CN103667167A - Stabilized recombinant expression plasmid vector in Hafnia alvei and application thereof - Google Patents
Stabilized recombinant expression plasmid vector in Hafnia alvei and application thereof Download PDFInfo
- Publication number
- CN103667167A CN103667167A CN201310473169.4A CN201310473169A CN103667167A CN 103667167 A CN103667167 A CN 103667167A CN 201310473169 A CN201310473169 A CN 201310473169A CN 103667167 A CN103667167 A CN 103667167A
- Authority
- CN
- China
- Prior art keywords
- gene
- plasmid
- toxin
- transformant
- decarboxylase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- ZBRRLABBHRYWNV-UHFFFAOYSA-N CCC(C)(C)C(NC(C)(C)C)=O Chemical compound CCC(C)(C)C(NC(C)(C)C)=O ZBRRLABBHRYWNV-UHFFFAOYSA-N 0.000 description 1
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention relates to a transformant obtained by transferring a recombinant plasmid vector into a host cell of Hafnia alvei, wherein the recombinant expression plasmid vector comprises a polynucleotide for coding polypeptidethe expression products and is obtained by deriving from a reproducible skeleton plasmid in the Hafnia alvei. The invention also relates to a method for manufacturing bio-based pentanediamine by using the transformant.
Description
Division statement
The application is the application number submitted on May 31st, 2012 the dividing an application for the Chinese patent application of " in hafnia alvei stable recombinant expression plasmid carrier and application thereof " that be 201210177392.X, denomination of invention.
Technical field
The application belongs to biology field, is specifically related to a kind of stable recombinant expression plasmid carrier and uses thereof.
Background technology
Pentamethylene diamine is a kind of hardware and software platform compound that can be used for producing multi-chemical.Since the eighties in 20th century, the research field of producing pentamethylene diamine with biological process has obtained extensive concern.In biological process, pentamethylene diamine can generate by Methionin decarboxylation.At present, with biological process, produce pentamethylene diamine and mainly adopt following two kinds of methods: microorganism fermentative production or in vitro enzyme catalysis are produced.
In the method for fermentative production Methionin, lysine decarboxylase gene is added in Strains for Lysine Production (as Corynebacterium glutamicum and intestinal bacteria), the approach of biosynthesizing Methionin is further extended to the approach of synthetic pentamethylene diamine.Yet the pentamethylene diamine productive rate of having reported is lower than using the identical bacterial classification that does not contain lysine decarboxylase gene to produce the productive rate of Methionin.Productive rate is low may be because pentamethylene diamine is to producing the toxicity restraining effect of bacterial strain.
In addition, can transform or utilize induction to express lysine decarboxylase bacterium, for the external Methionin decarboxylic reaction of catalysis biological.A kind of method is, in hafnia alvei (Hafnia alvei, the H.alvei) bacterial strain without transformation, the lysine decarboxylase gene of chromosome coding is carried out to abduction delivering.Yet the production of enzyme that this kind of method reported is low.Another kind method relates to the structure of recombinant bacteria.For example, some (JP2009028045 of company of Japan, U57189543, CN102056889) structure of the intestinal bacteria recombinant bacterium that report can overexpression lysine decarboxylase in succession, and utilize full cell or the decarboxylation of cell pyrolysis liquid catalysis Methionin to obtain pentamethylene diamine.Yet great expression makes expression plasmid unstable after going down to posterity several times to the poisonous protein of host cell.Must in fermented liquid, use microbiotic to guarantee the stable of in culturing process recombinant plasmid.
Antibiotic use may cause antibiosis to have the development of drug-fast bacterium, also can in environment, keep high-caliber resistance microorganism.For example, see Martinez, " Environmental pollution by antibiotics and by antibiotic resistance determinants; " Environmental Pollution (2009), Vol.157, Issue11,2893-2902.Owing to antibiosis being have to the harm of drug-fast bacterium to healthy and ecotope, antibiotic use is not environmental protection.Therefore, we need a more effective recombinant plasmid vector, can not have under the condition of antibiotic-screening, and repeatedly continuous passage still keeps stable.
Summary of the invention
Describe in detail
Detail in the following describes is only used to fully understand embodiments of the invention.But will be appreciated that as those skilled in the art enforcement of the present invention is not limited to these details.In addition, known structure and function is by detailed description or displaying, with the main points of the embodiment of the present invention of having avoided fuzzy.
The amino acid that used in the present invention, polypeptide, base sequence, the abbreviation of nucleic acid, it is the regulation to biological chemical name based on International Union of Pure and Applied Chemistry and international bio federation, be published in the abbreviation in " preparing the guidance containing the specification sheets of base sequence and aminoacid sequence " (United States Patent and Trademark Office) literary composition of the 138th the 9th phase of volume of European Journal of Biochemistry1984, and general abbreviation in biological technical field.
" nucleotide sequence " discussed in the disclosure, " polynucleotide " or " DNA molecular ", may comprise double-stranded DNA (that is, the double-stranded DNA being comprised of positive-sense strand and antisense strand) or single stranded DNA, and fragment.A part that refers to this nucleotide sequence in this " its fragment ", the function of the polypeptide that the polypeptide of its coding and the complete sequence of this nucleotide sequence are coded is basic identical.For example, a kind of Nucleotide of the toxin-resistant gene of encoding is expressed the polypeptide of the polypeptide that can neutralize a toxin.The expressed polypeptide of a fragment of Nucleotide of coding toxin-resistant gene also can neutralize this toxin polypeptide, and therefore the polypeptide expressed with the complete sequence of the Nucleotide of coding toxin-resistant gene compared the function that provides roughly the same.Equally, the expressed polypeptide pair of the complete sequence of the Nucleotide of the Nucleotide of toxin-encoding gene polypeptide that fragment is expressed and toxin-encoding gene has essentially identical toxicity with cell.
Here the nucleotide sequence of mentioning, polynucleotide or DNA molecular are not limited only to functional zone, may comprise at least one expression regulation district, coding region, leader sequence, exon, intron and expression cassette (are shown in, for example Papadakis et al., " Promoters and Control Elements:Designing Expression Cassettes for Gene Therapy; " Current Gene Therapy (2004), 4,89-113).In addition, the example of nucleotide sequence or polynucleotide may refer to RNA or DNA.The polynucleotide that has the polypeptide of specific aminoacid sequence and have a specific DNA sequence dna may comprise fragment, homologous sequence, derived sequence and the mutant nucleotide sequence of this sequence.The example of the mutant of nucleotide sequence or polynucleotide (as mutant DNA), comprises abiogenous sudden change, artificial mutation, and/or deletes, and replaces the sudden changes such as interpolation and/or insertion.The coded polypeptide of this mutant is construed as with the former nucleotide sequence coded polypeptide of not sudden change has in fact identical function.
Content disclosed in this invention comprises a stable recombinant expression plasmid carrier, comprises following part:
The polynucleotide of one section of coding toxin-resistant gene, it expresses a peptide species, neutralizes a kind of polypeptide poisonous to host cell, and corresponding poisonous polypeptide is expressed in host cell by the polynucleotide of one section of toxin-encoding gene with it,
The polynucleotide of one section of coded polypeptide expression product, wherein,
This stable recombinant expression plasmid carrier forms by reproducible skeleton plasmid in host cell is derivative.
In certain embodiments, this toxin gene is encoded in the chromogene group of host cell.
In certain embodiments, this stable recombinant expression plasmid carrier further comprises the polynucleotide of toxin-encoding gene.
In certain embodiments, the polynucleotide of the polynucleotide of this toxin-encoding gene and/or coding toxin-resistant gene is recombinated.
In certain embodiments, toxin gene, the one or more genes in the polynucleotide of toxin-resistant gene and coded polypeptide expression product are further optimized by codon optimized technology, to provide better expression to corresponding polypeptide in host cell.For example, optimize the optimization that toxin gene can comprise DNA sequence dna, to compare express polypeptide toxin better with sequence SEQ ID NO:1 or SEQ ID:3.In certain embodiments, toxin-resistant gene comprises the DNA sequence dna of further optimization, to compare and to express better toxinicide polypeptide with sequence SEQ ID NO:2 or SEQ ID:4.In certain embodiments, the gene of expression of polypeptides product comprises the DNA sequence dna of further optimization, to compare express polypeptide expression product better with sequence SEQ ID NO:5 or SEQ ID:6.
Codon optimized is a kind of technology, and it obtains protein expression to greatest extent by increasing the translation efficiency of interested gene in host cell.The DNA nucleotide sequence of species is optimized to the DNA nucleotide sequence into another species.DNA sequence dna is divided into triad (codon).A kind of amino acid whose low frequency codon is replaced by the high frequency codon of same amino acid in host cell.Thus, the expression of the DNA sequence dna of optimization in host cell improves.For example see
http:// www.guptalab.org/shubhg/pdf/shubhra codon.pdf, about codon optimized technology introduction, in this as reference, all include in.
Toxin/toxin-resistant gene used herein is to there being two genes, and one of them is toxin gene, expresses the virose polypeptide of host cell, and another is toxin-resistant gene, and the polypeptide of expression can neutralize the toxicity of this toxin polypeptide to host cell.
The toxin gene that some prokaryotic organism contains one or more chromosome codings.Some prokaryotic organism contains the right endogenous plasmid of coding particular toxin/toxin-resistant gene.(see, Wertz et al. " Chimeric nature of two plasmids of Hafnia alvei encoding the bacteriocins alveicins A and B. " Joumal of Bacteriology., (2004) 186:1598-1605.) toxin/toxin-resistant gene to conventionally playing a role in maintaining the stable and stress reaction of genetic information.While having karyomit(e) or plasmid-encoded toxin-resistant gene in cell, toxinicide albumen can continuous expression, and the albumen that neutralizes a toxin, maintains the survival of cell.In some prokaryotic organism, the degradation speed of toxinicide albumen is faster than toxin protein.If the plasmid with toxin-resistant gene is lost in cell, the time that synthetic toxin protein is left over can be longer than toxinicide albumen, can cell killing or cell growth inhibiting.Therefore, keeping under the prerequisite of cell survival, with toxin-resistant gene or the right plasmid of toxin/toxin-resistant gene, be difficult for losing.
Toxin/toxin-resistant gene is to including but not limited to, abt/abi gene pairs, aat/aai gene pairs, and fragment.In certain embodiments, toxin gene comprises DNA sequence dna SEQ ID NO:1, or SEQ ID NO:3.In certain embodiments, toxin-resistant gene comprises DNA sequence dna SEQ ID NO:2, or SEQ ID NO:4.
Host Strains used herein refers to the microorganism that can be transformed by stable recombinant plasmid vector.Host Strains includes, but not limited to hafnia alvei (H.alvei).
In certain embodiments, Host Strains is natural does not contain endogenous plasmid or has eliminated original endogenous plasmid.Term " elimination " (cured) refers to endogenous plasmid to eliminate from Host Strains at this.The resulting Host Strains that does not contain endogenous plasmid is called as " having eliminated " Host Strains.
In certain embodiments, as host's H.alvei bacterial strain, can from any known H.alvei strain, select.For example, without the H.alvei strain of endogenous plasmid, there are the H.alvei strain of pAlvA endogenous plasmid and its plasmid to eliminate strain (pAlvA-strain), have the H.alvei strain of pAlvB endogenous plasmid and its plasmid to eliminate strain (pAlvB-strain).
In certain embodiments, Host Strains is the industrial strain that is applicable to being applied to technical scale or scale operation.For example, industrial strain can be cultivated in fermentation container.The scale of cultivating can rise to millions of liters from hundreds of.Contrary laboratory strains is cultivated conventionally in several liters or less scale.In certain embodiments, industrial strain can be grown in the simpler and more economical nutrient solution of relative laboratory strains.
Expression of polypeptides product is the peptide species being produced by Host Strains.Expression of polypeptides product includes but not limited to, the expression of polypeptides product that any intestinal bacteria can produce, for example, enzyme (as decarboxylase, lytic enzyme, Starch phosphorylase).For example, decarboxylase is amino acid decarboxylase.For example, decarboxylase is lysine decarboxylase, tyrosine deearboxylase, arginine decarboxylase, ornithine decarboxylase, or L-Glutamic decarboxylase.In one embodiment, decarboxylase is lysine decarboxylase.In another embodiment, the polynucleotide of coding lysine decarboxylase comprises cadA gene, haldc gene or its fragment.In another embodiment, the polynucleotide of coding lysine decarboxylase comprises DNA sequence dna SEQ ID NO:5 or SEQ ID NO:6.In another embodiment, lytic enzyme is glucuroide, alpha-glucosidase, beta-glucosidase, mannosidase, alpha-Mannosidase, beta-Mannosidase, fructosidase, beta-fructosidase enzyme, xylosidase, α-xylosidase, xylobiase, tilactase, alpha-galactosidase, beta-galactosidase enzymes, Sumylact L, amylase, α-amylase, beta-amylase, myrosin, chitinase, sucrase, maltin, saccharase, Unidasa, or neuraminidase.In a preferred embodiment, the polynucleotide of coding beta-galactosidase comprises lacZ gene or its fragment.
Reproducible skeleton plasmid can be any plasmid that can copy in Host Strains.In one embodiment, stable recombinant expression plasmid is to form by a skeleton plasmid that can copy in hafnia alvei is derivative.Skeleton plasmid includes but not limited to, pUC (for example pUC18 and pUC19 plasmid), pBR322, pACYC plasmid, and their plasmid.
Used herein, so-called recombinant plasmid " forms by reproducible skeleton plasmid in host cell is derivative ", refer to that this recombinant plasmid by inserting the polynucleotide of one or more coding toxin-resistant genes in skeleton plasmid, the polynucleotide of one or more toxin-encoding genes, and/or the polynucleotide of one or more coded polypeptide expression products, and their arbitrary combination is carried out construction recombination plasmid.
Content disclosed in this invention also comprises the transformant that one or more stable recombinant plasmid vectors disclosed herein is transformed into Host Strains and obtains.
Here the transformant of mentioning refers to the Host Strains changing by introducing one or more stable recombinant plasmid vectors.In certain embodiments, transformant obtains by transforming to possessing competent host cell introduction recombinant plasmid vector.
In described transformant with the stability of toxin-resistant gene or the right plasmid of toxin/toxin-resistant gene higher than the stability that does not contain the right recombinant plasmid of toxin-resistant gene or toxin/toxin-resistant gene in same Host Strains.
In one embodiment, Host Strains is the hafnia alvei that a strain does not contain endogenous plasmid.The H.alvei strain that does not contain endogenous plasmid can be the natural bacterial strain that there is no endogenous plasmid, can be also the bacterial strain after a plasmid is eliminated as mentioned before.Stable recombinant plasmid vector, with one or more toxin-resistant genes, is selected from abi gene, aai gene, and fragment, and/or with one or more toxin/toxin-resistant genes pair, be selected from abt/abi gene pairs, aat/aai gene pairs and fragment thereof.
Content disclosed in this invention also comprises a method of producing pentamethylene diamine:
1a) cultivate a transformant with stable recombinant expression plasmid disclosed herein;
1b) with the bacterium liquid catalysis Methionin decarboxylation obtaining in step 1a, generate pentamethylene diamine;
1c) from the reaction solution of step 1b, reclaim pentamethylene diamine.
" the bacterium liquid that uses step 1a to obtain " mentioned herein may comprise the further processing of the bacterium liquid that step 1a is obtained.For example, with buffered soln dilution bacterium liquid, or centrifugal acquisition thalline, again thalline is resuspended in buffered soln, or cellular lysate is made to lysate, or/and the lysine decarboxylase of purifying from cellular lysate liquid.
Transformant can be cultivated in the substratum that contains carbon source and non-carbon nutrition source.Carbon source is including but not limited to sugar (carbohydrate, as glucose and fructose), oily and/or fatty, lipid acid, and/or its derivative.Oil & fat comprises saturated and/or unsaturated fatty acidss more than ten carbon, as cocounut oil, and plam oil, palm-kernel wet goods.Lipid acid can be saturated and/or unsaturated fatty acids, as caproic acid, sad, capric acid, lauric acid, oleic acid, palmitinic acid, linolic acid, linolenic acid, Rou Dou guan acid etc.Derivative of fatty acid includes but not limited to fatty acid ester and soap.Non-carbon nutrition source includes but not limited to nitrogenous source, inorganic salt and other organotrophy sources.
For example, substratum comprises the absorbable carbon source of transformant, can also comprise one or more other nutrition sources, as nitrogenous source, inorganic salt and other organotrophy sources.In certain embodiments, in substratum, the weight percent of nitrogenous source accounts for 0.01 to 0.1%.Nitrogenous source comprises ammonia, ammonium salt (as ammonium chloride, ammonium sulfate and ammonium phosphate), peptone, meat extract, yeast extract etc.Inorganic salt include but not limited to, potassium primary phosphate, dipotassium hydrogen phosphate, trimagnesium phosphate, magnesium sulfate, sodium-chlor etc.Other organotrophy sources include, but not limited to amino acid (as glycine, L-Ala, Serine, Threonine and proline(Pro)), VITAMIN (as VITMAIN B1, vitamin B12 and vitamins C), etc.
Bacterium liquid is cultivated and can at any temperature that can allow mycetocyte grow, be carried out.More suitable temperature is at approximately 20 to 40 ℃, or approximately 35 ℃.Incubation time can be about approximately 1 day, approximately 2 days, approximately 3 days, approximately 4 days, approximately 5 days, approximately 6 days, approximately 7 days, approximately 8 days, approximately 9 days or approximately 10 days.
In one embodiment, the substratum of transformant contains peptide, peptone, VITAMIN (as vitamin B group), trace element (as nitrogen, sulphur, magnesium), and mineral substance.Such substratum includes, but are not limited to well-known LB substratum (being dissolved in water (as distilled water or deionized water) by Tryptones, yeast extract and NaCl makes).
In one embodiment, step 1c is further comprising the steps of:
1d) separated solid and liquid portion by the resulting reaction solution of step 1b;
1e) pH regulator of the liquid portion obtaining in step 1d is arrived to approximately 14 or higher;
1f) remove the moisture in the liquid obtaining in step 1e;
1g) reclaim pentamethylene diamine.
In step 1d, the solid-liquid part of separating step 1b reaction solution, can realize by traditional centrifugal and/or filtration.
In step 1e, in step 1d, the pH value of the liquid component of gained can be by adding alkali, as sodium hydroxide regulates.Sodium hydroxide can add with the form of solid or solution (as the aqueous solution).
In step 1f, moisture content can be removed by normal pressure or vacuum distilling.
In step 1g, pentamethylene diamine can reclaim by normal pressure or vacuum distilling.
Content disclosed in this invention, also comprises with the prepared bio-based pentamethylene diamine of method disclosed herein.
The compound of " bio-based " mentioned here refers to the compound that is considered to bio-based according to ASTMD6866 standard.Described ASTMD6866 standard refers to the ASTM D6866 of American Standard of Testing Materials association testing standard, its name is called " by the test method of radiocarbon C14 assay solid, the biological content of liquids and gases sample " (Standard Test Methods for Determining the Biobased Content of Solid, Liquid, and Gaseous Samples Using Radiocarbon Analysis), ASTM D6866 is the standard method that industrial utilization carbon 14 is measured biomass content.
Content disclosed in this invention also comprises a kind of polymeric amide, and it comprises the structure of structural formula 1:
Structural formula 1
And steric isomer, wherein:
M=4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21, or 22;
N=4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21, or 22;
J=approximately 100～approximately 1,000, and 000;
One or more diprotic acid polymerizations that one or more diamines that described polymeric amide is m by carbonatoms and carbonatoms are n make, the bio-based carbon that at least one in diamine, diprotic acid comprises the renewable source that meets ASTM D6866 standard, and the m of this diamine or diprotic acid or n can be identical or different.
In one embodiment, diamine is bio-based pentamethylene diamine, the bio-based pentamethylene diamine of preferably preparing by disclosed method in the present invention.The example of diprotic acid includes, but are not limited to: ten carbon dicarboxylic acids, DC11, SL-AH, tridecanyldicarboxylic acid, DC14,16-dicarboxylic acid, DC18, and their arbitrary combination.In certain embodiments, all or part of diprotic acid is bio-based.
In another embodiment, the contained structure of polymeric amide, with mentioned above, is to be made by bio-based pentamethylene diamine and one or more diprotic acid polymerizations, and the bio-based pentamethylene diamine of preferably preparing according to method provided by the present invention;
N=4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21, or 22;
J=approximately 100～approximately 1,000,000 or j=approximately 1000～approximately 100,000 or j=approximately 1000～approximately 10,000; And
Diprotic acid comprises the bio-based carbon that meets ASTMD6866 standard.
The present invention also discloses the preparation method of polymeric amide disclosed herein, comprising:
According to method provided by the present invention, prepare bio-based pentamethylene diamine, as diamine.
In one embodiment, the method further comprises one or more bio-based diprotic acid of preparation.
In another embodiment, the method further comprises that reacting bio-based pentamethylene diamine prepares polymeric amide with one or more bio-based diprotic acid.
In the present invention, disclosed content also comprises the composition that contains one or more polymeric amide disclosed herein.
In one embodiment, diamine is bio-based pentamethylene diamine, the bio-based pentamethylene diamine of preferably preparing by disclosed method in the present invention.The example of diprotic acid includes, but are not limited to: ten carbon dicarboxylic acids, DC11, SL-AH, tridecanyldicarboxylic acid, DC14,16-dicarboxylic acid, DC18, and their arbitrary combination.In certain embodiments, all or part of diprotic acid is bio-based.
In another embodiment, the contained structure of polymeric amide, with mentioned above, is to be made by bio-based pentamethylene diamine and one or more diprotic acid polymerizations, and the bio-based pentamethylene diamine of preferably preparing according to method provided by the present invention;
N=4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21, or 22;
J=approximately 100～approximately 1,000,000 or j=approximately 1000～approximately 100,000 or j=approximately 1000～approximately 10,000; And
Diprotic acid comprises the bio-based carbon that meets ASTMD6866 standard.
The present invention also discloses a kind of pentamethylene-1 of preparing, 5-isocyanic ester (1, method 5-diisocyanatopentane), comprising:
2a) according to the method disclosed in the present, prepare bio-based pentamethylene diamine;
2b) resulting bio-based pentamethylene diamine in step 2a is converted into pentamethylene-1,5-isocyanic ester.
The method of step 2b can adopt known diamine to be converted into the method for isocyanic ester.For example traditional phosgenation, comprises a step high temperature phosgenation, at high temperature phosgene is mixed and makes isocyanic ester with diamine, and improved two step phosgenations thus, and by triphosgene, replace the triphosgene of phosgene.In addition do not adopt phosgene as the method for raw material in addition, for example, use CO
2the hexanediamine carbonylation method that replaces phosgene: pass into CO in primary amine and organic bases solution
2, in reaction mixture, add again appropriate phosphorous electrophilic reagent, there is dehydration thermopositive reaction, make isocyanic ester.Again for example, carbamate thermal decomposition method, first prepares carbamate with primary amine, reheats cracked ammonium carbamate and makes isocyanic ester.
Below in conjunction with specific embodiment, the present invention will be further described, should be understood that following examples are only not used in the scope of the present invention that limits for the present invention is described.For a person skilled in the art, any change of making within the scope of the present invention, modification or directly adopt the equal conditions in embodiment and the example implemented, be all interpreted as in covering scope of the present invention.In addition,, as set forth in the present invention, all reference that the present invention quotes are all included in the present invention with complete form.
Accompanying drawing explanation
Fig. 1 is the structure of the pPlac-cadA-abtabi recombinant expression plasmid described in example 1.A) use the PCR product of the cadA that e. coli bl21 karyomit(e) obtains for template; B) cadA PCR product is connected to the pMD18-T-cadA plasmid obtaining on pMD18-T carrier, wherein, there is one section of lacZ gene fragment 5 ' position of cadA gene; C) with PCR site-directed mutagenesis, delete after lacZ gene fragment the pPlac-cadA plasmid of formation; D) with H.alvei plasmid pAlvB, be template, the PCR product with HindIII site and abt/abi obtaining, this PCR product is connected to pMD18-T carrier subsequently; E) with HindIII enzyme, cut pPlac-cadA and containing the pMD18-T plasmid of abt/abi fragment, the main body of pPlac-cadA plasmid be connected with abt/abi fragment, obtaining pPlac-cadA-abtabi recombinant expression plasmid.
Fig. 2 is the recombinant bacterium JM109/pPlac-cadA described in embodiment 3, and the bacterium liquid of gained is cultivated in continuous passage, the colony growth situation after gradient dilution on LB and LB/AMP flat board.
Fig. 3 is the recombinant bacterium Ha/pPlac-cadA described in embodiment 3, and the bacterium liquid of gained is cultivated in continuous passage, the colony growth situation after gradient dilution on LB and LB/AMP flat board.
Fig. 4 is the recombinant bacterium Ha described in embodiment 3
c/ pPlac-cadA-abtabi, the bacterium liquid of gained is cultivated in continuous passage, the colony growth situation after gradient dilution on LB and LB/AMP flat board.
Embodiment
The structure of embodiment 1-CadA recombinant expression plasmid
E. coli bl21 (Biomed company) chromosomal DNA of take is template, with primer 1 and 2 (primer 1, SEQ ID:NO7:ATGAACGTTATTGCAATATT, primer 2, SEQ ID:NO8:ACTGAAAGCTTCCACTTCCCTTGTACGAGCT) (Fig. 1 is a) to copy cadA gene.By this PCR product and the derivative T carrier of pUC18-, pMD18-T (TaKaRa company) connects.Select cadA gene and lac promotor (Plac) connection product in the same way.The plasmid called after pMD18-T-cadA (Fig. 1 b) producing
The a bit of lacZ gene of the contained cadA gene of pMD18-T-cadA and its 5' end is in same reading frame.Therefore, by site-directed mutagenesis PCR, delete this unnecessary lacZ fragment.PCR reaction comprises: 50ng plasmid DNA, 10pmole primer 3 (SEQ ID:NO9:ATTCAATATTGCAATAACGTTCATAGCTGTTTCCTGTGTG), dNTPs (every kind of 0.25mM), 1 μ LPfuDNA polysaccharase (Biomed company), 1 μ L Taq DNA ligase (NEB), 4 μ L Pfu archaeal dna polymerase 10 * damping fluids, 5 μ L Taq DNA ligase 10 * damping fluids, adding deionized water to cumulative volume is 50 μ L.Thermal cycle conditions is identical with conventional PCR.After PCR reaction finishes, add 1 μ L DpnI (NEB) restriction endonuclease, at 37 ℃ of reaction 1hr.With this PCR reaction solution of 10 μ L, transform 100 μ L e. coli bl21 competent cells.From transformant bacterium colony, extract plasmid, with primer 4 (SEQ ID:NO10:AGGAAACAGCTATGAACGTT) order-checking.On expection plasmid, the lacZ fragment of cadA gene 5' end should be deleted.The expection plasmid obtaining through sequence verification, called after pPlac-cadA (Fig. 1 c).
The H.alvei bacterial strain using in the present embodiment contains pAlvB endogenous plasmid.Toxin/toxin-resistant gene on pAlvB plasmid is to being abt/abi gene pairs.According to pAlvB sequence (GenBank:AY271829) design the primer 5 and 6 (primer 5 of announcing, SEQ ID:NO11:ACTGAAAGCTTTACTTTCATCACAAGCCTCT, primer 6, SEQ ID:NO12:ACTGAAAGCTTAGATTCAGCGCGAGAGTGAT), these two primers have been introduced a pair of HindIII restriction enzyme site (Fig. 1 d) at the two ends of fragment.Take pAlvB as template, copy one section of fragment that contains abt/abi gene.PCR product is connected to pMD18-T carrier.Then this connection product is cut with HindIII enzyme, obtained the fragment of one section of approximately 1.8kb that contains abt/abi gene.Again pPlac-cadA plasmid is also cut with HindIII enzyme, obtained the fragment of one section of about 4.8kb.Finally, pPlac-cadA fragment and abt/abi fragment are linked together, form recombinant expression plasmid, pPlac-cadA-abtabi (Fig. 1 e).
