CN103695532B - Early stage detection molecular marker of Angiostrongylus cantonensis disease and primer - Google Patents
Early stage detection molecular marker of Angiostrongylus cantonensis disease and primer Download PDFInfo
- Publication number
- CN103695532B CN103695532B CN201310491375.8A CN201310491375A CN103695532B CN 103695532 B CN103695532 B CN 103695532B CN 201310491375 A CN201310491375 A CN 201310491375A CN 103695532 B CN103695532 B CN 103695532B
- Authority
- CN
- China
- Prior art keywords
- primer
- mir
- angiostrongylus cantonensis
- seq
- early stage
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the field of biology, and relates to early stage detection molecular marker of early stage Angiostrongylus cantonensis disease, and primer and correlated kit thereof. The necessary composition of the diagnostic reagent contains: aca-miR-146a-5p sequence and three related primers (stem loop primer, upstream and downstream primer) designed according to the sequence design. The invention firstly provides an application of aca-miR-146a-5p in preparation for diagnosis of Angiostrongylus cantonensis disease. The diagnostic reagent can accurately and simply detect infection of Angiostrongylus cantonensis at early stage, and can distinguish between meningitis or encephalitis caused by Angiostrongylus cantonensis and other meningitis or encephalitis with good social and economic benefits.
Description
Technical field
This patent belongs to field of biology, relates to a kind of molecular marker that can be used as early stage angiostrongyliasis cantonensis early detection, and the primer and related kit.
Background technology
Angiostrongyliasis cantonensis is also known as eosinophilia's property meningoencephalitis.Be infected because having eaten the raw or not yet done freshwater snails meat containing angiostrongylus cantonensis larva, parasitized larvae causes a disease in central nervous system.Main clinical manifestation is meningitis, perimyelitis, encephalitis or myelitis, and in peripheral blood and cerebrospinal fluid, eosinophilic granulocyte quantity increases, and heavy person can have persistence height cranium pressure; Brain polarization is had to damage the corresponding performance caused; Small number of patients can be lethal or leave sequela.Angiostrongyliasis cantonensis by universally acknowledged be newly popular or popular again parasitic zoonoses, the Ministry of Health of China was also classified as emerging infectious disease in 2003.Make a definite diagnosis angiostrongyliasis cantonensis and need find polypide in patient's cerebrospinal fluid or its hetero-organization, but recall rate only has about 10.Usually this disease needs to rely on clinical symptom, epidemiologic data and immunology to carry out comprehensive diagnos.Current laboratory examination mainly contains following several approach:
One, Blood routine examination: total white blood cells is normal or increase, eosinophilic granulocyte can have increasing in various degree.
Two, examination of cerebrospinal fluid: cerebrospinal pressure increases, quantity of leucocyte and protein content increase; Eosinophilia.Sugar, muriate are without considerable change.Only a few case can be looked for and be seen larva or adult.
Three, immunologic test: conventional method is enzyme linked immunosorbent assay, and antibody positive can as auxiliary diagnosis.
Four, etiological examination: look into from cerebrospinal fluid, eye or other parasitic sites and see this worm larva or adult, but positive probability is minimum.
Five, imaging examination: head B-sonography performance varied, in myelencephalon multiple long strip shape or tubercle strengthening focus and pia mater strengthening be main performance.
As everyone knows, the immunodiagnosis of angiostrongyliasis cantonensis is main is detect specific antibody (protein level) in patients serum by ELISA method.And the change of microRNA is early than the appearance of change in protein and clinical symptom, is therefore suitable for the early diagnosis of disease.In addition owing to drawing materials conveniently, the microRNA in serum or cerebrospinal fluid has better application prospect than the microRNA of tissue.MicroRNA is a kind of length 20 ~ 24nt strand microRNA, and it is extensively present in various eucaryotic organism expresses tool timing and tissue specificity, plays an important role in the bioprocesss such as Growth of Cells, growth, differentiation, death.The approach that microRNA discharges into peripheral circulation is mainly considered to have to infiltrate through circulation from damaged cell at present, forms microvesicle and enters circulation, enter the different approach of circulation three kinds by emiocytosis.The microRNA enzyme liberating of resistance to RNA, steady in a long-term can exist, boils, the method such as multigelation, acid or alkali environment and long-term preservation all can not lose in serum or cerebrospinal fluid.External correlative study at present finds that miR-1 has diagnostic value for Acute Myocardial Infarction; MiR-15, miR-16 can be used for the diagnosis of lymphocytic leukemia; Let-7 has diagnostic significance to nonsmall-cell lung cancer; MiR-134 can be used as the diagnosis marker of pulmonary infarction.
