CN103667186B - A kind of recovery totipotent method of mescenchymal stem cell - Google Patents
A kind of recovery totipotent method of mescenchymal stem cell Download PDFInfo
- Publication number
- CN103667186B CN103667186B CN201210326437.5A CN201210326437A CN103667186B CN 103667186 B CN103667186 B CN 103667186B CN 201210326437 A CN201210326437 A CN 201210326437A CN 103667186 B CN103667186 B CN 103667186B
- Authority
- CN
- China
- Prior art keywords
- cell
- culture
- totipotency
- mescenchymal stem
- stem cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention discloses a kind of recovery mesenchyma totipotent cultural method of dry small cell.The invention provides a kind of recovery mesenchyma totipotent method of dry small cell, comprise the steps: 1) by the in vitro mescenchymal stem cell Hanging drop culture of totipotency reduction, obtain the cell after Hanging drop culture；2) cell after described Hanging drop culture is continued the cultivation that suspends, it is achieved recover mesenchyma dry small cell totipotency.The experiment proves that, the invention provides a kind of recovery totipotent method of mescenchymal stem cell, the concrete 3D of employing cultivates, by through the mescenchymal stem cell (totipotency reduce in vitro mescenchymal stem cell) of repeatedly Secondary Culture after 3D cultivation processes, its volume increased gradually recovers, cytoactive strengthens, cloning capacity and differentiation capability strengthen, its paracrine action also increases, make old and feeble mescenchymal stem cell return to youth, recover stem cell properties.
Description
Technical field
The present invention relates to biological technical field, particularly relate to a kind of recovery totipotent method of mescenchymal stem cell.
Background technology
Mescenchymal stem cell (mesenchymal stem cells, MSCs) is a kind of adult stem cell, because it has by force
Big multiplication capacity and multi-lineage potential, immunogenicity is low, convenient sources, it is easy to separates, cultivate, expand and purifying etc. is excellent
Point so that it is there is wide potential applicability in clinical practice at the aspect such as autoimmune disease and various replacement therapies.Although marrow
Middle mescenchymal stem cell content is the most, but only accounts for 0.001%～0.01%, it is difficult to meets the needs of cell therapy, therefore needs
The most isolated and purified, cultivate amplification and could meet requirement.But, old and feeble and to Gegenbaur's cell in MSCs amplification procedure in vitro
Self-differentiation problem has a strong impact on its result for the treatment of and safety in utilization.
Keep MSCs primary characteristic it is critical only that the condition of culture improving MSCs.MSCs is at a kind of three-dimensional in vivo
Environment, it is thus proposed that the imagination of dimensional culture.1998, Qiu carried out dimensional culture to murine stromal cells, scanning
Electronic Speculum detection finds that a large amount of cell in microcarrier cytodex-3 surface covers, and mutually bridges together, constitutes three-dimensional many cells
Polymer.Visible Mineral nodules in polymer, alkaline phosphatase seen from immunohistochemical staining and 1 Collagen Type VI (Qiu Q,
Ducheyne P,Gao H,Ayyaswamy P.Formation and differentiation of three-
dimensional rat marrow stromal cell culture on microcarriers in a rotating-
wall vessel.Tissue Eng.1998;4:19-34.).Glowacki collagen sponge carries out dimensional perfusion as carrier
Cultivating, decrease the gathering of metabolite, found that Extracellular Matrix Content improves, cytoactive and the function cultivated are equal
Strengthen (Glowacki J, Mizuno S, Greenberger JS.Perfusion enhances functions of bone
marrow stromal cells in three-dimensional culture.Cell Transplant.1998;7:319-
26.).But cytodex-3 and collagen sponge are solid-core support, specific surface area is less, and cell is difficult to expand on a large scale.And carry greatly
Can body bioreactor be used for the amplification cultivation of MSCS, and the smooth solution of some problems that need, such as macroporous microcarrier
Development, cell and the adhesion of carrier, the wash-out etc. of attached cell.
Current 3D cultivation all can not meet current cell engineering and genetic engineering and form the demand of seed cell amount
Industrialization, and, 3D cultivation has the most fundamentally recovered MSCs versatility the most not yet research.
Summary of the invention
It is an object of the present invention to provide a kind of recovery mesenchyma totipotent method of dry small cell.
The method that the present invention provides, comprises the steps:
1) in vitro mescenchymal stem cell Hanging drop culture totipotency reduced, obtains the cell after Hanging drop culture；
2) by after described Hanging drop culture cell continue suspend cultivate, it is achieved recover described totipotency reduce in vitro between fill
Matter stem cell totipotency.
In said method, in step 1), the in vitro mescenchymal stem cell that described totipotency reduces is for do in vitro mesenchyma
The mescenchymal stem cell that cell obtains through amplification in vitro.
Wherein, above-mentioned in vitro mescenchymal stem cell can derive from any human body or animal tissue and body fluid, such as placenta, navel
Band, marrow, fat and/or Cord blood etc., and the totipotency of this in vitro mescenchymal stem cell is intact.