Because the H.alvei bacterial strain using in the present embodiment contains endogenous plasmid, first this H.alvei bacterial strain is carried out to plasmid elimination, obtain the H.alvei strain (H.alvei without endogenous plasmid
c).Again recombinant expression plasmid pPlac-cadA-abtabi is transformed into H.alvei
c.This recombinant expression plasmid is cultivated and still can be kept stable through 5 times or more times continuous passage under the condition of antibiotic-free screening.
The elimination of embodiment 2-hafnia alvei endogenous plasmid
One strain is done to plasmid with the H.alvei (Ha) of pAlvB endogenous plasmid to be eliminated.First with a recombinant expressed antitoxic pUC plasmid, removing host relies on the existence of pAlvB.Using the derivative plasmid of pUC as skeleton plasmid, is because it can copy in H.alvei, and its copy number can raise and improve with culture temperature.Therefore, having under the condition of antibiotic-screening and higher culture temperature, pUC plasmid is had the advantage in the competition with pAlvB, makes the latter be easy to lose.On pUC plasmid recombinant expressed Abi toxinicide albumen can in and the Abt toxin protein left over of pAlvB, make the host cell can be dead.
Take pAlvB as template, with primer 6 and 7 (primer 7, SEQ ID:NO13:ACTGAAAGCTTTTTAATTGTGTGACCACTAT), copy abi gene.PCR product is connected to pMDl8-T carrier (containing ampicillin resistance gene), and this connection product is named as pMDl8-T-abi.With this plasmid, transform with CaCl
2the H.alvei competent cell that legal system is standby.The preparation method of H.alvei competent cell is identical with the preparation method of conventional E.coli competent cell.
In the transformant of gained, comprise two plasmid: pAlvB and pMD18-T-abi.Transformant is lined on LB/AMP flat board, 40 ℃ of incubated overnight.For longer bacterium colony, with primer 5 and 6, be bacterium colony PCR.The bacterium colony of having eliminated pAlvB does not have PCR product.
Next step is to remove pMD18-T-abi plasmid from eliminated the H.alvei bacterial strain of pAlvB.This bacterial strain is lined not containing on the LB flat board of penbritin, 40 ℃ of incubated overnight.Longer bacterium colony is lined again not containing on the LB flat board of penbritin, 40 ℃ of incubated overnight.Longer bacterium colony is done to bacterium colony PCR with primer 6 and 7.The bacterium colony of having eliminated pMD18-T-abi does not have PCR product.With the bacterial strain that plasmid extraction test kit (Axygen company) is eliminated plasmid, carry out DNA extraction, do not obtain plasmid DNA.
The bacterial strain that this plasmid is eliminated is named as H.alvei
c(Ha
c).
Embodiment 3-toxin/toxin-resistant gene is to making the CadA expression plasmid in H.alvei stable
The stability of recombinant plasmid in host detects by the following method: continuous passage recombinant bacterial strain in non-selective nutrient solution, the bacterium liquid of at every turn cultivating gained is carried out to gradient dilution, be coated in respectively on non-selective and selectivity flat board the total cell count in estimation and relatively bacterium liquid and containing the cell count of plasmid.
By 3 recombinant bacterial strains (JM109/pPlac-cadA, Ha/pPlac-cadA, Ha
c/ pPlac-cadA-abtabi) single bacterium colony is inoculated in respectively that in the LB nutrient solution that contains penbritin, (JM109 is E.coliJM109 bacterial strain (Biomed company); Ha is the H.alvei bacterial strain that contains endogenous plasmid pAlvB; Ha
cfor having eliminated the H.alvei bacterial strain of endogenous plasmid), in 35 ℃ of shaking tables, grow 1 day (seed liquor).Then with 0.1% rate of vaccination, be inoculated in the fresh LB nutrient solution without penbritin.In 1 day (going down to posterity for the 1st time) of same temperature growth.Then with identical rate of vaccination and identical growth conditions continuous passage and cultivation (the 2nd to the 5th go down to posterity).Each bacterium liquid finishing of cultivating carries out 10 * gradient dilution with 0.85% aseptic sodium chloride solution.The sample of getting after 5 μ L dilutions is put respectively on and LB/AMP flat board dull and stereotyped in LB.35 ℃ of incubations 1 day.On the flat board without penbritin, can estimate the total cellular score of bacterium liquid, on having the flat board of penbritin, can estimate in bacterium liquid the quantity (Fig. 2 (JM109/pPlac-cadA) with the cell of plasmid, Fig. 3 (Ha/pPlac-cadA), Fig. 4 (Ha
c/ pPlac-cadA-abtabi)).
In non-selective nutrient solution, through 2 to 3 continuous passages, the ratio of the bacterium that contains plasmid in JM109/pPlac-cadA and Ha/pPlac-cadA bacterium liquid drops to 1% left and right (Fig. 2 and 3).In contrast, through 5 continuous passages, Ha
cthe ratio of the bacterium that contains plasmid in/pPlac-cadA-abtabi bacterium liquid is still 100% (Fig. 4).Therefore,, in H.alvei, toxin/toxin-resistant gene makes recombinant expression plasmid in the situation that there is no antibiotic-screening, also can keep stable.
Reference
The All Files that present patent application is mentioned, though only mention its title, treats as and quotes in full, and includes in this application form.
Claims (16)
1. a transformant, it enters host cell and obtains by recombinant plasmid vector is shifted, and wherein said host cell is hafnia alvei; The polynucleotide that described recombinant plasmid vector comprises one section of coded polypeptide expression product, and described recombinant plasmid vector forms by reproducible skeleton plasmid in hafnia alvei is derivative.
2. transformant according to claim 1, wherein said recombinant plasmid vector is stable, and comprise the polynucleotide of one section of coding recombinant type toxin-resistant gene, it expresses a peptide species, neutralize the polypeptide poisonous to host cell, this poisonous polypeptide is expressed in host cell by the polynucleotide of one section of toxin-encoding gene.
3. transformant according to claim 2, wherein said recombinant plasmid vector also comprises the polynucleotide of toxin-encoding gene.
4. transformant according to claim 3, wherein said toxin gene and toxin-resistant gene are selected from aat/aai gene pairs, the gene pairs of abt/abi gene pairs and fragment thereof.
5. according to the transformant described in claim 3 or 4, wherein said toxin gene comprises and is selected from the DNA sequence dna shown in SEQ ID NO:1 or SEQ ID NO:3, or its fragment.
6. according to the transformant described in any one in claim 1 to 5, wherein said toxin-resistant gene comprises and is selected from the DNA sequence dna shown in SEQ ID NO:2 or SEQ ID NO:4, or its fragment.
7. transformant according to claim 1, wherein said skeleton plasmid is for comprising pUC (pUC18/19), pBR322, arbitrary plasmid of pACYC and its plasmid.
8. according to the transformant described in any one in claim 1 to 7, wherein said hafnia alvei is the hafnia alvei without endogenous plasmid.
9. according to the transformant described in any one in claim 1 to 7, wherein said hafnia alvei is the hafnia alvei that has endogenous plasmid.
10. according to the transformant described in any one in claim 1 to 7, it is characterized in that the industrial strain that described hafnia alvei is hafnia alvei.
11. according to the transformant described in any one in claim 1 to 10, and wherein said expression of polypeptides product comprises decarboxylase, at least one in lytic enzyme and Starch phosphorylase.
12. transformants according to claim 11, wherein said decarboxylase is amino acid decarboxylase.
13. transformants according to claim 12, wherein said decarboxylase is selected from lysine decarboxylase, tyrosine deearboxylase, arginine decarboxylase, ornithine decarboxylase, or L-Glutamic decarboxylase.
14. transformants according to claim 13, the polynucleotide of the described lysine decarboxylase of wherein encoding is selected from haldc gene, cadA gene with and fragment.
15. transformants according to claim 14, the polynucleotide of wherein said coding lysine decarboxylase is the DNA sequence dna as shown in SEQ ID NO:5 or SEQ ID NO:6, or its fragment.
16. 1 kinds of methods of producing 1,5-pentamethylene diamine, comprising:
1a) cultivate the transformant as described in claims 14 or 15;
1b) with the bacterium liquid catalysis Methionin decarboxylation obtaining in step 1a, generate 1,5-pentamethylene diamine; With
In reaction solution 1c) obtaining, extract purifying and obtain 1,5-pentamethylene diamine from step 1b.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310473169.4A CN103667167A (en) | 2012-05-02 | 2012-05-31 | Stabilized recombinant expression plasmid vector in Hafnia alvei and application thereof |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210134682.6 | 2012-05-02 | ||
| CN201210134682 | 2012-05-02 | ||
| CN201310473169.4A CN103667167A (en) | 2012-05-02 | 2012-05-31 | Stabilized recombinant expression plasmid vector in Hafnia alvei and application thereof |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210177392.XA Division CN102851307B (en) | 2012-05-02 | 2012-05-31 | Recombinant expression plasmid vector stable in Hafnia alvei, and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103667167A true CN103667167A (en) | 2014-03-26 |
Family
ID=47398283
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310473169.4A Pending CN103667167A (en) | 2012-05-02 | 2012-05-31 | Stabilized recombinant expression plasmid vector in Hafnia alvei and application thereof |
| CN201210177392.XA Active CN102851307B (en) | 2012-05-02 | 2012-05-31 | Recombinant expression plasmid vector stable in Hafnia alvei, and application thereof |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210177392.XA Active CN102851307B (en) | 2012-05-02 | 2012-05-31 | Recombinant expression plasmid vector stable in Hafnia alvei, and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN103667167A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106834322A (en) * | 2017-03-14 | 2017-06-13 | 中国科学院南海海洋研究所 | The application of antitoxin SO_1445 or its encoding gene in stability of the plasmid in host cell is improved |
| CN108611357A (en) * | 2016-12-13 | 2018-10-02 | 上海凯赛生物技术研发中心有限公司 | A kind of recombinant expression plasmid, transformant and its application |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105612257B (en) * | 2013-01-28 | 2020-03-17 | 上海凯赛生物技术股份有限公司 | Cadaverine purification using high boiling point solvents |
| CN104212830B (en) * | 2014-09-03 | 2016-09-07 | 江南大学 | A kind of bacillus subtilis Self-controlled expression system and construction method thereof and application |
| CN105441496A (en) * | 2015-12-22 | 2016-03-30 | 天津科技大学 | Method for improving yield of cadaverine produced by utilizing microorganisms for saccharides fermentation |
| CN108220289B (en) * | 2016-12-13 | 2021-09-03 | 上海凯赛生物技术股份有限公司 | Polynucleotide, transformant and application thereof |
| CN107880543A (en) * | 2017-12-11 | 2018-04-06 | 苏州天亦辰针织有限公司 | A kind of bio-based nylon facing material and its preparation technology |
| CN110541010A (en) * | 2018-05-29 | 2019-12-06 | 上海凯赛生物技术股份有限公司 | Preparation method and culture medium of dibasic acid pentanediamine salt |
| CN111808884A (en) * | 2020-07-23 | 2020-10-23 | 云舟生物科技（广州）有限公司 | Baculovirus expression system and construction method and application thereof |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101016568B (en) * | 2007-01-26 | 2010-05-19 | 华中农业大学 | Method of screening transgene barley strain without antibiotic mediated by agrobacterium |
| CN102021164B (en) * | 2010-11-09 | 2013-09-11 | 南京农业大学 | Antibiotic resistance maker-free bacillus subtilis constructing method and method for screening bacillus subtilis with inactivated target gene |
| CN102321655B (en) * | 2011-09-05 | 2013-08-28 | 西北农林科技大学 | Pseudo-attP site based integrated general-purpose expression vector and construction method and application thereof |
-
2012
- 2012-05-31 CN CN201310473169.4A patent/CN103667167A/en active Pending
- 2012-05-31 CN CN201210177392.XA patent/CN102851307B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| JOHN E. WERTZ，ET AL: "Chimeric Nature of Two Plasmids of Hafnia alvei Encoding the Bacteriocins Alveicins A and B", 《JOURNAL OF BACTERIOLOGY》 * |
| 傅晓丽 等: "嗜酸乳杆菌DOML a 菌株thyA 基因突变株的筛选", 《生物工程进展》 * |
| 康小燕: "hot/sok介导的质粒稳定性研究", 《中国优秀硕士学文论文全文数据库》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108611357A (en) * | 2016-12-13 | 2018-10-02 | 上海凯赛生物技术研发中心有限公司 | A kind of recombinant expression plasmid, transformant and its application |
| CN108611357B (en) * | 2016-12-13 | 2021-12-07 | 上海凯赛生物技术股份有限公司 | Recombinant expression plasmid, transformant and application thereof |
| CN106834322A (en) * | 2017-03-14 | 2017-06-13 | 中国科学院南海海洋研究所 | The application of antitoxin SO_1445 or its encoding gene in stability of the plasmid in host cell is improved |
| CN106834322B (en) * | 2017-03-14 | 2020-09-04 | 中国科学院南海海洋研究所 | Application of antitoxin SO _1445 or encoding gene thereof in improving stability of plasmid in host cell |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102851307A (en) | 2013-01-02 |
| CN102851307B (en) | 2015-06-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102851307B (en) | Recombinant expression plasmid vector stable in Hafnia alvei, and application thereof | |
| CN100491524C (en) | Process and materials for production of glucosamine | |
| WO2005010182A1 (en) | Coryneform bacterium transformant and process for producing dicarboxylic acid using the same | |
| KR101558622B1 (en) | Increased production of a target product via stabilization of mrna | |
| CN102753692A (en) | Production process for amino acids of the aspartate family using microorganisms | |
| US20140178961A1 (en) | Constructs and strains for fixing carbon dioxide and methods for preparing the same | |
| CN103282486A (en) | Microbes with an improved ability to produce ornithine and method for producing ornithine using same | |
| CN106574237A (en) | Microorganism for producing o-acetyl-homoserine and method for producing o-acetyl-homoserine by using same | |
| CN106459958A (en) | Coryneform bacterium transformant having high level expression of highly active variant enzyme and production method for 4-hydroxybenzoic acid using same or for salt thereof | |
| CN109517771A (en) | The method of fermentation producing L-amino-acid | |
| CN106459888A (en) | Putrescine-producing variant strain and putrescine production method using same | |
| Broda et al. | Clostridium algidixylanolyticum sp. nov., a psychrotolerant, xylan-degrading, spore-forming bacterium. | |
| CN105555953A (en) | Novel mutant ornithine decarboxylase protein and use thereof | |
| JPWO2005105991A1 (en) | AMP deaminase derived from actinomycete and use thereof | |
| CN101268191B (en) | Method for producing amino acids using micro-organisms | |
| KR20130135860A (en) | Method for producing cadaverine | |
| CN101137743B (en) | Escherichia strain capable of converting xmp to gmp and maintaining the inactivated state of gene(s) associated with gmp degradation and methods of using the same | |
| KR20130135859A (en) | Method for producing cadaverine | |
| CN108795891B (en) | Glucose oxidase CnGODA as well as gene and application thereof | |
| Manucharova et al. | Thermophilic chitinolytic microorganisms of brown semidesert soil | |
| CN103459412A (en) | Microorganism and processes for the fermentative production of an organo-chemical compound | |
| Kiruthika et al. | Selective isolation and molecular identification of L-glutaminase producing bacteria from marine sediments | |
| EP1417313A1 (en) | Adenosylmethionine synthetase from streptomyces sp., gene sequences coding the same and method for mass production of secondary metabolites including antibiotics thereof | |
| EP2837688A1 (en) | Method for producing amino acid | |
| RU2806745C2 (en) | Method of production sulfur-containing amino acid or its derivative |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C41 | Transfer of patent application or patent right or utility model | ||
| CB03 | Change of inventor or designer information |
Inventor after: Pang Zhenhua Inventor after: Li Naiqiang Inventor after: Liu Chi Inventor after: Liu Xiucai Inventor before: Pang Zhenhua Inventor before: Li Naiqiang Inventor before: Liu Chi |
|
| COR | Change of bibliographic data | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20160114 Address after: 201203 Shanghai Zhangjiang High Tech Park of Pudong New Area Cailun Road No. 1690 Building 5 Floor 4 Applicant after: Shanghai Cathay Biotechnology Research and Development Center Co., Ltd. Applicant after: Cathay Industrial Biotech Co., Ltd. Address before: 201203 Shanghai Zhangjiang High Tech Park of Pudong New Area Cailun Road No. 1690 Building 5 Floor 4 Applicant before: Shanghai Cathay Biotechnology Research and Development Center Co., Ltd. Applicant before: Shanghai Cathay Biotechnology Co., Ltd. Applicant before: Shandong Cathay Biotechnological Material Co., Ltd. Applicant before: Shandong Cathay Biological Technology Co.,Ltd. Applicant before: Jilin Cathay Biological Technology Co.,Ltd. Applicant before: Cathay Industrial Biotech Co., Ltd. |
|
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20140326 |