MiR-146a-5p be a kind of typical multifunctional groups because of, mediated by its downstream gene, participate in various pathological processes, as inflammation, developing of immunity and tumour.Although microRNA has higher conservative property between various species, the sequence similarity namely between different plant species, incomplete same.
Summary of the invention
An object of the present invention is the molecular marker providing the microRNA of a kind of worm source property as angiostrongyliasis cantonensis early diagnosis.
Another object of the present invention is the primer being provided for detecting angiostrongyliasis cantonensis.
The primer that three of object of the present invention is to provide detection to adopt and molecular biology method.
First, invention provides and a kind ofly detects relevant molecular marked compound to angiostrongyliasis cantonensis, and its nucleotide sequence is as shown in SEQ ID NO:1.
Meanwhile, invention provides a kind of primer for detecting angiostrongyliasis cantonensis, it is characterized in that described primer sequence is as shown in SEQ ID NO:2, SEQ ID NO:3 and/or SEQ ID NO:4.
Gene as shown in SEQ ID NO:1, or as shown in SEQ ID NO:2, SEQ ID NO:3 and/or SEQ ID NO:4 primer, can be used for preparing angiostrongyliasis cantonensis detection reagent.
Invention provides a kind of angiostrongyliasis cantonensis detection kit simultaneously, it is characterized in that containing, for example the primer shown in SEQ ID NO:2, SEQ ID NO:3 and/or SEQ ID NO:4.Meanwhile, this test kit is characterized in that also can containing aca-miR-146a-5p in its amplified production.
The present invention carries out sequence alignment by the miR-146a-5p of species various in database mirbase, finding angiostrongylus cantonensis worm source property miR-146a-5p(aca-miR-146a-5p) sequence is for being UGAGAACUGAAUUCCAUAGGC, and humanized miR-146a-5p(hsa-miR-146a-5p) sequence is UGAGAACUGAAUUCCAUGGGUU, in view of both sequence end differences are comparatively large, specially designed three primers (comprising stem ring primer, upstream primer and downstream primer) can be utilized to differentiate.Experiment confirms, aca-miR-146a-5p detects the significant notation thing that people infects angiostrongylus cantonensis; And utilize primer of the present invention, relative disease can be detected with high specificity, rate of accuracy reached 96%.
The present invention is based on the design of above-mentioned molecular marked compound and primer, the detection method of Angiostrongylus cantonensis infection is substantially: in blood of human body, the aca-miR-146a-5p compared with high expression level amount detected, and namely this patient diagnosable is by Angiostrongylus cantonensis infection; In cerebrospinal fluid, the aca-miR-146a-5p compared with high expression level amount detected, meningitis or encephalitis that Angiostrongylus cantonensis infection causes can be diagnosed as.
More particularly, its step is extract patient suspected then to become CDNA then carrying out real-time quantitative PCR with a pair Auele Specific Primer with the specificity stem ring primer reverse transcription in the present invention with the total serum IgE in the serum (or cerebrospinal fluid) of normal people, with RNU6 as internal reference, judge that patient suspected is with or without Angiostrongylus cantonensis infection according to detected result.The present invention may be used for making diagnostic kit.
The invention discloses the diagnosis novel method of aca-miR-146a-5p in angiostrongyliasis cantonensis.Necessity composition of this diagnostic reagent comprises: aca-miR-146a-5p sequence and corresponding three primers (stem ring primer, upstream and downstream primer) according to this sequences Design.The present invention proposes aca-miR-146a-5p to be applied to the diagnosis preparing anti-angiostrongyliasis cantonensis first.This diagnostic reagent has and detects Angiostrongylus cantonensis infection in early days, accurately, easily, the advantage that the meningitis that Angiostrongylus cantonensis infection can be caused or encephalitis and other meningitis or encephalitis are differentiated, has good Social and economic benef@.
The present invention has following beneficial effect:
Adopt molecular marked compound of the present invention and relevant primer, can judge that whether detected object is by Angiostrongylus cantonensis infection exactly, accuracy rate is up to 96%.
Methods involving of the present invention can detect Angiostrongylus cantonensis infection in early days, accurately, simply, the patient infecting 3d can detect that the expression of aca-miR-146a-5p increases more than 5 times in blood, thus and early treatment, alleviate clinical symptom, reduce complication and sequela.
The meningitis that methods involving of the present invention can cause Angiostrongylus cantonensis infection or encephalitis are differentiated with other meningitis or encephalitis, in the cerebrospinal fluid of Angiostrongylus cantonensis infection patient, aca-miR-146a-5p expression amount obviously increases, increase more than 5 times, and in other encephalitis and other meningococcal infection patient, increasing does not appear in aca-miR-146a-5p, thus can be distinguished, and then takes effective treatment plan.
Accompanying drawing explanation
Fig. 1 is real-time quantitative fluorescence PCR amplification curve: the microRNA fluorescent PCR amplification curve being illustrated as standard;
Fig. 2 real-time fluorescence quantitative PCR solubility curve: the solubility curve in diagram is unimodal, illustrates that the primer specificity is good.
Embodiment
Description below by concrete embodiment illustrates the present invention further, but is not limitation of the present invention, only does example explanation.
embodiment 1
Design of primers
Angiostrongylus cantonensis worm source property miR-146a-5p(aca-miR-146a-5p is obtained in microRNA database mirbase retrieval) sequence is SEQ ID NO:1 (UGAGAACUGAAUUCCAUAGGC).
Design the reverse transcriptase primer SEQ ID NO:2:CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGCCTATGG with stem ring
The upstream and downstream primer of PCR in real time is respectively:
Upstream primer SEQ ID NO:3:ACACTCCAGCTGGGTGAGAACTGAATTCC
Downstream primer SEQ ID NO:4:TGGTGTCGTGGAGTCG
embodiment 2
The extracting of serum or cerebrospinal fluid total serum IgE
Get 200 HL serum or cerebrospinal fluid to without in RNA enzyme EP pipe, 12000rpm, 4 DEG C centrifugal 10 minutes, transfer supernatant goes in RNA enzyme EP pipe to another, add 1 milliliter of trizol, concuss five minutes, add chlorine alkane 200 microlitre, ten minutes are left standstill under normal temperature after mixing, 12000rpm, 4 DEG C centrifugal 15 minutes, another goes in RNA enzyme EP pipe to shift supernatant, add equal-volume Virahol, 15 minutes are left standstill under normal temperature after mixing, 35 minutes are left standstill under being placed in 4 DEG C of temperature again, 12000rpm, 4 DEG C centrifugal 10 minutes, abandon supernatant gently, then with 7200rpm after the washing with alcohol precipitation of 75%, 4 DEG C centrifugal 10 minutes, add 20 microlitres after abandoning air-dry 10 minutes to precipitate through depc process water dissolution.
embodiment 3
The brain lesions caused by angiostrongylus cantonensis needs and Viral encephalomeningitis, the discriminating of tuberculous meningoencephalitis and other cerebral parasitosiss: from making a definite diagnosis Angiostrongylus cantonensis infection patient 30 example and control group 30 example (Viral encephalomeningitis, tuberculous meningoencephalitis and each 10 examples of other cerebral parasitosiss patient) waist wears and obtains about one milliliter cerebrospinal fluid, after extracting RNA according to the method provided in embodiment 2, reverse transcription becomes CDNA, then real-time quantitative fluorescence PCR is carried out, the reaction conditions of real-time fluorescence quantitative PCR is: denaturation 95 DEG C, and the time is 10min; Sex change 95 DEG C, the time is 15sec, and annealing temperature is 60 DEG C, and the time is 30sec, elongating temperature 72 DEG C, and the time is 15sec, and cycle number is 40; Each sample carries out the test of multiple hole, and each detection reaction all needs to carry out melt curve analysis analysis immediately after loop ends, and detected temperatures is 70 DEG C ~ 95 DEG C, temperature rise rate is 0.4/DEG C time, constant temperature time is 1 sec/ time.Result shows: the solubility curve of real-time quantitative fluorescence PCR is unimodal (as shown in Figure 2), according to the Case definition that this test kit provides, namely aca-miR-146a-5p expression amount is five times, standard female sample or the above diagnosable meningitis that causes for angiostrongyliasis cantonensis or encephalitis, and this experiment show that the Sensitivity and Specificity of this method of inspection is respectively 96% and 94%.