The in vitro mescenchymal stem cell that above-mentioned totipotency reduces can be caused by any reason, as caused by amplification in vitro is cultivated,
Including culture system in vitro reason or the factor such as pass on；In embodiments of the invention, it is by amplification in vitro that above-mentioned totipotency reduces
Cultivation causes, specially Secondary Culture 4-10 generation；Described Secondary Culture specifically uses the mode of adhere-wall culture.
The in vitro mescenchymal stem cell that above-mentioned totipotency reduces is characterized by: compared with in vitro mescenchymal stem cell,
The volume of cell becomes big, shape is become irregular shape by fusiformis, the transparency of kytoplasm increases, independently to osteoblast differentiation, dry
Cell relating gene-1 Oct4, Sox2, Nanog expression declines.
In said method, in step 1),
Described Hanging drop culture comprises the steps: that the in vitro mescenchymal stem cell described totipotency reduced suspends, and obtains
Cell suspension；Again described cell suspension is dripped on culture dish lid, then the lid after dropping is upside down at the bottom of culture dish, training
Support, obtain the cell after hanging drop is Hanging drop culture；The concentration of described cell suspension is specially 104-108Individual/mL.
The step of the in vitro mescenchymal stem cell digestion described totipotency reduced also is included before above-mentioned suspension.
In said method, described Hanging drop culture also comprises the steps:, before described cultivation, to add at the bottom of described culture dish
Enter the water or solution preventing hanging drop to be dried；Described solution be concentration be 0.01M, pH value be 7.4 PBS, physiological saline,
Cell culture fluid or other buffer solution.
In said method, described culture dish is cell or Micro-Organism Culture Dish；The material tool of described cell or Micro-Organism Culture Dish
Body is plastics or glass.
In embodiments of the invention, Hanging drop culture is specific as follows:
1) in vitro mescenchymal stem cell totipotency reduced with digestive juice is digested to single cell suspension, with the DMEM of high sugar
+ 10%(weight/mass percentage composition) hyclone suspension, adjusting cell concentration in single cell suspension is 1 × 106Individual/mL, obtains slender
Born of the same parents' suspension；
2) be about 35000 cells with the cell number of every 35 μ l(every) volume above-mentioned cell suspension is dripped uniformly
Being added in the lid of diameter 9cm Micro-Organism Culture Dish (the most adherent culture dish), each Micro-Organism Culture Dish lid hanging drop drips numerical control system 40
Drip, more careful the reversing of Micro-Organism Culture Dish lid cover the PBS(concentration equipped with 10ml be 0.01M, pH value be 7.4) at the bottom of culture dish
On；It is placed in incubator, stands Hanging drop culture 36h, obtain hanging drop.
Above-mentioned digestion use digestive juice be pancreatin and EDTA are dissolved in concentration be 0.01M, pH value be 7.4 PBS buffering
The solution that liquid obtains, the wherein pancreatin final concentration of 0.25%(weight/mass percentage composition in digestive juice), EDTA is in digestive juice
Final concentration of 0.02%(weight/mass percentage composition).
In said method, the culture medium of suspend in described the Hanging drop culture suspension used and described suspension cultivation employing is equal
For cell culture medium or containing following 1)-3) in the cell culture medium of at least one component:
1) cell growth components is promoted: serum, growth factor, cell factor, trace element, hormone, vitamin, cell are believed
Number pathway inhibitor and/or activator；
2) help cell attachment component: collagen, gelatin, hyaluronic acid, cellulose, chondroitin sulfate, peptide, chitin,
PLA and/or hydrogel；
3) component that antipathogen infects: antibiotic.
Above-mentioned cell culture medium is the culture medium cultivating mescenchymal stem cell；The culture medium of described cultivation mescenchymal stem cell
For the DMEM in high glucose culture medium containing hyclone, specifically it is prepared as follows: hyclone is cultivated with DMEM in high glucose
The cell culture medium that base is mixed to get, described hyclone concentration in described cell culture medium is that 10%(percent mass contains
Amount).
In said method, the time of described Hanging drop culture is 2-110 hour；It is specially 36h；
The described time cultivated that suspends is 2-110 hour；It is specially 24h；
The condition that described Hanging drop culture and described suspension are cultivated is as follows: oxygen concentration is 0.1-50%, CO2Concentration is 1-15%,
Temperature is 30-40 ° of C；
Described Hanging drop culture and described suspension are cultivated and are static culture or dynamic cultivation；The mode of described dynamic cultivation is
Stir, rotate or shake.
In said method, recover described totipotency reduce in vitro mescenchymal stem cell totipotency be embodied in reduction described entirely
Can the in vitro mescenchymal stem cell that reduces of property volume, reduce in vitro mescenchymal stem cell S phase thin that described totipotency reduces
Born of the same parents' quantity, strengthen described totipotency reduce in vitro mescenchymal stem cell differentiation capability, strengthen described totipotency reduce from
The cloning capacity of body mescenchymal stem cell and/or improve in the in vitro mescenchymal stem cell that described totipotency reduces with totipotency phase
Correlation gene is expressed；
Described with totipotency related gene be CCR1, CCR2, CX3CR, CD49b, CXCR4, OCT4, SOX2 and/or
NANONG。
The mescenchymal stem cell obtained by above-mentioned method is also the scope of protection of the invention.
