CN102851307A - Recombinant expression plasmid vector stable in Hafnia alvei, and application thereof - Google Patents

Abstract

The invention relates to a stable recombinant expression plasmid vector comprising a fragment of polynucleotide encoding a recombinant antitoxin gene. The polynucleotide expresses a polypeptide used for neutralizing toxic polypeptide of a host cell. The toxic polypeptide is expressed in a host cell by a fragment of polynucleotide encoding a toxin gene. The recombinant expression plasmid vector also comprises a fragment of polynucleotide encoding polypeptide expression product. The stable recombinant expression plasmid vector is derived by replicable frame plasmid in Hafnia alvei. The invention also discloses a transformant of the stable recombinant expression plasmid, a method for preparing bio-based pentanediamine by using the transformant, and bio-based pentanediamine prepared with the method provided by the invention. The invention also discloses polyamide and a composition containing polyamide, which are prepared by using the bio-based pentanediamine prepared with the method as a raw material. The invention also discloses a method for preparing pentamethylene-1,5-diisocyanate. The method comprises the steps that: bio-based pentanediamine is prepared by using the method provided by the invention; and the bio-based pentanediamine is transformed into pentamethylene-1,5-diisocyanate.

Description

Stable recombinant expression plasmid carrier and application thereof in hafnia alvei

Technical field

The application belongs to biology field, is specifically related to a kind of stable recombinant expression plasmid carrier and uses thereof.

Background technology

Pentamethylene diamine is a kind of hardware and software platform compound that can be used for producing multi-chemical.Since the eighties in 20th century, the research field of producing pentamethylene diamine with biological process has obtained extensive concern.In biological process, pentamethylene diamine can generate by the Methionin decarboxylation.At present, produce pentamethylene diamine with biological process and mainly adopt following two kinds of methods: microbial fermentation production or in vitro enzyme catalysis are produced.

In the method for fermentative production Methionin, the lysine decarboxylase gene is added in the Strains for Lysine Production (such as Corynebacterium glutamicum and intestinal bacteria), the approach of biosynthesizing Methionin is further extended to the approach of synthetic pentamethylene diamine.Yet the pentamethylene diamine productive rate of having reported is lower than the productive rate that uses the identical bacterial classification that does not contain the lysine decarboxylase gene to produce Methionin.Productive rate is low may to be owing to the toxicity restraining effect of pentamethylene diamine to the production bacterial strain.

In addition, can transform or utilize and induce to express lysine decarboxylase bacterium, be used for the external Methionin decarboxylic reaction of catalysis biological.A kind of method is that the lysine decarboxylase gene to chromosome coding carries out abduction delivering in without hafnia alvei (Hafnia alvei, the H.alvei) bacterial strain of transforming.Yet the production of enzyme that this kind method is reported is low.Another kind method relates to the structure of recombinant bacteria.For example, some (JP2009028045 of company of Japan, US7189543, CN102056889) structure of the intestinal bacteria recombinant bacterium that report can the overexpression lysine decarboxylase in succession, and utilize full cell or the decarboxylation of cell pyrolysis liquid catalysis Methionin to obtain pentamethylene diamine.Yet, great expression to the poisonous protein of host cell so that expression plasmid is unstable after going down to posterity several times.Must in fermented liquid, use microbiotic to guarantee the stable of in culturing process recombinant plasmid.

Antibiotic use may cause antibiosis is have the development of drug-fast bacterium, also can keep high-caliber resistance microorganism in environment.For example, see Martinez, " Environmental pollutionby antibiotics and by antibiotic resistance determinants; " Environmental Pollution (2009), Vol.157, Issue 11,2893 – 2902.Because antibiosis is have drug-fast bacterium to the harm of healthy and ecotope, antibiotic use is not environmental protection.Therefore, we need a more effective recombinant plasmid vector, can not have under the condition of antibiotic-screening, and repeatedly continuous passage still keeps stable.

Summary of the invention

Describe in detail

Detail in the following describes only is in order to fully understand embodiments of the invention.But will be appreciated that as those skilled in the art enforcement of the present invention is not limited to these details.In addition, known structure and function is not by detailed description or displaying, to avoid having blured the main points of the embodiment of the invention.

Employed amino acid in the present invention, polypeptide, base sequence, the abbreviation of nucleic acid, be based on International Union of Pure and Applied Chemistry and international bio federation to the regulation of biological chemical name, be published in the abbreviation in " preparation contains the guidance of the specification sheets of base sequence and aminoacid sequence " (United States Patent and Trademark Office) literary composition of European Journal of Biochemistry the 9th phase of the 138th volume in 1984, and general abbreviation in biological technical field.

" nucleotide sequence " discussed in the disclosure, " polynucleotide " or " dna molecular " may comprise double-stranded DNA (that is, the double-stranded DNA that is comprised of positive-sense strand and antisense strand) or single stranded DNA, and fragment.Refer to the part of this nucleotide sequence in this " its fragment ", the function of the polypeptide that the polypeptide of its coding and the complete sequence of this nucleotide sequence are coded is basic identical.For example, a kind of Nucleotide of the toxin-resistant gene of encoding is expressed the polypeptide of the polypeptide that can neutralize a toxin.Therefore the expressed polypeptide of a fragment of Nucleotide of coding toxin-resistant gene this toxin polypeptide that also can neutralize compares the function that provides roughly the same with the expressed polypeptide of the complete sequence of the Nucleotide of coding toxin-resistant gene.Equally, the expressed polypeptide of the complete sequence of the Nucleotide of the Nucleotide of toxin-encoding gene polypeptide that fragment is expressed and toxin-encoding gene pair has essentially identical toxicity with cell.

Here the nucleotide sequence of mentioning, polynucleotide or dna molecular are not limited only to functional zone, may comprise at least one expression regulation district, the coding region, leader sequence, exon, intron and expression cassette (are seen, for example Papadakis et al., " Promoters and Control Elements:DesigningExpression Cassettes for Gene Therapy; " Current Gene Therapy (2004), 4,89-113).In addition, the example of nucleotide sequence or polynucleotide may refer to RNA or DNA.The polynucleotide that has the polypeptide of specific aminoacid sequence and have a specific dna sequence dna may comprise fragment, homologous sequence, derived sequence and the mutant nucleotide sequence of this sequence.The example of the mutant of nucleotide sequence or polynucleotide (such as mutant DNA) comprises abiogenous sudden change, artificial mutation, and/or deletion, replaces the sudden changes such as interpolation and/or insertion.The coded polypeptide of this mutant is construed as the polypeptide of encoding with the former nucleotide sequence of not sudden change and has in fact identical function.