embodiment 4
By serum early diagnosis angiostrongyliasis cantonensis
From making a definite diagnosis Angiostrongylus cantonensis infection patient 50 example and Normal group 50 people vein haemospasia about a milliliter, not anti-freezing normal temperature places four hours, 7500rpm, centrifugal five minutes, supernatant liquor is serum, draw 100 HL serum and extract RNA according to the method provided in embodiment 2, then the method that then carry out reverse transcription provides according to embodiment 3 carries out real-time quantitative fluorescence PCR, according to the Case definition that this test kit provides, namely aca-miR-146a-5p expression amount be five times, standard female sample or above diagnosable be angiostrongyliasis cantonensis, this experiment show that Sensitivity and Specificity is respectively 96% and 92%.
Claims (4)
1. as shown in SEQ ID NO:1 gene as the application on angiostrongyliasis cantonensis molecular marked compound.
2., for detecting a primer for angiostrongyliasis cantonensis, it is characterized in that described primer sequence is as shown in SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4.
3. as shown in SEQ ID NO:2, SEQ ID NO:3 and/or SEQ ID NO:4, primer is preparing the application in angiostrongyliasis cantonensis detection reagent.
4. an angiostrongyliasis cantonensis detection kit, is characterized in that containing, for example the primer shown in SEQ ID NO:2, SEQ ID NO:3 and/or SEQ ID NO:4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310491375.8A CN103695532B (en) | 2013-10-18 | 2013-10-18 | Early stage detection molecular marker of Angiostrongylus cantonensis disease and primer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310491375.8A CN103695532B (en) | 2013-10-18 | 2013-10-18 | Early stage detection molecular marker of Angiostrongylus cantonensis disease and primer |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103695532A CN103695532A (en) | 2014-04-02 |
| CN103695532B true CN103695532B (en) | 2015-03-04 |
Family
ID=50357194
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310491375.8A Active CN103695532B (en) | 2013-10-18 | 2013-10-18 | Early stage detection molecular marker of Angiostrongylus cantonensis disease and primer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103695532B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109554481B (en) * | 2018-09-30 | 2021-11-23 | 中山大学 | Application of miR-101b-3p in diagnosis and adjuvant therapy of angiostrongylus cantonensis |
| CN109943641A (en) * | 2019-01-18 | 2019-06-28 | 苏州上源生物科技有限公司 | It is accurate to identify pure deletion mutation, three-primer group of heterozygosis nematode and PCR discrimination method |
| CN109576381A (en) * | 2019-01-18 | 2019-04-05 | 苏州上源生物科技有限公司 | It is accurate to identify pure insertion mutation, three-primer group of heterozygosis nematode and PCR discrimination method |
| CN113341009B (en) * | 2021-05-25 | 2023-09-08 | 海南医学院 | Early diagnosis urine biomarker for Guangzhou pipe-line nematode disease and application thereof |
| CN114923995A (en) * | 2022-04-21 | 2022-08-19 | 中山大学 | Guangzhou angiostrongyliasis diagnosis biomarker and application thereof |
| CN115192710A (en) * | 2022-05-27 | 2022-10-18 | 华南理工大学 | Application of miRNA-200s protective agent in preparation of nervous system disease drugs, drugs and model construction method |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101824474A (en) * | 2010-03-31 | 2010-09-08 | 中国疾病预防控制中心寄生虫病预防控制所 | Kit and method for detecting angiostrongylus cantonensis in pomacea canaliculata |
| CN101875965A (en) * | 2009-04-28 | 2010-11-03 | 周卫川 | TaqMan probe for real-time fluorescence PCR (Polymerase Chain Reaction) detection of angiostrongylus cantonensis infected snails |
-
2013
- 2013-10-18 CN CN201310491375.8A patent/CN103695532B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101875965A (en) * | 2009-04-28 | 2010-11-03 | 周卫川 | TaqMan probe for real-time fluorescence PCR (Polymerase Chain Reaction) detection of angiostrongylus cantonensis infected snails |
| CN101824474A (en) * | 2010-03-31 | 2010-09-08 | 中国疾病预防控制中心寄生虫病预防控制所 | Kit and method for detecting angiostrongylus cantonensis in pomacea canaliculata |
Non-Patent Citations (2)
| Title |
|---|
| Identification and characterisation of microRNAs in young adults of Angiostrongylus cantonensis via a deep-sequencing approach;Shih-Hsin Chang et.al;《Mem Inst Oswaldo Cruz, Rio de Janeiro》;20130930;699-706 * |
| miR-146a-5p circuitry uncouples cell proliferation and migration, but not differentiation, in human mesenchymal stem cells;JY Hsiehet.al;《Nucl. Acids Res》;20130802;摘要 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103695532A (en) | 2014-04-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103695532B (en) | Early stage detection molecular marker of Angiostrongylus cantonensis disease and primer | |
| CN101225441B (en) | Method for detecting genetic constitution of clone-specific T lymphocyte TCR BV CDR3 | |
| CN102002531B (en) | Toxoplasma gondii detection kit and application thereof | |
| CN104450901B (en) | The nucleic acid markers of quick diagnosis mucocutaneous lymphnode syndrome and test kit thereof | |
| CN101608242A (en) | A kind of H3 subtype flu quick-detecting type classifying method based on the RT-LAMP technology | |
| CN103805696A (en) | Micro RNA (Ribonucleic Acid) molecular marker for diagnosing rheumatoid arthritis and detection kit thereof | |
| CN101845516B (en) | Real-time quantitative PCR detection method for red-sea bream iridovirus | |
| CN102618669A (en) | Kit for quickly examining loop SFTSV (severe fever with thrombocytopenia syndrome bunyavirus) mediated isothermal amplification of severe fever with thrombocytopenia syndrome bunyavirus | |
| CN105543394A (en) | miR-106b-5p, detection primer thereof and application of antisense nucleotide sequence thereof in fields of ischemic cerebral stroke diagnosis and treatment | |
| CN103320435B (en) | Listeria monocytogenes LAMP (loop-mediated isothermal amplification) detection kit containing internal standard | |
| CN102534051B (en) | Kit for detecting enterovirus | |
| CN101200767A (en) | Method for detecting peripheral blood specific T lymphocyte | |
| CN102876809B (en) | GCRV (grass carp reovirus) RT-PCR (reverse transcription-polymerase chain reaction) detection reagent kit and detection method | |
| CN104195254B (en) | Method based on loop-mediated isothermal amplification technique detection Herba Equiseti Hiemalis's Fusariumsp and Primer composition | |
| CN105821159A (en) | Nested RT-PCR detection method for differentiating variant strains and classic strains of PEDV | |
| CN104630328B (en) | Mycoplasma pneumoniae 23S rRNA 2064 site A:G mutation detection specific primer and probe | |
| CN102876811A (en) | RT-LAMP (reverse transcription loop-mediated isothermal amplification) detection kit and RT-LAMP detection method for SVCV (spring viremia of carp virus) | |
| CN111733227B (en) | Molecular marker circRNA for diagnosing idiopathic optic neuritis, kit and application | |
| CN105112514B (en) | GNAS detection in Gene Mutation reagent | |
| CN100567506C (en) | A kind of H5 subtype avian influenza virus detection kit and application thereof | |
| CN103509873A (en) | PCR rapid diagnostic reagent kit for babesia bigemina disease of cattle | |
| CN104655859A (en) | Breast cancer diagnosis marker | |
| CN104878118A (en) | Method for detecting rabbit dermatophyte and trichophyton mentagrophytes through dual quantitative PCR detection | |
| CN102943130B (en) | LAMP (Loop-medicated isothermal amplification) detection kit for metapneumovirus | |
| CN105039331A (en) | Peronophythora litchi LAMP primer as well as rapid detection method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |