CN103667273B - Double-stranded adapters, its application and build end pairing DNA library method - Google Patents

Abstract

The invention discloses a kind of method proposed double-stranded adapters, its application and build end pairing DNA library.Double-stranded adapters comprises joint A and joint B, and joint A and joint B comprises a LoxP sequence and respectively by equidirectional for LoxP sequence the auxiliary sequencel being connected to the DNA fragmentation two ends for the treatment of cyclisation.Apply technical scheme of the present invention, based on Cre recombinase/LoxP action system characteristic (when two LoxP sequences are positioned on a DNA chain, and direction is identical, Cre recombinase effectively can excise the sequence between two LoxP sites, and the sequence of cut-out realizes the cyclisation of DNA long segment by automatically circularizing state) the doubly-linked joint that designs, the mode of being cloned by T-A is connected to the two ends of the DNA fragmentation for building end pairing DNA library efficiently, then adopts Cre recombinase system can be used in the DNA fragmentation cyclisation building end pairing DNA library efficiently.

Description

Double-stranded adapters, its application and build end pairing DNA library method

Technical field

The present invention relates to high throughput sequencing technologies field, in particular to a kind of double-stranded adapters, its application and the method building end pairing DNA library.

Background technology

Full-length genome Denovo checks order also referred to as genome de novo sequencing, it does not rely on existing sequence information, directly the genome of certain species is checked order, and sequence is spliced by information biology means, assembles, thus obtain the Genome Atlas of these species.By carrying out systematic study to certain species whole genome sequence, this species gene group and important functional gene sequence information can be obtained, resolve the evolutionary history of these species, illustrate that this species growth is grown, the generation of important character and the molecular mechanism that conforms.

Two generations order-checking occur before, utilize generation Sanger sequencing technologies, several model animalss as: the full-length genome plan of Arabidopis thaliana, paddy rice, mouse and nematode etc. is also accomplished.But this sequencing technologies speed is slow, flux is low, cost too expensive, scientists can not be met far away for the numerous demand with the full-length genome plan of important scientific research and economic worth species of comprehensive analysis.Along with 454, the appearance of IIlumina and SOLid etc. two generation sequencing technologies, a lot of Denovo sequencing project by two generation sequencing technologies complete.In above-mentioned three kinds of order-checking platforms, Illumina order-checking has that high-throughput, accuracy are high, unit data low cost and other advantages concurrently, succeeds in developing and after widespread use, become the first-selection of animal-plant gene group order-checking at short data records splicing composite software.Technical team headed by Li Ruiqiang etc. develops software for IIlumina sequencing technologies, start the short beginning how long being used for the assembling of animal-plant gene group, and utilize this technology to complete the assembling of multiple important gene group, as panda genome, Cucumber germplasm, potato gene group etc.。Genome Denovo based on this two generations order-checking checks order and assemble method, need to obtain this species gradient Insert Fragment literature data: the genomic library that 180bp, 300bp and 500bp small segment literature data and 2 ~ 20K derive from long Insert Fragment two ends end pairing (mate-paired) carries out contig (contig) assembling and genome skeleton (scaffold) splicing, the library of the long Insert Fragment of DNA.The order-checking of genome mate-pairedDNA library is by long Insert Fragment library construction and checks order, and obtains the sequence compared with span section two ends in genome.The assembling of the larger genome of this sequence pair from obtaining compared with large span two ends or complex genome and genome structure variation excavation have very important effect.The key building genome ends pairing (mate-paired) DNA library is how long segment (2K, 5K, 10K, 20K) two ends are successfully realized intramolecular cyclization, and ensures certain cyclisation efficiency.The cyclisation in conventional mate-pairedDNA library is that the mode connected in the molecule by flat end connects realization, this banking process not only cyclisation efficiency is low, and more difficult which sequence of effective resolution, for deriving from connection site two ends, brings difficulty to the genomic comparison in later stage and assembling after order-checking.

Summary of the invention

The present invention aims to provide a kind of double-stranded adapters, its application and builds the method for end pairing DNA library, low with the construction process not only cyclisation efficiency solving Mate-pairedDNA library in prior art, and after order-checking, more difficult which sequence of effective resolution derives from the technical problem at connection site two ends.

According to an aspect of the present invention, a kind of double-stranded adapters is provided.This double-stranded adapters comprises joint A and joint B, and joint A and joint B comprises a LoxP sequence and respectively by equidirectional for LoxP sequence the auxiliary sequencel being connected to the DNA fragmentation two ends for the treatment of cyclisation.

Further, LoxP sequence in joint A is forward LoxP sequence, auxiliary sequencel in joint A comprises the sticky end being positioned at forward LoxP Sequences upstream, and be positioned at forward LoxP sequence downstream there is 3 ' outstanding T end, 5 ' end, first base of joint A two chains has carried out phosphorylation modification respectively, and the 32nd bit base T of forward LoxP sequence has carried out biotin labeling; LoxP sequence in joint B is reverse LoxP sequence, auxiliary sequencel in joint B comprises the sticky end being positioned at reverse LoxP Sequences upstream, and be positioned at reverse LoxP sequence downstream there is 3 ' outstanding T end, 5 ' end, first base of joint B two chains has carried out phosphorylation modification respectively, and oppositely the 32nd bit base T of LoxP sequence has carried out biotin labeling.

Further, as shown in Figure 1, the base sequence of joint B as shown in Figure 2 for the base sequence of joint A.

Further, double-stranded adapters comprises: by the base sequence in Fig. 1 except forward LoxP sequence through the replacement of one or several base and/or disappearance and/or interpolation and the nucleotide sequence of tool and joint A said function; And by the base sequence in Fig. 2 except reverse LoxP sequence through the replacement of one or several base and/or disappearance and/or interpolation and the nucleotide sequence of tool and joint B said function.

According to another aspect of the present invention, a kind of above-mentioned double-stranded adapters is provided to build the application in end pairing DNA library.