It is a further object to provide a kind of mesenchyma dry small cell cultural method.
The method that the present invention provides, including the step of above-mentioned method.
The experiment proves that, the invention provides a kind of recovery totipotent method of mescenchymal stem cell, specifically adopt
Cultivate with 3D, by the mescenchymal stem cell (mescenchymal stem cell that totipotency reduces) through repeatedly Secondary Culture at 3D cultivation
After reason, its volume increased gradually recovers, cytoactive strengthens, cloning capacity and differentiation capability strengthen, its paracrine action also
Increasing, these results illustrate, the method that this kind of 3D cultivates, and make old and feeble mescenchymal stem cell return to youth, recover
Stem cell properties；And this method uses a kind of regulatable undamaged physical means, external regulation human mesenchyme is dry thin
The versatility of born of the same parents and differentiation capability, it is achieved that the maintenance of amplification in vitro mescenchymal stem cell and recovery, and then solve the human world and fill
A difficult problem in the clinical practice of matter stem cell, has preferable economic benefit and social benefit.It addition, the MSCs that totipotency is recovered
Have the advantage that there is extremely low immunogenicity, because of without causing rejection as the seed cell transplanted；It is not related to
Ethics problem of embryonic stem cell etc..
Accompanying drawing explanation
Fig. 1 is that the MSCs versatility of adhere-wall culture reduces
Fig. 2 is the formation of the MSCs cell ball that 3D cultivates
Fig. 3 is the change of the MSCs cell size form that 3D cultivates
Fig. 4 is that 3D cultivates cell cycle and the impact of apoptosis
Fig. 5 is the impact that 3D cultivates on MSCs differentiation capability
Fig. 6 is the impact that 3D cultivates on MSCs cloning capacity
Fig. 7 is the expression of the MSCs totipotency related gene that 3D cultivates
Detailed description of the invention
Experimental technique used in following embodiment if no special instructions, is conventional method.
Material used in following embodiment, reagent etc., if no special instructions, the most commercially obtain.
In following embodiment, in vitro mescenchymal stem cell (mesenchymal stem cells, MSCs) is purchased from Cyagen
Biosciences Inc, catalog number are HUXMA-01001, it is also possible to be prepared as follows: pancreatin separates in vitro people
Marrow, umbilical cord or placenta mesenchyma stem cell, then collect cell and cultivate, when cell reaches the fusion of 70%-80%, use D-
After PBS, pancreatin processes, and is subsequently adding complete medium and terminates digestion, blow and beat into single cell suspension, is centrifuged and removes supernatant, complete
After full culture medium is resuspended, Secondary Culture.
In following embodiment, Micro-Organism Culture Dish (the most adherent culture dish) reaches the limited public affairs of scientific and technological development purchased from Wuhan cause sincerity
Department, catalog number is TCD000090.
Digestive juice in following embodiment is pancreatin and EDTA be dissolved in concentration be 0.01M, pH value be the PBS of 7.4
The solution obtained, the wherein pancreatin final concentration of 0.25%(weight/mass percentage composition in digestive juice), EDTA end in digestive juice
Concentration is 0.02%(weight/mass percentage composition).
In following embodiment concentration be 0.01M, pH value be 7.4 PBS formula as follows: NaCl 8.00g,
Na2HPO4.12H2O 2.90g, KCl 0.2g, KH2PO4 0.24g。
In following embodiment, cell culture condition can use: oxygen concentration is 0.1-50%, CO2Concentration is 1-15%, and temperature is
30-40 ° of C, being specifically oxygen concentration is 10%, CO2Concentration is 2%, and temperature is 37 ° of C；
Embodiment 1, totipotency reduce the acquisition of mescenchymal stem cell
One, the subculture in vitro separately adhere-wall culture of mescenchymal stem cell
In vitro mescenchymal stem cell (MSCs) is cultivated in low sugar DMEM of the hyclone (FBS, Gibco) containing 10%
Adherent Secondary Culture in base (Hyclone, SH30021.01B), the time of each Secondary Culture is 3 days, respectively obtains 1-10
For adherent MSCs.
Two, cellular omnipotency detection after adhere-wall culture
1), the morphologic change of MSCs after adhere-wall culture
Being seeded in overnight incubation (12h) in six orifice plates by after 1st generation and the 10th culture MSCs cell dissociation, second day general
Logical light microscope 10 × object lens are observed；Result as shown in figs. ia-b, as can be seen from the results, 1st generation and the 10th culture
It is further cultured for after MSCs cell dissociation respectively obtaining 2nd generation (p2) and the 12nd generation (p11) MSCs cell, along with the increasing of passage number
Many, the volume of cell starts to become big, and shape also becomes irregular by fusiformis；From basis of microscopic observation, cell increases at volume
During great, it is inconspicuous that border becomes, and the transparency of kytoplasm increases.It can be seen that the totipotency of adherent MSCs reduces.
Using same method detection adhere-wall culture the 4th, the adherent MSC in 6 generations, also occur that volume increases, totipotency reduces
Result.
2), the MSCs of adhere-wall culture is independently to osteoblast differentiation
The adherent MSC in adhere-wall culture the 4th generation carries out alkaline phosphatase staining；Result such as Fig. 1 C shows there is a few cell body
Amass and substantially flatten greatly, and in alkaline phosphatase staining positive (red), present autonomous to osteoblastic feature.Can see
Going out, the totipotency of adherent MSCs reduces, autonomous to a direction osteoblast differentiation without induction.
Use same method detection adhere-wall culture the 6th, the adherent MSC in 10 generations, also occur autonomous to a direction skeletonization
The result of cell differentiation.
3), the expression of the MSCs totipotency related gene of adhere-wall culture
In the MSCs of the different generation adhere-wall culture of real-time fluorescence quantitative PCR inspection totipotency gene OCT4, SOX2 and
The expression of NANONG: its primer sees below table 1.ApplicationRT reagent Kit (TaKaRa) kit enters
Row reverse transcription reaction and usePremix Ex TaqTMII (TaKaRa) kit is carried out at ABI 7300QPCR instrument
Real-time fluorescence quantitative PCR reacts.Reverse transcription reaction: 16 ° of C, 30min；42 ° of C, 30s；85 ° of C, enzyme-deactivating 5s；Regularly fluorescent quantitation
Reaction: 95 ° of C denaturations 10min；95 ° of C sex change 15s；60 ° of C annealing 60s, 40 circulations carry out PCR amplification.GAPDH is as interior
Ginseng, Δ Δ Ct method relative quantification.
Part of test results such as Fig. 1 D shows, along with the increase of MSCs passage number, stem cell related gene Oct4,
Sox2, Nanog expression all occurs in that decline (the 6th generation was less than 2nd generation) in various degree.
Using same method detection the 4th, the adherent MSC in 10 generations, expression is below the adherent MSCs of 2nd generation.
It can be seen from the results above that after adhere-wall culture, along with passage number increases, the totipotency of MSCs is gradually lowered.
Therefore, compared with initial in vitro mescenchymal stem cell, the 4th generation adherent MSCs, the 6th generation adherent MSCs, the 10th generation adherent MSCs
It is the mescenchymal stem cell that totipotency reduces.
Embodiment 2, the recovery totipotent cultivation of mescenchymal stem cell
(in the 4th generation adherent MSCs, the 6th generation, are adherent for mescenchymal stem cell that the totipotency that obtained by above-described embodiment 1 reduces
MSCs, the 10th generation adherent MSCs) carry out following two groups of process respectively:
A group: adhere-wall culture: cultural method ibid, obtains the 5th generation adherent MSCs, the 7th generation adherent MSCs, the 11st generation adherent
MSCs。
B group: 3D cultivates, and cultural method is as follows:
1, Hanging drop culture
With digestive juice, the 4th generation adherent MSCs, the 6th generation adherent MSCs, the 10th generation adherent MSCs are digested to unicellular respectively
Suspension, with the DMEM(GIBCO, C11995 of high sugar)+10%(weight/mass percentage composition) hyclone, adjust in single cell suspension thin
Born of the same parents' concentration is 1 × 106Individual/mL, obtains single cell suspension；
Be about 35000 cells with the cell number of every 35 μ l(every) volume above-mentioned cell suspension is dripped uniformly
In the lid of diameter 9cm Micro-Organism Culture Dish (the most adherent culture dish), each Micro-Organism Culture Dish lid hanging drop drips numerical control system at 40,
The most careful the reversing of Micro-Organism Culture Dish lid cover the PBS(concentration equipped with 10ml be 0.01M, pH value be 7.4, sigma, article No.:
On 051M8311) at the bottom of culture dish；It is placed in incubator, stands Hanging drop culture 36h, obtain hanging drop.
2, suspend cultivation
Collect hanging drop and be placed in the Micro-Organism Culture Dish continuation standing equipped with 10ml culture medium (DMEM in high glucose+10% hyclone)
Suspend cultivate 24h, one co-cultures 60h, obtain the 5th generation 3D cultivate MSCs cell ball, the 7th generation 3D cultivate MSCs cell ball, the 11st
MSCs cell ball is cultivated for 3D.
The forming process of above-mentioned cell ball is as shown in Figure 2 (as a example by the 5th generation MSCs cell ball), and A is Hanging drop culture 4h；B
For Hanging drop culture 12h；C is Hanging drop culture 24h；D is Hanging drop culture 36h；E is Hanging drop culture 48h；Cell ball under F:10 × object lens
Form, it can be seen that Hanging drop culture 36h i.e. can get cell ball.
3, digestion
The 5th generation 3D obtained above-mentioned 2 cultivates MSCs cell ball, the 7th generation 3D cultivates MSCs cell ball, the 11st generation 3D cultivates
MSCs cell ball is washed twice through PBS respectively, digests 10min with digestive juice, obtains the 5th generation, the 7th generation and the 11st generation 3D and cultivates MSCs
Cell.
Use same method the 5th generation of digestion, the 7th generation and the MSCs of the 11st generation adhere-wall culture, the 5th generation after being digested,
7th generation and the 11st generation adhere-wall culture MSCs cell.
Three, the totipotency of mescenchymal stem cell after detection 3D cultivates
3D in following test experience cultivates MSCs cell and adherent MSCs cell is postdigestive cell.
1, the change of MSCs biological morphology after 3D cultivates
5th generation, the 7th generation and the 11st generation 3D cultivation MSCs cell is seeded in overnight incubation (12h) in six orifice plates respectively, the
Within two days, ordinary optical microscope is observed；With the 5th generation, the 7th generation and the 11st generation adherent MSCs cell for comparison.
Result is as it is shown on figure 3, result that Fig. 3 A is the 11st generation adherent MSCs cell；Fig. 3 B is that the 11st generation 3D cultivation MSCs is thin
Born of the same parents' result；It can be seen that 3D cultivates cellular morphology starts again to revert to fusiformis, volume diminishes, more third dimension.
Fig. 3 C is the 5th generation and the 7th generation 3D cultivation MSCs cell, the 5th generation and the size at the 7th generation adherent MSCs forward reflection angle
Relatively；It can be seen that compared with attached cell, the forward reflection angle in the 5th generation and the 7th generation cell that 3D cultivates MSCs diminishes, and says
After bright 3D cultivation, the volume of cell reduces (reducing about 42%).
Fig. 3 D is that the 10 × object lens of the 5th generation adherent MSCs are observed；Fig. 3 E is 10 × object lens that the 5th generation 3D cultivates MSCs cell
Observe；It can be seen that the volume of cell is obviously reduced after 3D cultivation.
2,3D cultivates apoptosis and the cell cycle of MSCs
5th generation adherent MSCs and the 5th generation 3D is cultivated MSCs cell PI(P-4170, sigma) dyeing 30min, streaming
Cell instrument detection cell cycle distribution situation.Shown in result as Fig. 4 A-B, A is the cell cycle distribution of the 5th generation adherent MSCs；B
It it is the cell cycle distribution of the 5th generation 3D cultivation MSCs cell；It can be seen that after 3D cultivates, the cell of S phase significantly reduces (patch
Wall is cultivated: 24.92%；3D cultivates: 3.73%), cell is mostly in resting stage, thus maintains the characteristic of MSCs.
5th generation adherent MSCs and the 5th generation 3D are cultivated MSCs cell Annexin V/PI(invitrogen, 944090) double
After dyeing 1h, flow cytometer detection Apoptosis.Result is shown in the Apoptosis that Fig. 4 C-D, C are the 5th generation adherent MSCs；D is the 5th generation 3D
Cultivate the Apoptosis of MSCs cell；It can be seen that the apoptosis rate of cell is 4.2%+0.7% after 3D cultivation, dead cell is
3.3%, and the cell of major part (91%) is living cells；The survival rate of the cell of 3D cultivation and adhere-wall culture, without significant difference, is said
Bright 3D cultivates will not reduce cell survival rate.
3, the MSCs differentiation capability that 3D cultivates
1) the MSCs skeletonization direction differentiation that, induction 3D cultivates
Osteogenic induction is cultivated: be counted as 5 × 104Individual/ml the 5th generation adherent MSCs(is adherent) and it is counted as 5 × 104Individual/ml
5 generation 3D cultivate MSCs cell (3D cultivation) inoculate in six orifice plates respectively, cell reach 80% converge after change fat induction broth into
(10% hyclone, 0.1 μm ol/L dexamethasone, 50 μm ol/L ascorbic acid, the high sugar of 10mmol/L sodium β-glycerophosphate
DMEM culture medium) carry out osteogenic induction cultivation, within every 3 days, change a not good liquor.With do not carry out Fiber differentiation for comparison, addition is normal
Rule nutrient solution (the L-DMEM nutrient solution containing 10%FBS).
Respectively taking each group of cell when inducing 14d and carry out Alizarin red staining, light Microscopic observation is also photographed, and result is shown in Fig. 5 A-D institute
Showing, wherein, A is adherent induction；B is that 3D cultivation is not induced；C is adherent induction；D is that 3D cultivates induction；It can be seen that do not lure
Leading, both cells are without significant difference；After induction, the ability of the MSCs Osteoblast Differentiation that 3D cultivates is higher than adhere-wall culture
MSCs。
2), the MSCs that induction 3D cultivates becomes Adipose Differentiation
It is counted as 5 × 104The 5th generation adherent MSCs(of individual/ml is adherent) and it is counted as 5 × 104The 5th generation 3D of individual/ml cultivates
MSCs cell (3D cultivation) is inoculated in culture dish respectively, cell reach 80% converge after change into fat induction broth (L-DMEM train
Nutrient solution, 10%FBS, dexamethasone 10-6Mol/L, insulin 10mg/L, 3-isobutyl-1-methylxanthine (3-isobutyl-1-
Methylxanthine, IBMX) 0.5mmol/L, Indomethacin 0.2mmol/L) carry out fat induction differentiation cultivation, within every 3 days, change
One not good liquor.With do not carry out Fiber differentiation for comparison, addition for cellar culture liquid (the L-DMEM nutrient solution containing 10%FBS).
Respectively taking each group of cell when inducing 14d and carry out oil red O stain, light Microscopic observation is also photographed, and result is shown in Fig. 5 E-H institute
Showing, E is adherent induction；F is that 3D cultivation is not induced；G is adherent induction；H is that 3D cultivates induction；It can be seen that do not induce, this
Two kinds of cells are without significant difference；After induction, the MSCs that 3D cultivates becomes the ability MSCs higher than adhere-wall culture of Adipose Differentiation.
4, the MSCs cloning capacity detection that 3D cultivates
5th generation adherent MSCs(is adherent) and the 5th generation 3D cultivate MSCs cell (3D cultivation) be suspended in 10% hyclone respectively
DMEM nutrient solution in standby.
Above-mentioned each group of 200 cells are inoculated respectively containing (the L-DMEM cultivation containing 10%FBS of 37 ° of C pre-temperature nutrient solutions of 10mL
Liquid) ware in, and rotate gently, make cell be uniformly dispersed.Put 37 ° of C 5%CO2And the cell culture incubator of saturated humidity is cultivated 2
Week.When culture dish occurs macroscopic clone, carefully embathe with PBS 2 times.Adding 2ml4% paraformaldehyde, fixing cell is solid
Fixed 15 minutes.Removing fixer, add appropriate crystal violet dye liquor and contaminate 30 minutes, then slowly wash away dyeing liquor with flowing water, air is dried.
Clone's number of 10 cells it is more than at microscope (low power lens) counting.Finally calculate cloning efficiency ((Clone formation number/inoculation
Cell number) * 100%).
As shown in Figure 6, A is the clone that blue line is arranged above three multiple holes of adhere-wall culture to result, and lower section is that 3D cultivates
Clone's number；B be adhere-wall culture and 3D cultivate cloning efficiency (adherent con for 19%, 3D for 41%)；C is 10 × object lens
The colony morphology of lower adhere-wall culture；D is the colony morphology that under 10 × object lens, 3D cultivates, it can be seen from the results above that train through 3D
After Yanging, clone's number of MSCs has all had significant raising from quantity or quality.
5, the expression of the MSCs totipotency related gene that 3D cultivates
Inspection the 5th generation adherent MSCs(is adherent for real-time fluorescence quantitative PCR, con) and the 5th generation 3D cultivates MSCs cell, and (3D trains
Support) in migrate related gene CCR1, CCR2, CX3CR, CD49b, CXCR4, the table of totipotency gene OCT4, SOX2 and NANONG
Reach: its primer is shown in Table 1.ApplicationRT reagent Kit (TaKaRa) kit carry out reverse transcription reaction and
WithPremix Ex TaqTMII (TaKaRa) kit carries out real-time fluorescence quantitative PCR at ABI 7300QPCR instrument
Reaction.Reverse transcription reaction: 16 ° of C, 30min；42 ° of C, 30s；85 ° of C, enzyme-deactivating 5s；Regularly fluorescent quantitation reaction: 95 ° of C denaturations
10min；95 ° of C sex change 15s；60 ° of C annealing 60s, 40 circulations carry out PCR amplification.GAPDH is as internal reference, and Δ Δ Ct method is relative
Quantitatively.
Table 1 is the primer of totipotency related gene
| Gene | EMBL-database | Oligonucleotide(5’-3’) |
| CCR1 | NM001295 | For ACCATAGGAGGCCAACCCAAAATA (sequence 1) |
| Rev TCCATGCTGTGCCAAGAGTCA (sequence 2) | ||
| CCR2 | NM000647 | For CTACCTTCCAGTTCCTCATTTTT (sequence 3) |
| RevACATTTACAAGTTGCAGTTTTCAGC (sequence 4) | ||
| CX3CR | NM001337 | For ATAGATTCCCCATTGCCTCCTC (sequence 5) |
| Rev GGTTTTTCTATTTCCCTTACTGG (sequence 6) | ||
| CX3CR | NM001337 | For TGACTGGCAGATCCAGAGGTT (sequence 7) |
| Rev GTAGAATATGGACAGGAACAC(sequence 8) | ||
| CXCR4 | NM003467 | For ATCCCTGCCCTCCTGCTGACTATTC(sequence 9) |
| Rev GAGGGCCTTGCGCTTCTGGTG(sequence 10) | ||
| OCT4 | NM002701 | For GTATTCAGCCAAACGACCATC(sequence 11) |
| Rev CTGGTTCGCTTTCTCTTTCG (sequence 12) | ||
| Nanog | NM_024865.2 | For AATACCTCAGCCTCCAGCAGATG(sequence 13) |
| Rev TGCGTCACACCATTGCTATTCTTC(sequence 14) | ||
| Sox2 | NM_003106 | For GGGAAATGGGAGGGGTGCAAAAGAGG (sequence 15) |
| Rev TTGCGTGAGTGTGGATGGGATTGGTG (sequence 16) |
Result is as it is shown in fig. 7, A is the mrna expression migrating related gene CCR1/CCR2/CX3CR/CD49b；Can see
Going out, the mrna expression migrating related gene CCR1/CCR2/CX3CR/CD49b after 3D cultivates in MSC significantly improves；
B is the mrna expression of CXCR4；It can be seen that in MSC, the mrna expression of CXCR4 is traditional patch after 3D cultivates
More than 2000 times of wall cultivation；
C is the mrna expression of versatility related gene OCT4, SOX2, NANOG；It can be seen that through 3D cultivate after MSC in
The expression of OCT4, SOX2, NANOG substantially increases.
Above-mentioned experimental result illustrates, 3D cultivates the cellular-restoring totipotency that can totipotency be reduced.
Claims (2)
1. recover the mesenchyma totipotent method of dry small cell, comprise the steps:
1) in vitro mescenchymal stem cell Hanging drop culture totipotency reduced, obtains the cell after Hanging drop culture；
2) cell after described Hanging drop culture is continued the cultivation that suspends, it is achieved the in vitro mesenchyma recovering the reduction of described totipotency is done
Cellular omnipotency；
Step 1) in, the in vitro mescenchymal stem cell that described totipotency reduces is for obtain in vitro mescenchymal stem cell through amplification in vitro
The mescenchymal stem cell arrived；
Described amplification in vitro was cultivated as Secondary Culture 4-10 generation；Described Secondary Culture uses the mode of adhere-wall culture；
The in vitro mescenchymal stem cell totipotency that the described totipotency of described recovery reduces is embodied in and reduces what described totipotency reduced
The volume of in vitro mescenchymal stem cell, reduce the cell quantity of in vitro mescenchymal stem cell S phase, enhancing that described totipotency reduces
The differentiation capability of the in vitro mescenchymal stem cell that described totipotency reduces, to strengthen the in vitro mesenchyma that described totipotency reduces dry thin
The cloning capacity of born of the same parents and/or improve in the in vitro mescenchymal stem cell that described totipotency reduces with totipotency related gene expression；
Described is CCR1, CCR2, CX3CR, CD49b, CXCR4, OCT4, SOX2 and/or NANONG with totipotency related gene；
Step 1) in, described Hanging drop culture comprises the steps: that the in vitro mescenchymal stem cell described totipotency reduced suspends,
Obtain cell suspension；Again described cell suspension is dripped on culture dish lid, then the lid after dropping is upside down at the bottom of culture dish,
Cultivate, obtain the cell after hanging drop is Hanging drop culture；
The concentration of described cell suspension is 104-108Individual/mL；
Described Hanging drop culture also comprises the steps: before described cultivation, adds and prevent hanging drop to be dried at the bottom of described culture dish
Water or solution；Described solution be concentration be 0.01M, pH value be 7.4 PBS, physiological saline, cell culture fluid or its
Its buffer solution；
Described culture dish is cell or Micro-Organism Culture Dish；The material of described cell or Micro-Organism Culture Dish is plastics or glass；
Described Hanging drop culture suspends use suspension and described suspension cultivate use culture medium be cell culture medium or
Containing following 1)-3) in the cell culture medium of at least one component:
1) cell growth components is promoted: serum, growth factor, cell factor, trace element, hormone, vitamin, cell signal are logical
Road inhibitor and/or activator；
2) component of cell attachment is helped: collagen, gelatin, hyaluronic acid, cellulose, chondroitin sulfate, peptide, chitin, poly-breast
Acid and/or hydrogel；
3) component that antipathogen infects: antibiotic；
The time of described Hanging drop culture is 2-110 hour；
The described time cultivated that suspends is 2-110 hour；
The condition that described Hanging drop culture and described suspension are cultivated is as follows: oxygen concentration is 0.1-50%, CO2Concentration is 1-15%, temperature
For 30-40 DEG C；
Described Hanging drop culture and described suspension are cultivated and are static culture or dynamic cultivation；The mode of described dynamic cultivation is for stirring
Mix, rotate or shake.
2. a mesenchyma dry small cell cultural method, including the step of the method described in claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210326437.5A CN103667186B (en) | 2012-09-06 | 2012-09-06 | A kind of recovery totipotent method of mescenchymal stem cell |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210326437.5A CN103667186B (en) | 2012-09-06 | 2012-09-06 | A kind of recovery totipotent method of mescenchymal stem cell |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103667186A CN103667186A (en) | 2014-03-26 |
| CN103667186B true CN103667186B (en) | 2016-08-17 |
Family
ID=50305963
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210326437.5A Active CN103667186B (en) | 2012-09-06 | 2012-09-06 | A kind of recovery totipotent method of mescenchymal stem cell |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103667186B (en) |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| TWI525193B (en) * | 2014-10-20 | 2016-03-11 | 國璽幹細胞應用技術股份有限公司 | Uses of trans-cinnamaldehyde |
| CN106854639A (en) * | 2015-12-08 | 2017-06-16 | 中国药科大学 | One kind is based on three-dimensional semisolid adult stem cell cultural method |
| CN106834223B (en) * | 2017-04-05 | 2020-03-27 | 上海逍鹏生物科技有限公司 | Method for inducing differentiation of umbilical cord mesenchymal stem cells into chondrocytes |
| CN110894493A (en) * | 2019-10-28 | 2020-03-20 | 吉林大学 | Reprogramming mesenchymal stem cells and preparation method thereof |
| CN112725276A (en) * | 2021-01-14 | 2021-04-30 | 香港再生医学有限公司 | Suspension shaking culture method for improving yield of MSC (mesenchymal stem cell) differentiated into neural precursor cells |
| CN112870445A (en) * | 2021-01-29 | 2021-06-01 | 周建大 | Preparation method and application of soft tissue repair material |
| CN113106059B (en) * | 2021-04-07 | 2023-08-15 | 清华大学深圳国际研究生院 | High-migration mesenchymal stem cells, and preparation method and application thereof |
| CN113662966B (en) * | 2021-07-09 | 2023-01-24 | 广东医科大学 | Activating vesicle-containing hydrogel for promoting hair regeneration and medicinal application thereof |
| CN115644164A (en) * | 2022-05-09 | 2023-01-31 | 深圳市三启生物技术有限公司 | Preparation method of cell preservation solution and cell preservation solution prepared by preparation method |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011094572A3 (en) * | 2010-01-28 | 2011-12-29 | Shuichi Takayama | Hanging drop devices, systems and/or methods |
-
2012
- 2012-09-06 CN CN201210326437.5A patent/CN103667186B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011094572A3 (en) * | 2010-01-28 | 2011-12-29 | Shuichi Takayama | Hanging drop devices, systems and/or methods |
Non-Patent Citations (2)
| Title |
|---|
| application of hanging drop technique for stem cell differentiation and cytotoxicity studies;meenal banerjee et al.;《cytotechnology》;20060531;第51卷(第1期);1－5 * |
| 悬滴培养诱导大鼠骨髓间充质干细胞分化为肝样细胞;张奇好等;《中国病理生理杂志》;20101231;第26卷(第11期);第2208页第1节-右栏第一页，第2211页左栏第一段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103667186A (en) | 2014-03-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103667186B (en) | A kind of recovery totipotent method of mescenchymal stem cell | |
| CN103805562B (en) | Cultivate the serum free medium of placenta mesenchyma stem cell | |
| Santos et al. | Toward a clinical-grade expansion of mesenchymal stem cells from human sources: a microcarrier-based culture system under xeno-free conditions | |
| Chong et al. | Human peripheral blood derived mesenchymal stem cells demonstrate similar characteristics and chondrogenic differentiation potential to bone marrow derived mesenchymal stem cells | |
| CN107236704B (en) | From the method for placenta separating mesenchymal stem cell and the digestive enzyme compositions used | |
| CN102676451B (en) | Method for separating mesenchymal stem cells from placenta | |
| Sun et al. | Cell proliferation of human bone marrow mesenchymal stem cells on biodegradable microcarriers enhances in vitro differentiation potential | |
| CN102586184B (en) | Method for establishing placental mesenchyme stem cell library | |
| CN102191218B (en) | Complete medium and human amnion-derived mesenchymal stem cell culture method | |
| Saleh et al. | Turning round: multipotent stromal cells, a three-dimensional revolution? | |
| CN106520676B (en) | The method and its application of human amnion membrane are prepared from Human plactnta amnion | |
| CN103146647B (en) | Method for culturing mesenchymal stem cell in vitro | |
| CN109234229B (en) | Method for separating mesenchymal stem cells from placental blood vessels and digestive enzyme composition used in same | |
| CN107022521A (en) | Decidua vera tissue freezing, the method recovered and be separately cultured mescenchymal stem cell | |
| CN103060266A (en) | Method for separating and cultivating II-type epithelial cells of people alveolus pulmonis | |
| Schmidt et al. | The interplay between cell adhesion cues and curvature of cell adherent alginate microgels in multipotent stem cell culture | |
| Loubière et al. | Impact of the type of microcarrier and agitation modes on the expansion performances of mesenchymal stem cells derived from umbilical cord | |
| CN104651305A (en) | Method for acquiring bioactive proteins by utilizing umbilical cord mesenchymal stem cells | |
| CN101831403B (en) | Method for amplifying mesenchymal stem cells of human umbilical cord and placenta in vitro | |
| Zhou et al. | Ex vivo expansion of bone marrow mesenchymal stem cells using microcarrier beads in a stirred bioreactor | |
| Choi et al. | In vitro expansion of human adipose-derived stem cells in a spinner culture system using human extracellular matrix powders | |
| CN104046589B (en) | A kind of method of co-culture of cells induction stem cell in vitro directed differentiation | |
| CN113322231A (en) | Method for separating and culturing mesenchymal stem cells and preparation | |
| Dai et al. | Development of a novel feeding regime for large scale production of human umbilical cord mesenchymal stem/stromal cells | |
| CN107574143B (en) | Method for separating endothelial progenitor cells from cryopreserved cord blood |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |