Second group of pig observed 7, and 3 death show that hyper-immune serum prepared by the present invention is better to separated clinically PEDV p55 strain therapeutic effect.

Table 2 hyper-immune serum efficacy test result

Group	Inoculum kind	Test piglet number	Observing time	Morbidity number	Cure rate
							1	PEDV(V-ZJ08 strain)+serum of the present invention	10	7	0	100%
2	Serum prepared by the classical vaccine strain of PEDV(V-ZJ08 strain)+PEDV	10	7	3	70%
						3	PEDV(V-ZJ08 strain)	10	7	10	-

Embodiment 7 storage life tests

Porcine epidemic diarrhea virus ZJ08 strain hyper-immune serum is placed under-70 ℃ of conditions and is preserved, in 1,3,6,9,12,15 month, measure serum titer, according to the method in embodiment 3, carry out.

Result shows, under-70 ℃ of conditions, preserves 15 months, and serum neutralization tires 2 ^6.9, the serum keeping phase is decided to be under-70 ℃ of conditions and preserves 12 months (in Table 3).

The table 3 serum-70 ℃ titration result of preserving different time

The different holding times	1 month	3 months	6 months	9 months	12 months	15 months
							Serum neutralization is tired	2 6.8	2 6.9	2 6.8	2 6.9	2 7.0	2 6.9

The above is only the preferred embodiment of the present invention; it should be pointed out that for those skilled in the art, do not departing under the prerequisite of the technology of the present invention principle; can also make some improvements and modifications, these improvements and modifications also should be considered as protection scope of the present invention.

Sequence table

Animal medicine research center, <110> BeiJing DaBei farm Science Group Co., Ltd

Fuzhou Dabeinong Bioisystech Co., Ltd

Beijing Ke Mufeng Biology Pharmacy Co., Ltd

BeiJing DaBei farm Science Group Co., Ltd

<120> porcine epidemic diarrhea resisting virus hyper-immune serum and preparation method thereof

<130>

<160> 6

<170> PatentIn version 3.3

<210> 1

<211> 20

<212> DNA

<213> artificial sequence

<400> 1

gtcttacatg cgaattgacc 20

<210> 2

<211> 20

<212> DNA

<213> artificial sequence

<400> 2

ggcatagaga gataatggca 20

<210> 3

<211> 20

<212> DNA

<213> artificial sequence

<400> 3

tcctagactt caaccttacg 20

<210> 4

<211> 20

<212> DNA

<213> artificial sequence

<400> 4

ggtgacaagt gaagcacaga 20

<210> 5

<211> 681

<212> DNA

<213> PEDV M gene

<400> 5

atgtctaacg gttttattcc cgttgatgag gtgattgaac accttagaaa ctggaatttc 60

acatggaata tcatactgac gatactactt gtagtgcttc agtatggcca ttacaagtac 120

tctgtgttct tgtatggtgt caagatggct attctatgga tactttggcc tcttgtgttg 180

gcactgtcac tttttgatgc atgggctagc ttccaggtca actgggtctt tttcgctttc 240

agcatcctta tggcttgcat cactcttatg ctgtggataa tgtattttgt caatagcatt 300

cggttgtggc gcaggacaca ttcttggtgg tctttcaatc ctgaaactga cgcgcttctc 360

actacttctg tgatgggccg acaggtctgc attccagtgc ttggagcacc aactggtgta 420

acgctaacac tccttagtgg tacattgttt gtagagggct ataaggttgc tactggcgta 480

caggtaagtc aattgcctga tttcgtcaca gtcgccaagg ccactacaac aattgtctat 540

ggacgtgttg gtcgttcagt caatgcttca tctggcactg gttgggcttt ctatgtccgg 600

tcaaaacacg gcgactactc agctgtgagt aatccgagtg cggttctcac agatagtgag 660

aaagtgcttc atttagtcta a 681

<210> 6

<211> 626

<212> DNA

<213> PEDV ZJ08 ORF3

<400> 6

atgtttcttg gactttttca atacacgatt gacacagttg tcaaagatgt ctcaaagtct 60

gctaacttgt ctttggatgc tgtccaagag ttggagctca atgtagttcc aattagacaa 120

gcttcaaatg tgacgggttt tcttttcacc agtgttttta tctacttctt tgcactgttt 180

aaagcgtctt ctttgaggcg caattatatt atgttggcag cgcgttttgc tgtcattgtt 240

ctttttgttg cacacttatt ggcaggcttt gtttagtctg cttttactcc tggcgctata 300

aaaatgcgct ctttattatc tttaatacta cgacactttc tttcctcaat ggtaaagcag 360

cttattatga cggcaaatcc attgtgattt tagaaggtgg tgaccattac atcacttttg 420

gcaactcttt tgttgctttc gttagtagca ttgacttgta tctagctata cgtgggcggc 480

aagaagccga cctacagctg ttgcgaactg ttgagcttct tgatggcaag aagctttatg 540

tcttttcgca acatcaaatt gttggcatta ctaatgctgc atttgactca attcaactag 600

acgagtatgc tacaattagt gaatga 626

Claims (3)

1. a porcine epidemic diarrhea resisting virus hyper-immune serum, it is immunogen for take the inactivated vaccine of Porcine epidemic diarrhea virus ZJ08 strain CGMCC No.7806, from immune swine, separation of serum makes.

2. hyper-immune serum as claimed in claim 1, is characterized in that, the inactivated vaccine of described Porcine epidemic diarrhea virus ZJ08 strain CGMCC No.7806 is for to be prepared from Porcine epidemic diarrhea virus ZJ08 strain deactivation and oily adjuvant emulsion.

3. the preparation method of the hyper-immune serum described in claim 1 or 2, it comprises the steps:

1) immunity: the Porcine epidemic diarrhea virus inactivated vaccine of take described in claim 1 or 2 is the immunogen immune 50-60 age in days binary pig that grows up, immunity for the first time: intramuscular injection is 4ml altogether, immunity for the second time: carried out at immune latter 14 days for the first time, immunizing dose 8ml, divide 2 injections, immunity for the third time: carried out immunizing dose 16ml, minute 3 injections at immune latter 14 days for the second time;

2) blood sampling: latter 15～21 days of last immunity, detect NAT, reach 2 ⁹when above, kill the aseptic blood-letting of pig;

3) serum separation and preparation: solidification blood is divided into the fritter of 1-3 square centimeter with sterilization cutter, leaches serum, be sub-packed in physiological saline solution bottle, all the other are placed in-70 ℃ of preservations.

Images