According to a further aspect of the invention, a kind of method building end pairing DNA library is provided.The method DNA fragmentation comprised for building end pairing DNA library carries out the step of cyclisation, the step that DNA fragmentation for building end pairing DNA library carries out cyclisation comprises: be connected with the double-stranded adapters any one of Claims 1-4 by the DNA fragmentation being used for building end pairing DNA library, obtain connecting product; The DNA fragmentation connected in product adopts Cre recombinase system to carry out cyclisation.

Further, the method building end pairing DNA library specifically comprises the following steps: S1, genomic dna is used physics mode random fragmentation, and enrichment is for building the DNA fragmentation of end pairing DNA library; S2, carry out end-filling to the DNA fragmentation that enrichment in step S1 obtains, then end adds dATP, purifying; S3, the product obtained by step S2 and double-stranded adapters add linked system, carry out ligation; S4, carries out electrophoretic separation to the connection product that step S3 obtains, cuts target stripe, reclaims purifying; S5, gets the product that step S4 obtains and adopts Cre recombinase system to carry out cyclisation; S6, digests the product of cyclisation non-in step S5; S7, carries out fragmentation to the product in step S6, makes DNA fragmentation size concentrate between 350 ~ 650bp; S8, utilizes the affine magnetic bead of Streptomycin sulphate to carry out enrichment in the product of step S7 with the sequence of biotin labeling joint; S9, carry out end reparation to the product of step S8, then end adds dATP; S10, adds order-checking joint used to the product of step S9; S11, utilizes sequencing primer to carry out pcr amplification to the product of step S10; S12, by the product electrophoretic separation of step S11, cuts the DNA fragmentation between 350 ~ 650bp, recovery, purifying, obtains end pairing DNA library.

Further, the joint used that checks order in step S10 is that illumina checks order joint used, P5 and P7 that the sequencing primer in step S11 provides for illumina.

Further, step S5 comprises, and the product first obtained by step S4 carries out quantitatively, then gets 200 ~ 300ng product and adopts Cre recombinase system to carry out cyclisation.

Further, step S9, S10 and S11 all carry out on magnetic bead.

Apply technical scheme of the present invention, based on Cre recombinase/LoxP action system characteristic (when two LoxP sequences are positioned on a DNA chain, and direction is identical, Cre recombinase effectively can excise the sequence between two LoxP sites, and the sequence of cut-out realizes the cyclisation of DNA long segment by automatically circularizing state) the doubly-linked joint that designs, the mode of being cloned by T-A is connected to the two ends of the DNA fragmentation for building mate-pairedDNA library efficiently, then Cre recombinase system is adopted can be used in the DNA fragmentation cyclisation building mate-pairedDNA library efficiently.

Accompanying drawing explanation

The Figure of description forming a application's part is used to provide a further understanding of the present invention, and schematic description and description of the present invention, for explaining the present invention, does not form inappropriate limitation of the present invention.In the accompanying drawings:

Fig. 1 shows the structural representation of joint A;

Fig. 2 shows the structural representation of joint B;

Fig. 3 shows the band agarose gel electrophoresis figure (cut glue and reclaim front and back) of the broken target sizes of genome in embodiment 1;

2100 biological analysers (Agilent2100bioanalyzer) that Fig. 4 shows the Mate-pairedDNA library Agilent company obtained in embodiment 1 detect 2100 detection Insert Fragment distribution plans; And

Fig. 5 shows personality analysis mate-pairedDNA library, Mate-pairedDNA library final Insert Fragment size (insert-size) distribution plan obtained in embodiment 1.

Embodiment

It should be noted that, when not conflicting, the embodiment in the application and the feature in embodiment can combine mutually.Below with reference to the accompanying drawings and describe the present invention in detail in conjunction with the embodiments.

In order to the construction process not only cyclisation efficiency solving Mate-pairedDNA library in prior art is low, and after order-checking, more difficult which sequence of effective resolution derives from the technical problem at connection site two ends, inventors herein proposes technical scheme of the present invention.

According to a kind of typical embodiment of the present invention, a kind of double-stranded adapters is provided, this double-stranded adapters comprises joint A and joint B, and joint A and joint B comprises a LoxP sequence and respectively by equidirectional for LoxP sequence the auxiliary sequencel being connected to the DNA fragmentation two ends for the treatment of cyclisation.

Apply technical scheme of the present invention, based on Cre recombinase/LoxP action system characteristic (when two LoxP sequences are positioned on a DNA chain, and direction is identical, Cre recombinase effectively can excise the sequence between two LoxP sites, and the sequence of cut-out realizes the cyclisation of DNA long segment by automatically circularizing state) the doubly-linked joint that designs, the mode of being cloned by T-A is connected to the two ends of the DNA fragmentation for building mate-pairedDNA library efficiently, then Cre recombinase system is adopted can be used in the DNA fragmentation cyclisation building mate-pairedDNA library efficiently.

And, application Cre-LoxP system constructing mate-paired library, long Insert Fragment two ends are distinguished by the joint sequence added, that is: the both sides sequence of joint sequence must be the sequence that long segment derives from two ends, and after solving order-checking, more difficult which sequence of effective resolution derives from the technical problem at connection site two ends.

Preferably, double-stranded adapters comprises joint A and joint B, wherein, LoxP sequence in joint A is forward LoxP sequence, auxiliary sequencel in joint A comprises the sticky end being positioned at forward LoxP Sequences upstream, and be positioned at forward LoxP sequence downstream there is 3 ' outstanding T end, 5 ' end, first base of joint A two chains has carried out phosphorylation modification respectively, and the 32nd bit base T of forward LoxP sequence has carried out biotin labeling; LoxP sequence in joint B is for comprising reverse LoxP sequence, auxiliary sequencel in joint B comprises the sticky end being positioned at reverse LoxP Sequences upstream, and be positioned at reverse LoxP sequence downstream there is 3 ' outstanding T end, 5 ' end, first base of joint B two chains has carried out phosphorylation modification respectively, and oppositely the 32nd bit base T of LoxP sequence has carried out biotin labeling.