Content disclosed in this invention comprises a stable recombinant expression plasmid carrier, comprises following part:

The polynucleotide of one section coding toxin-resistant gene, it expresses a peptide species, a kind of polypeptide poisonous to host cell that neutralize, corresponding poisonous polypeptide is expressed in host cell by the polynucleotide of one section toxin-encoding gene with it,

The polynucleotide of one section coded polypeptide expression product, wherein,

This stable recombinant expression plasmid carrier forms by reproducible skeleton plasmid in host cell is derivative.

In certain embodiments, this toxin gene is encoded in the chromogene group of host cell.

In certain embodiments, this stable recombinant expression plasmid carrier further comprises the polynucleotide of toxin-encoding gene.

In certain embodiments, the polynucleotide of the polynucleotide of this toxin-encoding gene and/or coding toxin-resistant gene is recombinated.

In certain embodiments, toxin gene, the one or more genes in the polynucleotide of toxin-resistant gene and coded polypeptide expression product further are optimized with codon optimized technology, to provide better expression to corresponding polypeptide in host cell.For example, optimize the optimization that toxin gene can comprise dna sequence dna, to compare better express polypeptide toxin with sequence SEQ ID NO:1 or SEQ ID:3.In certain embodiments, toxin-resistant gene comprises the dna sequence dna of further optimization, expresses better the toxinicide polypeptide to compare with sequence SEQ ID NO:2 or SEQ ID:4.In certain embodiments, the gene of expression of polypeptides product comprises the dna sequence dna of further optimization, to compare better express polypeptide expression product with sequence SEQ IDNO:5 or SEQ ID:6.

Codon optimized is a kind of technology, and it obtains to greatest extent protein expression by increasing the translation efficiency of interested gene in host cell.The dna nucleotide sequence of species is optimized to the dna nucleotide sequence into another species.Dna sequence dna is divided into triad (codon).A kind of amino acid whose low frequency codon is replaced by the high frequency codon of same amino acid in the host cell.Thus, the expression of the dna sequence dna of optimization in host cell improves.For example see Http:// www.guptalab.org/shubhg/pdf/shubhra_codon.pdf, about codon optimized technology introduction, all include in as a reference at this.

Toxin/toxin-resistant gene used herein is to there being two genes, and one of them is toxin gene, expresses the virose polypeptide of host cell, and another is toxin-resistant gene, the polypeptide of the expression toxicity of this toxin polypeptide to host cell that can neutralize.

Some prokaryotic organism contains the toxin gene of one or more chromosome codings.Some prokaryotic organism contains the right endogenous plasmid of coding particular toxin/toxin-resistant gene.(see, Wertz et al. " Chimeric nature of two plasmids of Hafnia alvei encoding the bacteriocins alveicins A and B. " Journal of Bacteriology., (2004) 186:1598-1605.) toxin/toxin-resistant gene is to usually playing a role in keeping the stable and stress reaction of genetic information.When karyomit(e) or plasmid-encoded toxin-resistant gene were arranged in the cell, toxinicide albumen can continuous expression, and the albumen that neutralizes a toxin is kept the survival of cell.In some prokaryotic organism, the degradation speed of toxinicide albumen is faster than toxin protein.If the plasmid with toxin-resistant gene is lost in cell, the time that the toxin protein that has synthesized is left over can be longer than toxinicide albumen, can cell killing or cell growth inhibiting.Therefore, under the prerequisite that keeps cell survival, be difficult for losing with toxin-resistant gene or the right plasmid of toxin/toxin-resistant gene.

Toxin/toxin-resistant gene is to including but not limited to abt/abi gene pairs, aat/aai gene pairs, and fragment.In certain embodiments, toxin gene comprises dna sequence dna SEQ ID NO:1, or SEQ ID NO:3.In certain embodiments, toxin-resistant gene comprises dna sequence dna SEQ ID NO:2, or SEQ ID NO:4.

Host Strains used herein refers to can be by the microorganism of stable recombinant plasmid vector conversion.Host Strains includes, but not limited to hafnia alvei (H.alvei).

In certain embodiments, Host Strains is natural does not contain endogenous plasmid or has eliminated original endogenous plasmid.Term " elimination " (cured) refers to endogenous plasmid is eliminated from Host Strains at this.The resulting Host Strains that does not contain endogenous plasmid is called as " having eliminated " Host Strains.

In certain embodiments, can from any known H.alvei strain, select as host's H.alvei bacterial strain.For example, without the H.alvei strain of endogenous plasmid, there are the H.alvei strain of pAlvA endogenous plasmid and its plasmid to eliminate strain (pAlvA-strain), have the H.alvei strain of pAlvB endogenous plasmid and its plasmid to eliminate strain (pAlvB-strain).

In certain embodiments, Host Strains is the industrial strain that is fit to be applied to technical scale or scale operation.For example, industrial strain can be cultivated in fermentation container.The scale of cultivating can rise to millions of liters from hundreds of.Opposite laboratory strains is cultivated in several liters or less scale usually.In certain embodiments, industrial strain can be grown in the simpler and more economical nutrient solution of relative laboratory strains.

The expression of polypeptides product is a peptide species that is produced by Host Strains.The expression of polypeptides product includes but not limited to, the expression of polypeptides product that any intestinal bacteria can produce, for example, enzyme (such as decarboxylase, lytic enzyme, Starch phosphorylase).For example, decarboxylase is amino acid decarboxylase.For example, decarboxylase is lysine decarboxylase, tyrosine deearboxylase, arginine decarboxylase, ornithine decarboxylase, or L-Glutamic decarboxylase.In one embodiment, decarboxylase is lysine decarboxylase.In another embodiment, the polynucleotide of coding lysine decarboxylase comprises the cadA gene, haldc gene or its fragment.In another embodiment, the polynucleotide of coding lysine decarboxylase comprises dna sequence dna SEQ ID NO:5 or SEQ ID NO:6.In another embodiment, lytic enzyme is glucuroide, alpha-glucosidase, beta-glucosidase, mannosidase, alpha-Mannosidase, beta-Mannosidase, fructosidase, beta-fructosidase enzyme, xylosidase, α-xylosidase, xylobiase, tilactase, alpha-galactosidase, beta-galactosidase enzymes, Sumylact L, amylase, α-amylase, beta-amylase, myrosin, chitinase, sucrase, maltin, saccharase, Unidasa, or neuraminidase.In a preferred embodiment, the polynucleotide of coding beta-galactosidase comprises lacZ gene or its fragment.

Reproducible skeleton plasmid can be any plasmid that can copy in Host Strains.In one embodiment, stable recombinant expression plasmid is to form by a skeleton plasmid that can copy in hafnia alvei is derivative.Skeleton plasmid includes but not limited to, pUC(is pUC18 and pUC19 plasmid for example), pBR322, pACYC plasmid, and their plasmid.

Used herein, so-called recombinant plasmid " forms by reproducible skeleton plasmid in host cell is derivative ", refer to that this recombinant plasmid is by inserting the polynucleotide of one or more coding toxin-resistant genes in skeleton plasmid, the polynucleotide of one or more toxin-encoding genes, and/or the polynucleotide of one or more coded polypeptide expression products, and their arbitrary combination is come construction recombination plasmid.

Content disclosed in this invention also comprises one or more stable recombinant plasmid vectors disclosed herein is transformed the transformant that obtains into Host Strains.

Here the transformant of mentioning refers to the Host Strains that changes by introducing one or more stable recombinant plasmid vectors.In certain embodiments, transformant obtains by transforming to possessing competent host cell introduction recombinant plasmid vector.

Be higher than with the stability of the right plasmid of toxin-resistant gene or toxin/toxin-resistant gene in the described transformant and do not contain toxin-resistant gene or the right stability of recombinant Plasmid of toxin/toxin-resistant gene in the same Host Strains.

In one embodiment, Host Strains is the hafnia alvei that a strain does not contain endogenous plasmid.The H.alvei strain that does not contain endogenous plasmid can be the natural bacterial strain that does not have endogenous plasmid, also can be the bacterial strain after a plasmid is eliminated as mentioned before.Stable recombinant plasmid vector is selected from the abi gene with one or more toxin-resistant genes, aai gene, and fragment, and/or with one or more toxin/toxin-resistant genes pair, be selected from the abt/abi gene pairs, aat/aai gene pairs and fragment thereof.

Content disclosed in this invention also comprises a method of producing pentamethylene diamine:

1a) cultivate a transformant with stable recombinant expression plasmid disclosed herein;

1b) generate pentamethylene diamine with the bacterium liquid catalysis Methionin decarboxylation that obtains among the step 1a;

1c) from the reaction solution of step 1b, reclaim pentamethylene diamine.

" the bacterium liquid that uses step 1a to obtain " mentioned herein may comprise the further processing of the bacterium liquid that step 1a is obtained.For example with buffered soln dilution bacterium liquid, or centrifugal acquisition thalline, again thalline is resuspended in the buffered soln, or cellular lysate is made lysate, or/and the lysine decarboxylase of from cellular lysate liquid, purifying.

Transformant can be cultivated in the substratum that contains carbon source and non-carbon nutrition source.Carbon source is including but not limited to sugar (carbohydrate is such as glucose and fructose), and is oily and/or fatty, lipid acid, and/or its derivative.Oil ﹠ fat comprises the saturated and/or unsaturated fatty acids that ten carbon are above, such as cocounut oil, and plam oil, palm-kernel wet goods.Lipid acid can be saturated and/or unsaturated fatty acids, and is sad such as caproic acid, capric acid, lauric acid, oleic acid, palmitinic acid, linolic acid, linolenic acid, tetradecanoic acid etc.Derivative of fatty acid includes but not limited to fatty acid ester and soap.Non-carbon nutrition source includes but not limited to nitrogenous source, inorganic salt and other organotrophy sources.

For example, substratum comprises the absorbable carbon source of transformant, can also comprise one or more other nutrition sources, such as nitrogenous source, inorganic salt and other organotrophy sources.In certain embodiments, the weight percent of nitrogenous source accounts for 0.01 to 0.1% in the substratum.Nitrogenous source comprises ammonia, ammonium salt (such as ammonium chloride, ammonium sulfate and ammonium phosphate), peptone, meat extract, yeast extract etc.Inorganic salt include but not limited to, potassium primary phosphate, dipotassium hydrogen phosphate, trimagnesium phosphate, sal epsom, sodium-chlor etc.Other organotrophy sources include, but not limited to amino acid (such as glycine, L-Ala, Serine, Threonine and proline(Pro)), VITAMIN (such as VITMAIN B1, vitamin B12 and vitamins C), etc.

Bacterium liquid is cultivated and can be carried out under any temperature that can allow mycetocyte grow.Suitable temperature is at about 20 to 40 ° of C, or about 35 ° of C.Incubation time can be approximately 1 day, approximately 2 days, approximately 3 days, approximately 4 days, approximately 5 days, approximately 6 days, approximately 7 days, approximately 8 days, approximately 9 days or approximately about 10 days.

In one embodiment, the substratum of transformant contains peptide, peptone, VITAMIN (such as vitamin B group), trace element (such as nitrogen, sulphur, magnesium), and mineral substance.Such substratum includes, but are not limited to well-known LB substratum (being dissolved in water (such as distilled water or deionized water) by Tryptones, yeast extract and NaCl makes).

In one embodiment, step 1c is further comprising the steps of:

1d) separation is by solid and the liquid portion of the resulting reaction solution of step 1b;

1e) with the pH regulator of the liquid portion that obtains among the step 1d to approximately 14 or higher;

1f) remove moisture in the liquid that obtains among the step 1e;

1g) reclaim pentamethylene diamine.

In step 1d, the solid-liquid part of separating step 1b reaction solution can realize by traditional centrifugal and/or filtration.

In step 1e, the pH value of the liquid component of gained can by adding alkali, be regulated such as sodium hydroxide among the step 1d.Sodium hydroxide can add with the form of solid or solution (such as the aqueous solution).

In step 1f, moisture content can be removed by normal pressure or vacuum distilling.

In step 1g, pentamethylene diamine can reclaim by normal pressure or vacuum distilling.

Content disclosed in this invention also comprises with the prepared bio-based pentamethylene diamine of method disclosed herein.

The compound of " bio-based " mentioned here refers to be considered to according to ASTM D6866 standard the compound of bio-based.Described ASTM D6866 standard refers to the ASTM D6866 of American Standard of Testing Materials association testing standard, its name is called " with the test method of radiocarbon C14 assay solid, the biological content of liquids and gases sample " (Standard Test Methods for Determining the Biobased Content of Solid, Liquid, and Gaseous Samples Using Radiocarbon Analysis), ASTM D6866 is the standard method that industrial utilization carbon 14 is measured biomass content.

Content disclosed in this invention also comprises a kind of polymeric amide, and it comprises the structure of structural formula 1:

Structural formula 1

And steric isomer, wherein:

M=4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21, or 22;

N=4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21, or 22;

J=approximately 100 ~ approximately 1,000,000;

Described polymeric amide is that one or more diamines of m and one or more diprotic acid polymerizations that carbonatoms is n make by carbonatoms, at least a bio-based carbon that comprises the renewable source that meets ASTM D6866 standard in diamine, the diprotic acid, and the m of this diamine or diprotic acid or n can be identical or different.

In one embodiment, diamine is the bio-based pentamethylene diamine, the bio-based pentamethylene diamine that preferably prepares with disclosed method among the present invention.The example of diprotic acid includes, but are not limited to: ten carbon dicarboxylic acids, DC11, SL-AH, tridecanyldicarboxylic acid, DC14,16-dicarboxylic acid, DC18, and their arbitrary combination.In certain embodiments, all or part of diprotic acid is bio-based.

In another embodiment, the contained structure of polymeric amide is to be made by bio-based pentamethylene diamine and one or more diprotic acid polymerizations with above described, and the bio-based pentamethylene diamine that preferably prepares according to method provided by the present invention;

N=4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21, or 22;

J=approximately 100～approximately 1,000,000 or j=approximately 1000～approximately 100,000 or j=approximately 1000 ~ approximately 10,000; And

Diprotic acid comprises the bio-based carbon that meets ASTM D6866 standard.

The present invention also discloses the preparation method of polymeric amide disclosed herein, comprising:

Prepare the bio-based pentamethylene diamine according to method provided by the present invention, as diamine.

In one embodiment, the method further comprises one or more bio-based diprotic acid of preparation.

In another embodiment, the method comprises that further reaction bio-based pentamethylene diamine and one or more bio-based diprotic acid prepare polymeric amide.

Disclosed content also comprises the composition that contains one or more polymeric amide disclosed herein among the present invention.

In one embodiment, diamine is the bio-based pentamethylene diamine, the bio-based pentamethylene diamine that preferably prepares with disclosed method among the present invention.The example of diprotic acid includes, but are not limited to: ten carbon dicarboxylic acids, DC11, SL-AH, tridecanyldicarboxylic acid, DC14,16-dicarboxylic acid, DC18, and their arbitrary combination.In certain embodiments, all or part of diprotic acid is bio-based.

In another embodiment, the contained structure of polymeric amide is to be made by bio-based pentamethylene diamine and one or more diprotic acid polymerizations with above described, and the bio-based pentamethylene diamine that preferably prepares according to method provided by the present invention;

N=4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21, or 22;

J=approximately 100～approximately 1,000,000 or j=approximately 1000～approximately 100,000 or j=approximately 1000 ~ approximately 10,000; And

Diprotic acid comprises the bio-based carbon that meets ASTM D6866 standard.

The present invention also discloses a kind of pentamethylene-1 for preparing, the 5-isocyanic ester (1, method 5-diisocyanatopentane) comprises:

2a) prepare the bio-based pentamethylene diamine according to the method disclosed in the present;

2b) resulting bio-based pentamethylene diamine among the step 2a is converted into pentamethylene-1, the 5-isocyanic ester.

The method of step 2b can adopt known diamine to be converted into the method for isocyanic ester.For example traditional phosgenation comprises a step high temperature phosgenation, namely at high temperature phosgene is mixed making isocyanic ester with diamine, and improved two goes on foot phosgenations thus, and replace the triphosgene of phosgene with triphosgene.Do not adopt phosgene as the method for raw material in addition in addition, for example use CO ₂The hexanediamine carbonylation method that replaces phosgene: in primary amine and organic bases solution, pass into CO ₂, in reaction mixture, add again an amount of phosphorous electrophilic reagent, the dehydration thermopositive reaction occurs, make isocyanic ester.Again for example, the carbamate thermal decomposition method prepares carbamate with primary amine first, reheats the cracked ammonium carbamate and makes isocyanic ester.

The present invention will be further described below in conjunction with specific embodiment, should be understood that following examples only are used for explanation the present invention and are not used in the scope of the present invention that limits.For a person skilled in the art, any change of making within the scope of the present invention, modification or directly adopt the equal conditions among the embodiment and the example implemented all are interpreted as in covering scope of the present invention.In addition, as set forth in the present invention, all reference that the present invention quotes are all included among the present invention with complete form.

Description of drawings

Fig. 1 is the structure of the pPlac-cadA-abtabi recombinant expression plasmid described in the example 1.A) use the PCR product of the cadA that e. coli bl21 karyomit(e) obtains as template; B) cadA PCR product is connected to the pMD18-T-cadA plasmid that obtains on the pMD18-T carrier, wherein, there is one section lacZ gene fragment the 5' position of cadA gene; C) with after the PCR site-directed mutagenesis deletion lacZ gene fragment, the pPlac-cadA plasmid of formation; D) be template with H.alvei plasmid pAlvB, the PCR product with HindIII site and abt/abi that obtains, this PCR product is connected to the pMD18-T carrier subsequently; E) cut pPlac-cadA and contain the pMD18-T plasmid of abt/abi fragment with the HindIII enzyme, the main body of pPlac-cadA plasmid is connected with the abt/abi fragment, obtain the pPlac-cadA-abtabi recombinant expression plasmid.

Fig. 2 is the recombinant bacterium JM109/pPlac-cadA described in the embodiment 3, and the bacterium liquid of gained is cultivated in continuous passage, the colony growth situation after the gradient dilution on LB and LB/AMP flat board.

Fig. 3 is the recombinant bacterium Ha/pPlac-cadA described in the embodiment 3, and the bacterium liquid of gained is cultivated in continuous passage, the colony growth situation after the gradient dilution on LB and LB/AMP flat board.

Fig. 4 is the recombinant bacterium Ha described in the embodiment 3 ^c/ pPlac-cadA-abtabi, the bacterium liquid of gained is cultivated in continuous passage, the colony growth situation after the gradient dilution on LB and LB/AMP flat board.

Embodiment

The structure of embodiment 1-CadA recombinant expression plasmid

Take e. coli bl21 (Biomed company) chromosomal DNA as template, with primer 1 and 2(primer 1, SEQ ID:NO 7:ATGAACGTTATTGCAATATT, primer 2, SEQ ID:NO8:ACTGAAAGCTTCCACTTCCCTTGTACGAGCT) (Fig. 1 is a) to copy the cadA gene.The T carrier that this PCR product and pUC18-is derivative, pMD18-T(TaKaRa company) connect.Select the cadA gene to be connected Plac with the lac promotor) in the same way connection product.The plasmid called after pMD18-T-cadA(Fig. 1 b that produces).

The a bit of lacZ gene of the contained cadA gene of pMD18-T-cadA and its 5 ' end is in same reading frame.Therefore, delete this unnecessary lacZ fragment by site-directed mutagenesis PCR.The PCR reaction comprises: the 50ng plasmid DNA, 10pmole primer 3(SEQ ID:NO 9:ATTCAATATTGCAATAACGTTCATAGCTGTTTCCTGTGTG), every kind of 0.25mM of dNTPs(), 1 μ L Pfu archaeal dna polymerase (Biomed company), 1 μ L Taq dna ligase (NEB), 4 μ L Pfu archaeal dna polymerases, 10 * damping fluid, 5 μ L Taq dna ligases, 10 * damping fluid, adding deionized water to cumulative volume is 50 μ L.Thermal cycle conditions is identical with conventional PCR.After the PCR reaction finishes, add 1 μ L DpnI(NEB) restriction endonuclease, at 37 ℃ of reaction 1hr.Transform 100 μ L e. coli bl21 competent cells with this PCR reaction solution of 10 μ L.From the transformant bacterium colony, extract plasmid, with primer 4(SEQ ID:NO 10:AGGAAACAGCTATGAACGTT) order-checking.The lacZ fragment of cadA gene 5 ' end should be deleted on the expection plasmid.Through the expection plasmid that sequence verification obtains, called after pPlac-cadA(Fig. 1 c).

The H.alvei bacterial strain that uses in the present embodiment contains the pAlvB endogenous plasmid.Toxin/toxin-resistant gene on the pAlvB plasmid is to being the abt/abi gene pairs.According to pAlvB sequence (GenBank:AY271829) design primer 5 and the 6(primer 5 announced, SEQ ID:NO 11:ACTGAAAGCTTTACTTTCATCACAAGCCTCT, primer 6, SEQ ID:NO 12:ACTGAAAGCTTAGATTCAGCGCGAGAGTGAT), these two primers have been introduced a pair of HindIII restriction enzyme site (Fig. 1 d) at the two ends of fragment.Take pAlvB as template, copy one section fragment that contains the abt/abi gene.The PCR product is connected to the pMD18-T carrier.Then should connect product and cut with the HindIII enzyme, obtain one section fragment that contains the approximately 1.8kb of abt/abi gene.Again the pPlac-cadA plasmid is also cut with the HindIII enzyme, obtained one section approximately fragment of 4.8kb.At last, pPlac-cadA fragment and abt/abi fragment are linked together, form recombinant expression plasmid, pPlac-cadA-abtabi(Fig. 1 e).

Because the H.alvei bacterial strain that uses in the present embodiment contains endogenous plasmid, at first this H.alvei bacterial strain is carried out plasmid and eliminate, obtain the H.alvei strain (H.alvei without endogenous plasmid ^c).Again recombinant expression plasmid pPlac-cadA-abtabi is transformed into H.alvei ^cThis recombinant expression plasmid is cultivated through 5 times or more times continuous passage under the condition of antibiotic-free screening still can keep stable.

The elimination of embodiment 2-hafnia alvei endogenous plasmid

To the H.alvei(Ha of a strain with the pAlvB endogenous plasmid) do plasmid and eliminate.Remove the host to the existence dependence of pAlvB with a recombinant expressed antitoxic pUC plasmid first.Using the derivative plasmid of pUC as skeleton plasmid, is because it can copy in H.alvei, and its copy number can improve with the culture temperature rising.Therefore, under the condition that antibiotic-screening and higher culture temperature are arranged, the pUC plasmid with the competition of pAlvB in have the advantage, make the latter be easy to lose.On the pUC plasmid recombinant expressed Abi toxinicide albumen can in and the Abt toxin protein left over of pAlvB, make the host cell can be dead.

Take pAlvB as template, with primer 6 and 7(primer 7, SEQ ID:NO 13:ACTGAAAGCTTTTTAATTGTGTGACCACTAT) copies the abi gene.The PCR product is connected to pMD18-T carrier (containing ampicillin resistance gene), and this connection product is named as pMD18-T-abi.With this Plasmid Transformation with CaCl ₂The H.alvei competent cell that legal system is standby.The preparation method of H.alvei competent cell is identical with the preparation method of the E.coli competent cell of commonly using.

Comprise two plasmid: pAlvB and pMD18-T-abi in the transformant of gained.Transformant is lined on the LB/AMP flat board, 40 ℃ of incubated overnight.For longer bacterium colony, be bacterium colony PCR with primer 5 and 6.The bacterium colony of having eliminated pAlvB does not have the PCR product.

Next step is to remove the pMD18-T-abi plasmid from the H.alvei bacterial strain of having eliminated pAlvB.This bacterial strain is lined on the LB flat board that does not contain penbritin, 40 ℃ of incubated overnight.Longer bacterium colony is lined on the LB flat board that does not contain penbritin again, 40 ℃ of incubated overnight.Longer bacterium colony is bacterium colony PCR with primer 6 and 7.The bacterium colony of having eliminated pMD18-T-abi does not have the PCR product.The bacterial strain of plasmid being eliminated with plasmid extraction test kit (Axygen company) carries out DNA extraction, does not obtain plasmid DNA.

The bacterial strain that this plasmid is eliminated is named as H.alvei ^c(Ha ^c).

Embodiment 3-toxin/toxin-resistant gene is to making the CadA expression plasmid among the H.alvei stable

The stability of recombinant plasmid in the host detects by the following method: continuous passage recombinant bacterial strain in non-selective nutrient solution, the bacterium liquid of at every turn cultivating gained is carried out gradient dilution, be coated in respectively on the non-selective and selectivity flat board estimation and the total cell count in the bacterium liquid and contain the cell count of plasmid relatively.

With 3 recombinant bacterial strains (JM109/pPlac-cadA, Ha/pPlac-cadA, Ha ^c/ pPlac-cadA-abtabi) single bacterium colony is inoculated in respectively that (JM109 is E.coli JM109 bacterial strain (Biomed company) in the LB nutrient solution that contains penbritin; Ha is the H.alvei bacterial strain that contains endogenous plasmid pAlvB; Ha ^cFor having eliminated the H.alvei bacterial strain of endogenous plasmid), 1 day (seed liquor) of growth in 35 ℃ of shaking tables.Then be inoculated in the fresh LB nutrient solution without penbritin with 0.1% rate of vaccination.In same temperature growth 1 day (the 1st time go down to posterity).Then with identical rate of vaccination and identical growth conditions continuous passage and cultivation (the 2nd to the 5th go down to posterity).Each bacterium liquid that finishes of cultivating carries out 10 * gradient dilution with 0.85% aseptic sodium chloride solution.The sample of getting after 5 μ L dilute is put respectively on and the LB/AMP flat board dull and stereotyped in LB.35 ℃ of incubations 1 day.The total cellular score of bacterium liquid be can estimate on without the flat board of penbritin, quantity (Fig. 2 (JM109/pPlac-cadA), Fig. 3 (Ha/pPlac-cadA), Fig. 4 (Ha with the cell of plasmid on the flat board of penbritin is arranged, can be estimated in the bacterium liquid ^c/ pPlac-cadA-abtabi)).

Through 2 to 3 continuous passages, the ratio that contains the bacterium of plasmid in JM109/pPlac-cadA and the Ha/pPlac-cadA bacterium liquid drops to about 1% (Fig. 2 and 3) in non-selective nutrient solution.In contrast, through 5 continuous passages, Ha ^cThe ratio that contains the bacterium of plasmid in the/pPlac-cadA-abtabi bacterium liquid still is 100%(Fig. 4).Therefore, in H.alvei, toxin/toxin-resistant gene makes recombinant expression plasmid in the situation that there is not antibiotic-screening also can keep stable.

Reference

The All Files that present patent application is mentioned though only mention its title, is treated as and is quoted in full, and includes in this application form.

Sequence table

SEQ ID：NO 1(aat gene)

>gb|AY271828.1|:385-1717 Hafnia alvei plasmid pAlvA,complete sequence

1 atgagtggtg gagatggcaa gggtcacaat agtggagcac atgattccggtggcagcatt

61 aatggaactt ctgggaaagg tgggccatca agcggaggag catcagataattctgggtgg

121 agttcggaaa ataacccgtg gggcggtggt aactcgggaa tgattggtggcagtcaagga

181 ggtaacggag ctaatcatgg tggcgaaaat acatcttcta actatgggaa agatgtatca

241 cgccaaatcg gtgatgcgat agccagaaag gaaggcatca atccgaaaatattcactggg

301 tactttatcc gttcagatgg atatttgatc ggaataacgc cacttgtcag tggtgatgcc

361 tttggcgtta atcttggcct gttcaataac aatcaaaata gtagtagtga aaataaggga

421 tggaatggaa ggaatggaga tggcattaaa aatagtagcc aaggtggatggaagattaaa

481 actaatgaac ttacttcaaa ccaagtagct gctgctaaat ccgttccaga acctaaaaat

541 agtaaatatt ataagtccat gagagaagct agcgatgagg ttattaattc taatttaaac

601 caagggcatg gagttggtga ggcagctaga gctgaaagag attacagagaaaaagtaaag

661 aacgcaatca atgataatag tcccaatgtg ctacaggatg ctattaaatt tacagcagat

721 ttttataagg aagtttttaa cgcttacgga gaaaaagccg aaaaactagc caagttatta

781 gctgatcaag ctaaaggtaa aaagatccgc aatgtagaag atgcattgaa atcttatgaa

841 aaacacaagg ctaacattaa caaaaaaatc aatgcgaaag atcgcgaagctatcgccaag

901 gctttggagt ctatggatgt agaaaaagcc gcaaaaaata tatccaagttcagcaaagga

961 ctaggttggg ttggcccagc tatcgatata actgattggt ttacagaatt atacaaagca

1021 gtgaaaactg ataattggag atctctttat gttaaaactg aaactattgc agtagggcta

1081 gctgcaaccc atgtcaccgc cttagcattc agtgctgtct tgggtgggcc tataggtatt

1141 ttaggttatg gtttgattat ggctggggtt ggggcgttag ttaacgagac aatagttgac

1201 gaggcaaata aggtcattgg gatttaa

SEQ ID：NO 2(aai gene)

>gb|AY271828.1|:1734-2069 Hafnia alvei plasmid pAlvA,completesequence

1 atgacaagga aatattacat acataatatg ttttggggat actttatggc tgcttgtatt

61 ctttacgcca gttatggtga tgacgaacct aaaataattg cgctcagaat ctttggtttg

121 gctagcgcta ttctatttcc tttctctcgg tttctaatag agaaagcagc gcttagatat

181 acgaaaaaag aattttggaa aacaggtttt tttaaggatg gtgtgccaaa aacatattta

241 atgactttgt attttatttt tatttttatg acatcaattc ctattggtgt tctttctgtt

301 tgttttgaaa taaaaaatgt gaccgctaaa atatag

SEQ ID：NO 3(abt gene)

>gb|AY271829.1|:384-1566 Hafnia alvei plasmid pAlvB,completesequence

1 atgagtggtg gagacggtaa aggtcacaat agtggagcac atgattccgg tggcagcatt

61 aatggaactt cggggaaagg tggacctgat tctggtggcg gatattggga caaccatcca

121 catattacaa tcaccggtgg acgggaagta ggtcaagggg gagctggtat caactggggt

181 ggtggttctg gtcatggtaa cggcgggggc tcagttgcca tccaagaata taacacgagt

241 aaatatccta acacgggagg atttcctcct cttggagacg ctagctggct gttaaatcct

301 ccaaaatggt cggttattga agtaaaatca gaaaactcag catggcgctc ttatattact

361 catgttcaag gtcatgttta caaattgact tttgatggta cgggtaagct cattgatacc

421 gcgtatgtta attatgaacc cagtgatgat actcgttgga gcccgcttaa aagttttaaa

481 tataataaag gaaccgctga aaaacaggtt agggatgcca ttaacaatga aaaagaagca

541 gttaaggacg ctgttaaatt tactgcagac ttctataaag aggtttttaa ggtttacgga

601 gaaaaagccg agaagctcgc taagttatta gcagatcaag ctaaaggcaa aaaggttcgc

661 aacgtagaag atgccttgaa atcttatgaa aaatataaga ctaacattaa caaaaaaatc

721 aatgcgaaag atcgcgaagc tattgctaaa gccttggagt ctatggatgt aggaaaagcc

781 gcaaaaaata tagccaagtt cagtaaagga ctaggttggg ttggccctgc tatcgatata

841 actgattggt ttacagaatt atacaaggca gtggaaactg ataattggag atctttttat

901 gttaaaactg aaactattgc agtagggcta gctgcaaccc atgttgccgc cttggcattc

961 agcgctgtct tgggtgggcc tgtaggtatt ttgggttatg gtttgattat ggctggggtt

1021 ggggcgttag ttaatgagac aatagttgac gaggcaaata aggttattgg gctttaa

SEQ ID：NO 4(abi gene)

>gb|AY271829.1:1583-1918 Hafnia alvei plasmid pAlvB,completesequence

1 atgacaagga aatattatat acataatatg ttttgggggt actttatggc tgtttgtatt

61 ctttacgcca gttatgggga taacgaacct aaaataattg cgctcagaat ctttggtttg

121 gctagtgcta tcctattccc tttctctcgg tttttaatag agaaaaccgc gcttagatat

181 acgaaaaaag aattttggga aactggtttt tttaaggatg gcgtgccaaa aacatattta

241 atgactttgt atttaatttt tatttttatg acatcaattc ctataggtgt tatttctgtt

301 ttttttgaaa taaaaaatgt gaccgctaaa ttatag

SEQ ID：NO 5(E.coli gene for lysine decarboxylase(cadA))

>gi|253771435:4076771-4078918 Escherichia coli′BL21-Gold(DE3)pLysS AG′chromosome,complete genome

1 atgaacgtta ttgcaatatt gaatcacatg ggggtttatt ttaaagaaga acccatccgt

61 gaacttcatc gcgcgcttga acgtctgaac ttccagattg tttacccgaa cgaccgtgac

121 gacttattaa aactgatcga aaacaatgcg cgtctgtgcg gcgttatttt tgactgggat

181 aaatataatc tcgagctgtg cgaagaaatt agcaaaatga acgagaacct gccgttgtac

241 gcgttcgcta atacgtattc cactctcgat gtaagcctga atgacctgcg tttacagatt

301 agcttctttg aatatgcgct gggtgctgct gaagatattg ctaataagat caagcagacc

361 actgacgaat atatcaacac tattctgcct ccgctgacta aagcactgtt taaatatgtt

421 cgtgaaggta aatatacttt ctgtactcct ggtcacatgg gcggtactgc attccagaaa

481 agcccggtag gtagcctgtt ctatgatttc tttggtccga ataccatgaa atctgatatt

541 tccatttcag tatctgaact gggttctctg ctggatcaca gtggtccaca caaagaagca

601 gaacagtata tcgctcgcgt ctttaacgca gaccgcagct acatggtgac caacggtact

661 tccactgcga acaaaattgt tggtatgtac tctgctccgg caggcagcac cattctgatt

721 gaccgtaact gccacaaatc gctgacccac ctgatgatga tgagcgatgt tacgccaatc

781 tatttccgcc cgacccgtaa cgcttacggt attcttggtg gtatcccaca gagtgaattc

841 cagcacgcta ccattgctaa gcgcgtgaaa gaaacaccaa acgcaacctg gccggtacat

901 gctgtaatta ccaactctac ctatgatggt ctgctgtaca acaccgactt catcaagaaa

961 acactggatg tgaaatccat ccactttgac tccgcgtggg tgccttacac caacttctca

1021 ccgatttacg aaggtaaatg cggtatgagc ggtggccgtg tagaagggaa agtgatttac

1081 gaaacccagt ccactcacaa actgctggcg gcgttctctc aggcttccat gatccacgtt

1141 aaaggtgacg taaacgaaga aacctttaac gaagcctaca tgatgcacac caccacttct

1201 ccgcactacg gtatcgtggc gtccactgaa accgctgcgg cgatgatgaa gggtaatgct

1261 ggtaagcgtc tgatcaacgg ttccattgaa cgtgcgatca aattccgtaa agagatcaaa

1321 cgtctgagaa cggaatctga tggctggttc tttgatgttt ggcagccgga tcatatcgat

1381 acgactgaat gctggccgct gcgttctgac agcacctggc acggcttcaa aaacatcgat

1441 aacgagcaca tgtatcttga cccgatcaaa gtcaccctgc tgactccggg gatggaaaaa

1501 gacggcacca tgagcgactt tggtattccg gccagcatcg tggcgaaatacctcgacgaa

1561 catggcatcg ttgttgagaa aaccggtccg tataacctgc tgttcctgtt cagcatcggt

1621 atcgataaga ccaaagcact gagcctgctg cgtgctctga ctgacttcaa acgtgcgttc

1681 gacctgaacc tgcgtgtgaa aaacatgctg ccgtctctgt atcgtgaaga tcctgaattc

1741 tatgaaaaca tgcgtattca ggaactggct caaaatatcc acaaactgat tgttcaccac

1801 aatctgccgg atctgatgta tcgcgcattt gaagtgctgc cgacgatggt aatgactccg

1861 tatgctgcgt tccagaaaga gctgcacggt atgaccgaag aagtttacct cgacgaaatg

1921 gtaggtcgta ttaacgccaa tatgatcctt ccgtatccgc cgggagttcc tctggtaatg

1981 ccgggtgaaa tgatcaccga agaaagccgt ccggttctgg agttcctgca gatgctgtgt

2041 gaaatcggcg ctcactatcc gggctttgaa accgatattc acggtgcata ccgtcaggct

2101 gatggccgct ataccgttaa ggtattgaaa gaagaaagca aaaaataa

SEQ ID：NO 6(Hafnia Alvei gene for lysine decarboxylase(haldc)

>gi|43438|emb|X03774.1|Hafnia alvei gene for lysine decarboxylase(LDC)

1 atgaatatca ttgccatcat gaacgattta agcgcttatt ttaaggaaga acccctgcgc

61 gagctgcatc aagagttaga gaaggaaggc ttccgtattg cttatcccaa agaccgcaac

121 gatctgctga agctgattga aaacaactcc cgcctgtgtg gcgtcatttt cgactgggat

181 aaatataacc tcgaactcag cgctgaaatc agcgagctca acaaactgct gccaatttat

241 gccttcgcca atacctattc gacgcttgac gtcaacatga gcgacctgcg tcttaatgtt

301 cgcttctttg aatatgcatt aggcagcgcg caagacattg ccaccaagat ccgccaaagc

361 accgatcagt atattgatac cattctgcca ccgctgacca aggcgctgtt caaatacgtc

421 aaagaagaga aatacacagt ctgtacgccg gggcatatgg gcggaactgc gttcgataaa

481 agccctgtcg gtagcctgtt ctatgatttc ttcggtgaaa acaccatgcg ttcggatatc

541 tcgatctccg tatctgagct cggatcgctg ctcgatcata gcggcccaca ccgtgacgcc

601 gaagagtata tcgcgcgcac gttcaacgcc gatcgcagct atatcgtaac caacggaaca

661 tctacggcga ataaaattgt cggcatgtat tcatctcctg ccggtgccac tattctgata

721 gaccgtaact gccataaatc attgacccat ttgatgatga tgagcaacgt tgtccccgtc

781 tatctgcgcc caacccgtaa cgcctacggc attttaggcg ggataccgca aagcgagttc

841 acccgcgcca gcattgaaga gaaagtgaaa aatacgccca atgcgacatg gccggtgcat

901 gcggtagtca ccaactctac ctatgacggc ctgttctaca ataccgaata catcaaaaac

961 acgcttgatg ttaagtcgat tcacttcgat tcggcatggg tgccttacac caacttccat

1021 ccgatttacc aaggcaaagc agggatgagc ggtgaacgtg tgccggggaa aatcatctac

1081 gagactcagt ccacccacaa actgctggcg gcattctcgc aggcatcgat gatccacgtg

1141 aaaggtgaga tcaacgaaga aaccttcaat gaagcctata tgatgcatac ctcaacatca

1201 ccgcattacg ggatcgttgc gtcgacggaa accgcggcgg ctatgatgaa gggcaacgcc

1261 ggtaagcgtt taattaacgg ttcaattgaa cgagcgatcc gcttccgtaa agagatccgc

1321 cgcttacgta cagaatctga tggctggttc tttgacgtat ggcagccgga taacattgac

1381 gaggttgctt gctggccact caatccacgt aatgaatggc atggattccc gaacatcgac

1441 aacgatcata tgtatcttga tccgatcaaa gtcactctgc tgaccccagg tttaagcccc

1501 aatggcactc tggaagagga agggataccg gcgtcgatcg tgtcgaaata tctggatgag

1561 cacggcatca tcgtggaaaa aaccgggcca tataacctgc tcttcctgtt tagtatcggg

1621 atcgataaaa ccaaggcgtt gagcttgttg cgggcattaa ccgatttcaa acgcgtgtat

1681 gacctcaacc tgcgcgtgaa aaacgtgttg ccatcgctct ataacgaggc gcctgatttc

1741 tataaagaga tgcgaattca ggagttggct caggggattc atgctctggt gaaacaccac

1801 aatctaccag acctgatgta tcgtgcattt gaggtattac caaagctggt gatgacgccg

1861 catgatgcgt tccaagaaga agtgcgtggc aatattgagc catgtgcctt ggatgatatg

1921 ttagggaaag ttagcgccaa catgatcttg ccgtatcctc cgggtgttcc ggtggttatg

1981 ccgggagaaa tgctcactaa ggagagccgc cctgttctga gcttcttgca gatgctatgt

2041 gaaattggcg cacactatcc gggctttgaa acggatattc acggcgttca tcgtgatggt

2101 gcaacgggta aatacatggt cgtggtgctc aaacaaggcg cagatgaacc gggtgataaa

2161 ccgagtgata cggtgaagaa agcgccgggt aaaaaaccat cagcggcgaa gaagtcataa

SEQ ID：NO 7

1 ATGAACGTTA TTGCAATATT

SEQ ID：NO 8

1 ACTGAAAGCT TCCACTTCCC TTGTACGAGCT

SEQ ID：NO 9

1ATTCAATATT GCAATAACGT TCATAGCTGT TTCCTGTGTG

SEQ ID：NO 10

1 AGGAAACAGC TATGAACGTT

SEQ ID：NO 11

1 ACTGAAAGCTT TACTTTCATC ACAAGCCTCT

SEQ ID：NO 12

1 ACTGAAAGCTT AGATTCAGCG CGAGAGTGAT

SEQ ID：NO 13

1 ACTGAAAGCT TTTTAATTGT GTGACCACTA T

Claims (21)

1. stable recombinant expression plasmid carrier comprises:

The polynucleotide of one section coding recombinant type toxin-resistant gene, it expresses a peptide species, the polypeptide poisonous to host cell that neutralize, this poisonous polypeptide is expressed in host cell by the polynucleotide of one section toxin-encoding gene;

The polynucleotide of one section coded polypeptide expression product, wherein,

This stable recombinant expression plasmid carrier forms by reproducible skeleton plasmid in hafnia alvei is derivative.

2. recombinant plasmid vector according to claim 1, it further comprises the polynucleotide of toxin-encoding gene.

3. recombinant plasmid vector according to claim 2 is characterized in that described toxin gene and toxin-resistant gene comprise the arbitrary aat/aai of being selected from gene pairs, the gene pairs of abt/abi gene pairs and fragment thereof.

4. according to claim 1,2, or 3 described recombinant plasmid vectors, it is characterized in that described toxin gene comprises to be selected from the dna sequence dna shown in SEQ ID NO:1 or the SEQ ID NO:3, or its fragment.

5. each described recombinant plasmid vector according to claim 1-4 is characterized in that described toxin-resistant gene comprises to be selected from the dna sequence dna shown in SEQ ID NO:2 or the SEQ ID NO:4, or its fragment.

6. each described recombinant plasmid vector according to claim 1-5 is characterized in that described skeleton plasmid is for comprising pUC(pUC18/19), pBR322, arbitrary plasmid of pACYC and its plasmid.

7. each described recombinant plasmid vector according to claim 1-6 is characterized in that described expression of polypeptides product comprises decarboxylase, and is at least a in lytic enzyme and the Starch phosphorylase.

8. recombinant plasmid according to claim 7 is characterized in that decarboxylase is amino acid decarboxylase, such as lysine decarboxylase, and tyrosine deearboxylase, arginine decarboxylase, ornithine decarboxylase, or L-Glutamic decarboxylase.

9. recombinant plasmid vector according to claim 8, the polynucleotide of the lysine decarboxylase that it is characterized in that encoding comprises the haldc gene, the cadA gene with and fragment.

10. recombinant plasmid according to claim 9 is characterized in that described recombinant vectors comprises the dna sequence dna shown in SEQ ID NO:5 or the SEQ ID NO:6, or its fragment.

11. recombinant plasmid according to claim 7 is characterized in that described lytic enzyme is beta-galactosidase enzymes.

12. recombinant plasmid according to claim 11, the polynucleotide of the described beta-galactosidase gene that it is characterized in that encoding comprise lacZ gene and relevant dna fragmentation.

13. each described recombinant plasmid vector shifts the transformant that enters host cell and obtain according to claim 1-12, it is characterized in that described host cell is the hafnia alvei without endogenous plasmid.

14. transformant according to claim 13 is characterized in that described hafnia alvei is the industrial strain of hafnia alvei.

15. a method of producing 1,5-pentamethylene diamine comprises:

1a) cultivate claim 13 or 14 described transformants;

1b) generate 1,5-pentamethylene diamine with the bacterium liquid catalysis Methionin decarboxylation that obtains among the step 1a

Extract purifying in the reaction solution that 1c) from step 1b, obtains and obtain 1,5-pentamethylene diamine.

16. a kind of bio-based 1 that makes by claim 14 methods of claim, the 5-pentamethylene diamine.

17. a polymeric amide comprises the structure of structural formula 1:

Structural formula 1

And steric isomer, wherein:

M=4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21, or 22;

N=4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21, or 22;

j＝100~1000000；

Described polymeric amide is that the diamine of m and diprotic acid polymerization that carbonatoms is n make by carbonatoms, at least a organic carbon that comprises the renewable source that meets ASTM D6866 standard in diamine, the diprotic acid, and the m of this diamine or diprotic acid or n can be identical or different.

18. polymeric amide according to claim 17 is characterized in that, diamine is the bio-based 1 that method according to claim 15 makes, the 5-pentamethylene diamine.

19. according to claim 17 or 18 described polymeric amide, it is characterized in that, diprotic acid comprises the bio-based carbon that meets ASTM D6866 standard.

20. a composition comprises the arbitrary described polymeric amide of claim 17-19.

21. one kind prepares pentamethylene-1, the method for 5-isocyanic ester comprises:

2a) method according to claim 15 prepares bio-based 1, the 5-pentamethylene diamine;

The bio-based 1 that 2b) makes among the step of converting 2a, 5-pentamethylene diamine are pentamethylene-1, the 5-isocyanic ester.

Images