Because have the sticky end being positioned at forward LoxP Sequences upstream according to the double-stranded adapters of the specific embodiment of the invention, the efficient linked system of T-A therefore can be adopted.Treat that the DNA fragmentation end of cyclisation adopts and add dATP, certain density joint can be connected efficiently with target fragment.Equally, 3 ' the outstanding T end that has of forward LoxP sequence downstream is be convenient to carry out T-A with DNA fragmentation be connected equally.5 ' end, first base of joint A two chains has carried out phosphorylation modification respectively, ensure the carrying out of connection and cyclization, and the 32nd bit base T of forward LoxP sequence has carried out biotin labeling, so that cyclisation follow-up build in storehouse, by after secondary breaking with connect mould avidin magnetic bead by target fragment enrichment.

In order to prevent the vitamin H group modified from affect the connection (space occupy-place) of connector end, close sticky end exceeds the scope of 6 bases as far as possible, has therefore carried out biotin labeling at the base T of the 32nd most suitable.

Why selection biotin labeling, build the cyclized by treatment and biotinylated nucleic acid fragment (with joint A or B for boundary, the sequence at two ends is the two ends of derived long chain DNA to this fragment) after secondary breaking of storehouse process because building for convenience in storehouse to adopt Streptavidin MagneSphere to be separated.The bonding force height very (Kd=10-15) of Streptavidin and vitamin H, therefore has application widely.This magnetic bead to be diameter that is homogeneous, superparamagnetism be magnetic bead of 2.8 μm, surface is the restructuring Streptavidin of covalently bound individual layer (and non-multilayer), and closes with BSA.The Streptavidin of individual layer can produce the binding site of maximum biologies, is not only conducive to the combination of free vitamin H, also no problem for catching of biotinylated ligands.This magnetic bead has liquid phase reaction kinetics fast.Just because of Streptavidin MagneSphere has unique and specific surface, therefore catch, be separated and the operation in downstream all very efficient.Individual layer can ensure that not having Streptavidin falls down from magnetic bead surfaces, does not have unnecessary Streptavidin absorption simultaneously, and the consistence between ensure that batch, guarantees the result tested.

According to a kind of typical embodiment of the present invention, as shown in Figure 1, the base sequence of joint B as shown in Figure 2 for the base sequence of joint A.Wherein, base sequence such as lower part as shown in Figure 1 forms: 5 ' end P of forward and reverse strand represents that first base has carried out phosphorylation modification; Sequence in maximum square frame is the LoxP sequence of forward, the square frame comprising 8 pairs of bases shows in LoxP sequence the 8 pairs of bases determining direction, the base of 13 inverted repeats of these 8 pairs of base both sides is the binding domain of Cre enzyme, and in maximum square frame, the 3rd base T reciprocal is the base of biotin modification; The base T of the outer little square frame mark of maximum square frame is used for carrying out T-A with target DNA fragments and is connected (sequence of double-strand is respectively: SEQIDNO1:5 '-CGATAACTTCGTATAATGTATGCTATACGAAGTTATACGT-3 ', SEQIDNO2:3 '-CCAGCTATTGAAGCATATTACATACGATATGCTTCAATATGC-5 ').Such as the lower part of base sequence as shown in Figure 2 forms: 5 ' end P of forward and reverse strand represents that first base has carried out phosphorylation modification; Sequence in maximum square frame is reverse LoxP sequence, the square frame comprising 8 pairs of bases shows in LoxP sequence the 8 pairs of bases determining direction, the base of 13 inverted repeats of these 8 pairs of base both sides is the binding domain of Cre enzyme, and in maximum square frame, the 3rd base T reciprocal is the base of biotin modification; The base T of the outer little square frame mark of maximum square frame is used for carrying out T-A with target DNA fragments and is connected (sequence of double-strand is respectively: SEQIDNO3:5 '-GCATAACTTCGTATAGCATACATTATACGAAGTTATAGCT-3 ', SEQIDNO4:3 '-CCACGTATTGAAGCATATCGTATGTAATATGCTTCAATATCG-5 ').

According to the alternative embodiment of the present invention, positive/negatively to LoxP sequence downstream, there is 3 ' outstanding T not changing, positive/negative 5 ' terminal phosphateization is modified, and the 31st or 32 bit base T of forward and reverse LoxP sequence carried out biotin labeled principle under the amendment made.This double-stranded adapters comprises the replacement and/or disappearance and/or interpolation and the nucleotide sequence of tool and joint A said function of the base sequence in Fig. 1 except forward LoxP sequence being passed through one or several base; And by the base sequence in Fig. 2 except reverse LoxP sequence through the replacement of one or several base and/or disappearance and/or interpolation and the nucleotide sequence of tool and joint B said function.

According to a kind of typical embodiment of the present invention, a kind of above-mentioned double-stranded adapters is provided to build the application in mate-pairedDNA library.

According to a kind of typical embodiment of the present invention, provide a kind of method building Mate-pairedDNA library.The method DNA fragmentation comprised for building Mate-pairedDNA library carries out the step of cyclisation, the step that DNA fragmentation for building Mate-pairedDNA library carries out cyclisation comprises: be connected with the double-stranded adapters any one of Claims 1-4 by the DNA fragmentation being used for building Mate-pairedDNA library, obtains connecting product; The DNA fragmentation connected in product adopts Cre recombinase system to carry out cyclisation.

Preferably, the method building Mate-pairedDNA library specifically comprises the following steps:

S1, by the mode random fragmentation of genomic dna physics, enrichment is for building the DNA fragmentation in Mate-pairedDNA library;

S2, carry out end-filling to the DNA fragmentation that enrichment in step S1 obtains, then end adds dATP, purifying;

S3, the product obtained by step S2 and above-mentioned double-stranded adapters add linked system, carry out ligation;

S4, carries out electrophoretic separation to the connection product that step S3 obtains, cuts target stripe, reclaims purifying;

S5, gets the product that step S4 obtains and adopts Cre recombinase system to carry out cyclisation;

S6, digests the product of cyclisation non-in step S5, and the product of wherein non-cyclisation includes single stranded DNA and double-stranded DNA;

S7, carries out fragmentation to the product in step S6, makes DNA fragmentation size concentrate between 350 ~ 650bp;

S8, utilizes the affine magnetic bead of Streptomycin sulphate to carry out enrichment in the product of step S7 with the sequence of biotin labeling joint;

S9, carry out end reparation to the product of step S8, then end adds dATP;

S10, adds order-checking joint used to the product of step S9;

S11, utilizes sequencing primer to carry out pcr amplification to the product of step S10;

S12, by the product electrophoretic separation of step S11, cuts the DNA fragmentation between 350 ~ 650bp, and recovery, purifying, obtain Mate-pairedDNA library.

Preferably, the joint used that checks order in step S10 is that illumina checks order joint used, P5 and P7 that the sequencing primer in step S11 provides for illumina, makes the library of structure successfully can check order on IIlumina checks order platform.

Preferably, step S5 comprises further, and the product first obtained by step S4 carries out quantitatively, then gets 200 ~ 300ng product and adopts Cre recombinase system to carry out cyclisation.Why select this scope, be because enough intramolecular cyclization spaces (same molecule two ends cyclisation) should be ensured within the scope of this, prevent intermolecular linearly connected again.

Preferably, step S9, S10 and S11 all carry out on magnetic bead, use Streptavidin MagneSphere to reach the object of the target DNA fragments of enriched biological mark.

In order to detect the Mate-pairedDNA library obtained and check order, technical scheme of the present invention comprise further 2100 detections are carried out to the Mate-pairedDNA library of the above-mentioned acquisition of step and Q-PCR quantitative, and adopt the Hiseq2000 of Illumina company order-checking platform to check order, information biology carries out personalization assessment to this library, determines indices.

In a kind of typical embodiment of the present invention, the method for above-mentioned mate-pairedDNA library construction, in step S1, genomic dna used is the DNA of any material of 20 μ g, comprises animal, plant, microorganism etc.The broken instrument of DNA is Digilab company plusDNAShearingDevice.

The enzyme used that fills of step S2 is: T4DNA polysaccharase, 0.2U/ μ l, T4 polynueleotide kinase, final concentration 0.5U/ μ l; Add dATP enzyme used: Klenow (3 '-5 ' exo ^-), final concentration 0.5U/ μ l; DATP final concentration: 0.2mM.

The final concentration of joint A and B that step S3 is used: 0.1 μM, ligase enzyme: T ₄dNA quick ligase (Rapidligase), the concentration of ligase enzyme in linked system is 30U/ μ l.

Step S4 product reclaims MinElutePCRPurificationKit(QIGEN used) test kit.

Step S5 quantitatively takes Qubit quantitative; Cyclisation system is: the final concentration of product 300ng, Cre enzyme (NEB) is 0.1U/ μ l.

Step S6 single stranded DNA and double-stranded DNA carry out digestion system: ATP final concentration 44mM; Depend on linear double stranded nucleic acid digestive ferment (Plasmid-SafeATP-DependentDnase) the final concentration 0.5U/ μ l of ATP; Single stranded exonucleases (ExonucleaseI) final concentration 0.6U/ μ l.

Step S7 adopts CovarisS220 that the DNA molecular of cyclisation is carried out fragmentation.

Adopt in step S8 m-270streptavidinmagneticbeads carries out enrichment in the product of step S7 with the sequence of biotin labeling joint.

Step S9 end repairs system: T4DNA polysaccharase final concentration 0.2U/ μ l; T4 polynueleotide kinase final concentration 0.5U/ μ l; DNTP final concentration 0.4mM; Add dATP system: Klenow (3 '-5 ' exo ^-), final concentration 0.5U/ μ l; DATP final concentration 0.2mM.

Sequence measuring joints system is added: T4DNA ligase enzyme final concentration 60U/ μ l in step S10; Joint (adaptor, containing Index) final concentration 0.5 μM.

Step S11PCR system: 5X reactionBuffer(NEB) 1/2 volume; Primer P5, P7 final concentration 0.5 μM.

Beneficial effect of the present invention is further illustrated below in conjunction with embodiment.

Method in following embodiment is ordinary method if no special instructions, and nucleotide sequence used is by the synthesis of Shanghai Invitrogen biotech firm, and agents useful for same is the product of Enzymatics company if no special instructions, and water used is ultrapure water.

1, the fragmentation of genomic dna

Sample: people's standard substance genome DNA sample, i.e. human gene group DNA's sample (HumanGenomicDNA) of Promege company purchase.

1) sample concentration and integrity mensuration'

Use Qubit(American I nvitrogen) to sample DNA concentration determination, carry out precisely quantitatively, and use 0.8% sepharose, 120v voltage, electrophoresis 1 hour, detect sample quality, guarantee that people's standard substance genome DNA sample is complete without degraded.The result of comprehensive gel electrophoresis and Qubit, to concentration, the total amount of sample with whether quality is qualified determines: (criterion of acceptability) genome is complete, without degraded, electrophoresis result genomic dna master tape should at maximum more than band 40kb.If there is pulsed field gel electrophoresis result, then DNA master tape should at more than 48.5kb; Without protein, RNA or naked eyes visible foreign pollute (pollute if sample contains RNA, the concentration that must add 1/10 volume by sample volume be 10mg/ml RNase and at 37 DEG C of process 30min); Sample concentration reaches 150ng/ more than μ l;

2) if sample concentration < 100ng/ μ is l, then need to concentrate sample;

3) 25 μ g genomic dnas are got; 37 DEG C of incubation 30min; The centrifugal 5min of 12000rpm, transfer supernatant is in a new 1.5ml centrifuge tube; With QIAGENEB (Elutionbuffer) or TE(Tris-EDTA) damping fluid supply 200 μ l;

4) with hydraulic cutting device (HydroSheardevice) by broken for sample target area enrichment (optimum configurations experimentally arranges top condition).

2, end reparation and add dATP

It is as shown in table 1 that end repairs system:

Table 1

Reagent	Volume (μ l)
		Fragmentation DNA	150
T4 polynueleotide kinase damping fluid	20
		Ultrapure triphosphate deoxy-nucleotide mixture (dNTP mix) (10mM each)	4
T4DNA polysaccharase	5

T4 polynueleotide kinase	10
		Ultrapure water	Add to 200

20 DEG C of incubation 30min; With AMpureXP magnetic bead (Beads) purification of samples of 1.8 times of sample volumes after repairing.

Add dATP system as shown in table 2:

Table 2

Reagent	Volume (μ l)
		10 × Blue damping fluid (Buffer)	20
1mM triphosphoric acid adenyl-deoxyribonucleotide (dATP)	10
		Klenow fragment (3' → 5'exo-) (Klenow Exo-)	10
Ultrapure water	Add to 200

37 DEG C of incubation 30min; After adding dATP reaction, AmpureXP magnetic bead (Beads) purification of samples of rear use 1.8 times of sample volumes, by 80 μ l ultrapure water eluted sample.

3, A, B joint is added

Linked system is as shown in table 3:

Table 3

Reagent	Volume (μ l)
		The DNA of purifying	80μl
2 × quick ligase damping fluid	100
		Joint A (20 μMs)	5
Joint B (20 μMs)	5
		T4DNA ligase enzyme (fast)	10
Amount to	200

25 DEG C of incubation 15min; Product adds tetrabromophenol sulfonphthalein, 65 DEG C of deactivation 10min.

4, clip size is selected

1) sepharose (BIO-RADCertifiedMegabaseAgarose) 125ml(1 × TAE of 0.6% is prepared), the comb hole of recommending is that 1mm(is long) × 9mm(is wide) × 10mm(is high) and 7 holes combs, add millesimal Gelred dyestuff during colloidal sol;

2) take out the glue holder of glue, glue comb and gel frame, note selecting wide aperture glue to comb and note with glue holder supporting.Then the holder of careful cleaning glue, glue comb and gel frame finally use dehydrated alcohol wiping by pure water rinsing, dry stand-by.

3) assemble gel frame, poured in gel frame by the agarose solution being cooled to 50 DEG C and solidify, notably do not have in agarose solution bubble.After room temperature is solidified, put it into 4 DEG C of refrigerators until agarose and cool at least 30min.

4) pull out glue comb, together with glue holder, sepharose is taken out stand-by from gel frame; If sepharose needs need pull out comb during placement overnight, put into freshness protection package sealing and preserve.

5) repeatedly carefully clean electrophoresis chamber with tap water, then use distilled water flushing three times, then use dehydrated alcohol wiping electrophoresis chamber, after room temperature is dried, stand-by add the rinse of a small amount of 1 times of Tris-acetate buffer (1 × TAEbuffer) in electrophoresis chamber after.

6) put into the sepharose of just preparation and pour the electrophoretic buffer 1 × TAE of precooling into electrophoresis chamber, posting label and prepare electrophoresis.

7) open electrophoresis apparatus power supply, mix up voltage and electrophoresis time starts electrophoresis.First make sample enter gel with 100V electrophoresis 20min, then voltage is turned down to 25V electrophoresis 18 ~ 20 hours, whether normally need to pay close attention to electrophoresis state in process.

8) cut glue (target area) as Fig. 3, reclaim test kit with QIAquickQIAEXII gel and carry out glue purification recovery, last volume is 81 μ l; Get 1 μ l quantitative.

5, cyclisation

Cyclisation system:

1) in PCR pipe, following reaction system is added

A) 10 μ l10 × Cre damping fluids

B) 80 μ l step 4 product D NA(Filled-inDNA, 300ng)

C) 10 μ lCre recombinases (CreRecombinase) (1U/ μ l)

2) vortex oscillation, then reacts in PCR instrument

A) 37 DEG C are incubated 50 minutes;

B) 70 DEG C are incubated 10 minutes;

C) 4 DEG C of preservations.

6, linear DNA digestion

1) reaction system:

A) 2.2 μ lDTT(DL-Dithiothreitol, dithiothreitol (DTT), 100mM) (after directly first adding mixing, adding other reactant again)

B) 2.2 μ lATP(adenosine-triphosphate, adenosine triphyosphate, 100mM)

C) 10 μ l depend on the linear double stranded nucleic acid digestive ferment Plasmid-SafeATP-DependentDNase (10U/ μ l) of ATP

D) 6 μ l single stranded exonucleases ExonucleaseI (20U/ μ l)

2) crawl vortex oscillation, then reacts in PCR instrument

A) 37 DEG C are incubated 30 minutes

B) 80 DEG C are incubated 20 minutes

C) 4 DEG C of preservations

3) use QIAquickPCR Product Purification Kit QIAquickPCRPurificationKit (Qiagen) purifying, dissolve with 122 μ lEB.

7, secondary breaking

1) the broken instrument CovarisS220 of ultrasonic wave DNA is opened, degassed and be chilled to 6 DEG C to 8 DEG C in advance;

2) DNA of Exonucleolytic ferment treatment is transferred to T6 Glass tubing, the top of pipe will be reached in order to ensure the liquid level in sustained segment DNA, T6 Glass tubing, by the method for adding ultrapure water, the gas in T6 Glass tubing is discharged;

3) fragmentation parameter is as shown in table 4:

Table 4

4) broken rear PCR reclaims test kit and reclaims (50 μ l).-15 DEG C ~-25 DEG C can be stored in.

8, DNA(M-270 streptavidin magnetic bead (streptavidinbeads) purifying of purifying biological element mark)

1) vibrate resuspended m-270 streptavidin magnetic bead (streptavidinmagneticbeads).

2) magnetic bead drawing 20 μ l resuspended is placed in 1.5ml centrifuge tube, is placed on by centrifuge tube on Magneto separate frame and waits for 1 minute, and careful absorption abandons supernatant.

3) magnetic bead is washed with 50 μ l magnetic beads binding buffer liquid (BeadBindingBuffer).Careful resuspended precipitation, flicks centrifuge tube, of short duration centrifugal 1 ~ 2 second, is placed on by centrifuge tube on Magneto separate frame, wait for 1 minute, abandon supernatant.Repeat this step once.

4) with 50 μ l magnetic bead binding buffer liquid (BeadBindingBuffer) resuspended magnetic beads.

5) add from step 7 process after sample 50 μ l, 20 DEG C on hot mixing tank temperature bath 15 minutes.(every 2min shakes 15s, 600rpm).

6) centrifuge tube is placed on Magneto separate frame, wait for 1 minute, give up supernatant, with magnetic bead lavation buffer solution (BeadWashBuffer I) the washing magnetic bead of 200 μ l, resuspended magnetic bead five times are blown and beaten in each washing gently, resuspended precipitation, flick centrifuge tube, of short duration centrifugal 1 ~ 2 second, centrifuge tube is placed on Magneto separate frame, wait for 1 minute, abandon supernatant.

7) repeating step 6) 2 times.

8) centrifuge tube is placed on Magneto separate frame, waits for 1 minute, give up supernatant, wash magnetic bead with the EB of 200 μ l, resuspended magnetic bead five times are blown and beaten in each washing gently, resuspended precipitation, of short duration centrifugal 1-2 second, centrifuge tube is placed on Magneto separate frame, waits for 1 minute, abandon supernatant.

9) wash magnetic bead with the QIAGENEBbuffer of 200 μ l, after EB and magnetic bead mixing, place on ice, prepare to carry out end and repair system.

9, end reparation

In the centrifuge tube of 1.5ml, prepare end repair reaction system, as shown in table 5:

Table 5

Reagent	Volume (μ l)
		End repairs damping fluid	10
Ultrapure water	75
		Ultrapure triphosphate deoxy-nucleotide mixture (Natural dNTP Mix)	4
T4DNA polysaccharase	5
		T4 polynueleotide kinase	5
Klenow archaeal dna polymerase	1
		Cumulative volume	100

1) reagent after use is put back to also-20 DEG C of preservations in original reagent box;

2) by 8-9) in centrifuge tube be placed on Magneto separate frame, wait for 1 minute, abandon supernatant, add end and repair mixed system 100 μ l;

3) in hot mixing tank (hermomixer), 20 DEG C of temperature are bathed 30 minutes, and every 2 minutes resuspended magnetic beads once, should be soft as much as possible during mixing.

4) 1.5ml centrifuge tube is placed on Magneto separate frame, waits for 1 minute, give up supernatant.Wash magnetic bead three times with the magnetic bead elution buffer (BeadWashBuffer I) of 200 μ l, each washing blows and beats resuspended magnetic bead about 5 times gently.

5) wash magnetic bead with the EB of 200 μ l, resuspended magnetic bead 5 times are blown and beaten in each washing gently.

6) wash magnetic bead with the QIAGENEB damping fluid of 200 μ l, after EB and magnetic bead mixing, place on ice, prepare to add A system.

10, end adds A

From-20 DEG C of test kits preserved, take out 10 × Blue damping fluid and 1mMdATP in advance, be placed on thawed on ice and make it fully mix, enzyme is taken out from-20 DEG C of refrigerators and is placed in-20 DEG C of ice chests.

1) in the centrifuge tube of 1.5ml, prepare end and add " A " reaction system, as shown in table 6:

Table 6

Reagent	Volume (μ l)
		10 × Blue damping fluid	5
Ultrapure water	32
		1mM triphosphoric acid adenyl-deoxyribonucleotide (1mM dATP)	10
Klenow fragment (3' → 5'exo-) (Klenow Exo-)	3

Total Volume

50

2) by 9-8) in centrifuge tube be placed on Magneto separate frame, wait for 1 minute, abandon supernatant, add end and add A mixed system 50 μ l, mix gently;

3) in hot mixing tank, 37 DEG C of temperature are bathed 30 minutes, and every 2 minutes resuspended magnetic beads once, should as much as possible softly (every 2min shakes 15s, 600rpm) during mixing.

4) 1.5ml centrifuge tube is placed on Magneto separate frame, waits for 1 minute, abandon supernatant.Wash magnetic bead three times with the magnetic bead elution buffer (BeadWashBuffer I) of 200 μ l, each washing blows and beats resuspended magnetic bead about 5 times gently.

5) wash magnetic bead twice with the EB of 200 μ l, resuspended magnetic bead 5 times are blown and beaten in each washing gently.

6) remove the damping fluid (EB) of last washing, add the resuspended magnetic bead of EB of 19 μ l.Magnetic bead is transferred in a new 1.5ml centrifuge tube.

11, sequence measuring joints is added

1) fech connection damping fluid (2 × AdapterLigationBuffer) and joint (PEAdapterOligoMix) from-20 DEG C of test kits preserved in advance, is placed on thawed on ice and fully mixes, until without any solid insoluble in damping fluid.

2) in the centrifuge tube of 1.5ml, prepare joint (Adapter) ligation system, as shown in table 7:

Table 7

Reagent	Volume (μ l)
		10-6) sample	19
Rapid ligation buffer (Rapid Ligation Buffer2 ×)	25
		Joint (PE Adapter Oligo Mix)	1
Quick ligase (adapter ligase)	5
		Cumulative volume	50

3) blow and beat joint (Adapter) ligation system lightly and guarantee that magnetic bead fully suspends in reaction system.

4) in hot mixing tank (Thermomixer), 20 DEG C of temperature are bathed 15 minutes, and every 2 minutes resuspended magnetic beads once, should as much as possible softly (every 2min shakes 15s, 600rpm) during mixing.

5) 1.5ml centrifuge tube is placed on Magneto separate frame, waits for 1 minute, abandon supernatant.Wash magnetic bead three times with the magnetic bead elution buffer I (BeadWashBuffer I) of 200 μ l, each washing blows and beats resuspended magnetic bead about 5 times gently.

6) can select: build magnetic bead elution buffer II (BeadWashBuffer II) the washing magnetic bead of storehouse gDNA inferior quality (having degraded) suggestion 200 μ l once, notice that magnetic bead elution buffer II (BeadWashBuffer II) can only use after adding joint, in other washing step, all can not add BeadWashBuffer II;

7) wash magnetic bead twice with the EB of 200 μ l, resuspended magnetic bead 5 times are blown and beaten in each washing gently.

8) remove the damping fluid (EB) of last washing, add the resuspended magnetic bead of EB of 23 μ l.Magnetic bead is transferred in a new 0.2mlPCR pipe.

12, pcr amplification, outbound

1) from-20 DEG C of test kits preserved, take out PhusionDNA polysaccharase, PCR primer PE1.0 and PCR primer PE2.0, be placed on and thaw on ice and fully mix PhusionDNA polysaccharase.

2) in the centrifuge tube of 0.2ml, PCR reaction system is prepared, as shown in table 8:

Table 8

Reagent	Volume (μ l)
		Phusion archaeal dna polymerase	25
11-8) sample	23
		PCR primer 1.0	1
PCR primer 2.0	1
		Cumulative volume	50

3) in PCR instrument, follow procedure is run:

PCR cycle number is 18.

A) 98 DEG C of insulation 30s;

B) 17 circulations: 98 DEG C of insulation 10s, 65 DEG C of insulation 30s, 72 DEG C of insulation 30s;

C) 72 DEG C of insulation 5min;

D) 4 DEG C of preservations.

4) reaction terminates the supernatant that rear Magneto separate frame pipettes PCR reaction system, and this supernatant is carried out electrophoresis.

5) electrophoresis selects fragment (350 ~ 650bp)

Reclaim test kit (QIAquickGelExtractionKit) with gel and carry out glue purification recovery, reclaim and connect product and be dissolved in 20 μ lEB(ElutionBuffer, elution buffer) in.Printed label is also attached on centrifuge tube tube wall, and easy-to-look-up, so far library has been prepared substantially.

13, storehouse inspection, upper machine

1) purified product of gained in step 12 is diluted to 1ng/ μ l, takes out 1 μ l for Agilent company of the Agilent2100(U.S.) detect, get 1 μ l in addition again for QPCR(Biorad company) detect, according to detected result Fig. 4, machine concentration in decision.

2) according to the concentration of step 1) gained, library is diluted to upper confidential ask after, Illumina company Hiseq2000 check order platform check order.

14, information analysis

Carry out personality analysis to lower machine data, use the stricter parameter comparison of BWA on human genome, comparison result is as accompanying drawing 5 and table 9.

Table 9(biological sequence alignment software (BWA) comparison result)

Parameter interpretation:

Number Allread1number: the high quality order-checking reading 1(read1 for Evaluation);

Number Allread2number: the high quality order-checking reading 2(read2 for Evaluation);

Number Allread1mapnumber: the reading 1(read1 in comparison);

Number Allread2mapnumber: the reading 2(read2 in comparison);

Note: before doing these data statisticss, to the reading (reads) of the reading base (reads) do not had in comparison (map) and many places comparison and total mass number lower than 20 the filtration carried out of reading (reads), so allread1num should be the number of the read1 after filtration, number (mapnum) in allread1 comparison is the upper number reading (read) of comparison (map), because before to there is no filtering in comparison (map), so be the comparison of 100%.

Insertsizepeak: the actual library size obtained based on data evaluation;

AllPEmapreadspair: reading (reads) logarithm in both-end comparison in (PE) comparison data in all comparisons;

Note: the reads on so-called PE comparing refer to two reads all comparison on same karyomit(e).

PErightdirectionpair: reading (reads) logarithm that in both-end comparison, in (PE) comparison data, PE is in the right direction;

Note: for small segment library, comparison direction is relative.

For large fragment library, due to needs cyclisation, so direction is dorsad.

In comparison result, generally judge the position relationship of reads by comparing origin coordinates in reading (reads) comparison to karyomit(e) (or scaffold), with regard to large stretch of phase library, if judge read 1(read1) position and read 2(read2) position relationship meet direction as time dorsad, think in the right direction.Otherwise be the base pair (PEerrordirectionpair) of anisotropy in both-end comparison, because concerning large stretch of phase library, the incomplete situation of a lot of cyclisation can be there is, so the value of base pair in the right direction in both-end comparison (PErightdirectionpair) does not generally all include height, certainly, this value higher explanation cyclisation effect is better, and the help risen later analysis can be larger.

Certainly, the prerequisite of statistics is, all comparison is on same karyomit(e) for these two readings (reads), and the direction of read1 and read2 is contrary.So base pair (PEerrordirectionpair) % being not difficult to be interpreted as anisotropy in base pair (PErightdirectionpair%)+both-end comparison in the right direction in what both-end comparison is not equal to 100%.

The base pair (PEerrordirectionpair) of anisotropy in both-end comparison: the reads logarithm (PEerrordirection/AllPEmapreadspair) of PE anisotropy in PE comparison data;

The base pair (PEsamestrandpair) of same chain in both-end comparison: the reads logarithm (PEsamestrand/AllPEmapreadspair) in PE comparison data on same chain;

Note: same chain (samestrand) refers to two readings (reads), although comparison is on same karyomit(e), but the direction of these two reads is identical, namely we claim be same chain (general two readings (reads) should be a comparison in normal chain, a comparison is in minus strand.）

Certainly, such reading (reads) is also have no idea in follow-up analysis, so the ratio of this value is also more low better.

The base pair (PEdirrerentchrpair) of coloured differently body in both-end comparison: reads logarithm (PEdirrerentchr/AllPEmapreadspair) in comparison to coloured differently body or scaffold in PE comparison data;

Note: in general, the quality scaffold and splice situation can be seen by these chain (link) relations read between (reads), that is, if all correct comparison of a pair reading (reads) is on this scaffold, so this scaffold just has a link, being reacted on figure is exactly such a structure, camber line represents a link relation, chain (link) relation is more, the support situation of reads to this scaffold representing this library is better, so takes on the scaffold come more reliable.

Thus, comparison (map) is only needs, so the ratio of the base pair (PEdirrerentchrpair) of anisotropy in both-end comparison is also more low better to the reads on same karyomit(e) or scaffold.

SD (20%): reading (reads) logarithm ratio (20%SDReads/PErightdirectionpair) meeting library true peak upstream and downstream 20% in PE comparison data in the right direction;

Note: for large stretch of phase library reads, even if they all comparison on same scaffold, and comparison direction is also correct, but we can not determine it must is that we need, because whether we also need the insertion peak (insertsize) between consideration two reading (reads) to meet the requirements, that is, we think the reading (reads) only meeting library true peak upstream and downstream 20%, and are that the reads of the correct comparison of PE is only effective reads.So, SD (20%) is that we add up in base pair (PErightdirectionpair) in the right direction in both-end comparison, meet the size inserting the ratio shared by reading (reads) logarithm that peak (insertsize) requires, certainly, the larger explanation of this value we can reading (reads) more.

Base pair (PErightdirectionpair) proportion in the right direction in both-end comparison reaches 67%, SD (20%) has accounted for 95.6%, these data are all data availables, insert peak (Insertsizepeak) at 4964bp, concentrate on 5k position, visible Library Quality is very good.

The foregoing is only the preferred embodiments of the present invention, be not limited to the present invention, for a person skilled in the art, the present invention can have various modifications and variations.Within the spirit and principles in the present invention all, any amendment done, equivalent replacement, improvement etc., all should be included within protection scope of the present invention.

Sequence table

Nuo Hezhi source, <110> Beijing bioinformation Science and Technology Ltd.

<120> double-stranded adapters, its application and build end pairing DNA library method

<130>PN15194NHZY

<160>4

<170>PatentInversion3.1

<210>1

<211>40

<212>DNA

<213>artificial

<400>1

cgataacttcgtataatgtatgctatacgaagttatacgt40

<210>2

<211>42

<212>DNA

<213>artificial

<400>2

ccagctattgaagcatattacatacgatatgcttcaatatgc42

<210>3

<211>40

<212>DNA

<213>artificial

<400>3

gcataacttcgtatagcatacattatacgaagttatagct40

<210>4

<211>42

<212>DNA

<213>artificial

<400>4

ccacgtattgaagcatatcgtatgtaatatgcttcaatatcg42

Claims (6)

1. a double-stranded adapters, is characterized in that, comprises joint A and joint B, and described joint A and described joint B comprises a LoxP sequence and respectively by equidirectional for described LoxP sequence the auxiliary sequencel being connected to the DNA fragmentation two ends for the treatment of cyclisation;

Described LoxP sequence in described joint A is forward LoxP sequence, described auxiliary sequencel in described joint A comprises the sticky end being positioned at described forward LoxP Sequences upstream, and be positioned at described forward LoxP sequence downstream there is 3 ' outstanding T end, 5 ' end, first base of described joint A two chains has carried out phosphorylation modification respectively, and the 32nd bit base T of described forward LoxP sequence has carried out biotin labeling;

Described LoxP sequence in described joint B is reverse LoxP sequence, described auxiliary sequencel in described joint B comprises the sticky end being positioned at described reverse LoxP Sequences upstream, and be positioned at described reverse LoxP sequence downstream there is 3 ' outstanding T end, 5 ' end, first base of described joint B two chains has carried out phosphorylation modification respectively, and the 32nd bit base T of described reverse LoxP sequence has carried out biotin labeling; As shown in Figure 1, the base sequence of described joint B as shown in Figure 2 for the base sequence of described joint A.

2. double-stranded adapters as claimed in claim 1 is building the application in end pairing DNA library.

3. build a method for end pairing DNA library, the DNA fragmentation comprised for building end pairing DNA library carries out the step of cyclisation, it is characterized in that, the step that the described DNA fragmentation for building end pairing DNA library carries out cyclisation comprises:

The DNA fragmentation being used for building end pairing DNA library is connected with double-stranded adapters according to claim 1, obtains connecting product;

Described DNA fragmentation in described connection product adopts Cre recombinase system to carry out cyclisation.

4. method according to claim 3, is characterized in that, the method for described structure end pairing DNA library specifically comprises the following steps:

S1, uses physics mode random fragmentation by genomic dna, enrichment is for building the DNA fragmentation of end pairing DNA library;

S2, carry out end-filling to the DNA fragmentation that enrichment in described step S1 obtains, then end adds dATP, purifying;

S3, the product obtain described step S2 and double-stranded adapters according to claim 1 add linked system, carry out ligation;

S4, carries out electrophoretic separation to the connection product that described step S3 obtains, cuts target stripe, reclaims purifying;

S5, gets the product that described step S4 obtains and adopts Cre recombinase system to carry out cyclisation;

S6, digests the product of cyclisation non-in described step S5;

S7, carries out fragmentation to the product in described step S6, makes DNA fragmentation size concentrate between 350 ~ 650bp;

S8, utilizes the affine magnetic bead of Streptomycin sulphate to carry out enrichment in the product of described step S7 with the sequence of biotin labeling joint;

S9, carry out end reparation to the product of described step S8, then end adds dATP;

S10, adds order-checking joint used to the product of described step S9;

S11, utilizes sequencing primer to carry out pcr amplification to the product of described step S10;

S12, by the product electrophoretic separation of described step S11, cuts the DNA fragmentation between 350 ~ 650bp, recovery, purifying, obtains described end pairing DNA library.

5. method according to claim 4, is characterized in that, described step S5 comprises further, is first undertaken quantitatively by the product that described step S4 obtains, and then gets product described in 200 ~ 300ng and adopts Cre recombinase system to carry out cyclisation.

6. method according to claim 4, is characterized in that, described step S9, S10 and S11 all carry out on magnetic bead.