CN103667146A - DDT (2,2-bis(4-Chlorophenyl)-1,1,1-trichloroethane) and DDE (1,1-dichloro-2,2-bis(p-chlorophenyl)ethylene) degrading bacterium DXZ9 - Google Patents

Abstract

The invention provides a DDT (2,2-bis(4-Chlorophenyl)-1,1,1-trichloroethane) and DDE (1,1-dichloro-2,2-bis(p-chlorophenyl)ethylene) degrading bacterium DXZ9 (Stenotrophomonas sp.DXZ9). The DDT and DDE degrading bacterium DXZ9 is collected at the China Center for Type Culture Collection (CCTCC for short) with the CCTCC No: M2013304, and the collection data of the DDT and DDE degrading bacterium DXZ9 is June 28, 2013. After the DDT and DDE degrading bacterium DXZ9 is prepared into bacterium suspension, the bacterium suspension is directly added to soil so as to degrade DDT and DDE in the soil; the DDT and DDE degrading bacterium can be used for safely, efficiently and rapidly degrading the DDT and DDE remaining in the soil, thus the genetic toxicity of the DDT and the DDE to environments is reduced; the DDT and DDE degrading bacterium has the effects of repairing DDT and DDE contaminated soil and protecting ecological environments. The microbial agent of the bacterial strain is simple in preparation technology and low in cost and has high efficiency, no secondary pollution and very good application prospect.

Description

One strain DDT and DDE degradation bacteria DXZ9

(1) technical field

The present invention relates to a strain DDT and DDE degradation bacteria DXZ9, be specifically related to a strain DDT and DDE degradation bacteria---Stenotrophomonas belongs to (Stenotrophomonas sp.), belongs to biological degradation processing technology field.

(2) background technology

DDT (2,2-bis (4-Chlorophenyl)-1,1,1-trichloroethane) molecular formula: C ₁₄h ₉cl ₅, two (4-the chloro-phenyl-)-1，1，1-trichloroethane (p, p'-DDT) of another name 2,2-; DDE(1,1-dichloro-2,2-bis (p-chlorophenyl) ethylene) as a kind of aerobic meta-bolites of DDT, but DDE is stronger than DDT persistence, although so disabled a lot of years of DDT, its degraded product DDE still exists in environment.Molecular formula: C ₁₄h ₈cl ₄, 2,2-pair-(rubigan)-vinylidene chloride of another name.Its structural formula is as follows:

Pure p, p'-DDT is white crystals, and fusing point is 108.5～109 ℃, and zero pour is more than 87 ℃, water insoluble, dissolves in most of organism or chlorinated solvent.

Although DDT China has forbidden for many years, the residual concentration of DDTs in environment is still high, and the recall rate of DDTs in the soil of different areas, Nanjing is 100%, and residual quantity is at 0.148～0.26mgkg ^-1between.In most of sampling point soil, may there is the input of new DDTs pollutent.In the topsoil in Guanting reservoir region, Pekinese, have the existence of organochlorine pesticide, DDT content accounts for 93% of total organochlorine pesticide.Mainly contain two reasons, first pollution source is mainly from residual in environment of use of a large amount of organochlorine pesticides eighties, i.e. historical use causes; The second production from agricultural chemicals kelthane and use.DDT disappears slowly in edatope, generally, approximately needs 10 years.Most of DDT is present in the soil that surface layer 2.5cm is dark, and the transformation period in the environment of temperate zone can reach 2.3～30 years, and in the torrid zone, during rainy season, the transformation period of DDT in field soil is 234～317 days.In DDTs various surrounding mediums (ocean, bed mud, atmosphere, rivers, soil etc.), animal vegetable tissue organ and human body thereof in the world, extensively exist, oneself becomes a global environmental problem gradually through having caused people from all walks of life and the public's extensive concern.DDT all can exert an influence to biological neural system, reproductive system, immunity system, endocrine system, because DDT has fat-solubility, persistence and stability with its meta-bolites, by food chain, produce biological magnification, it is the focus that people pay close attention to the potential risk of ecotope and HUMAN HEALTH always.

Utilize microorganism recovery technique cost be low because having, environmental influence compared with little, microbial life power is extremely strong, can large-area applications etc. distinct advantages be more and more subject to people's attention, be one of soil remediation technology of at present tool potentiality.So far, some researchers have screened many strains DDT degradation bacteria both at home and abroad, but DDE degradation bacteria is less, and it is the bacterial strain that is found first DDT and DDE all to have good degradation capability that Stenotrophomonas that this research relates to belongs to.

(3) summary of the invention

In order to address the above problem, the present invention has obtained a strain DDT and DDE degradation bacteria DXZ9 from the production waste treatment plant collection separation of agricultural chemicals, belongs to Stenotrophomonas and belongs to, and the experiment proved that it all has degradation capability to DDT and DDE.

One strain DDT and DDE degradation bacteria DXZ9(Stenotrophomonas sp.DXZ9), on June 28th, 2013, be preserved in Wuhan, China typical case's culture collection center (being called for short CCTCC), preserving number is CCTCC No:M2013304.Preservation address: Luojia Mountain, Wuhan, Hubei Province Wuhan University; Postcode: 430072.

A described strain DDT and DDE degradation bacteria DXZ9 morphological specificity are as follows: be rod-short, do not produce gemma, band has raw flagellum; Gram positive, indoles, nitrate reduction, D-R, wood-sugar fermentation, lactose fermentation, seminose fermentation test are all negative.

The total DNA of DDT and DDE degradation bacteria DXZ9 of take is template, utilize bacterial 16 S rDNA universal primer (27F:AGAGTTTGATCCTGGCTCAG, 1392R:ACGGGCGGTGTGTAC) carry out pcr amplification, obtain being about the amplified production of 1500bp, order-checking is completed by the raw work in Shanghai, and its 16s rDNA sequence is as shown in SEQ ID.NO1.

According to the comparison of Gene Bank sequence homology, bacterial strain DXZ9 and Stenotrophomonas maltophilia are in a minimum branch together, and homology reaches 91%.In conjunction with the physiological and biochemical property of bacterial strain, bacterial strain DXZ9 is initially identified as to Stenotrophomonas and belongs to, called after DDT and DDE degradation bacteria DXZ9(Stenotrophomonas sp.DXZ9).

Through the degradation characteristic research of DDT and DDT degradation bacteria DXZ9 is found: suitable DXZ9 growth and optimum temps when DDT and DDE degradation rate are reached to maximum thereof are 30 ℃, and pH is 7.0; Under optimum temps and pH condition, degradation bacteria DXZ95d is interior to 10 μ gmL ^-1the degradation rate of DDT and DDE is respectively 54.99% and 39.68%, when the concentration of DDT reaches 20 μ gmL ^-1time this bacterium degradation rate still in 40% left and right, when the concentration of DDE reaches 20 μ gmL ^-1time, the degradation rate of this bacterium is still in 30% left and right.

By GC-MS, analyze, DDT is first degraded to p under degradation bacteria DXZ9 effect, p '-DDE and p, p-DDD, then generates intermediate product 9-Methylidenefluorene, finally may be decomposed into 1,2-benzenedicarboxylic Acid, 2,6-bis (1,1-dimethylethyl)-4-methyl-phenol, 2-benzenedicarboxic Acid, Dodecanoic Acid and 2,6-bis (1,1-dimethylethyl)-4-methyl-phenol.In addition, p in soil, p '-DDT and p, before and after p '-DDE degraded, biological genetoxic is adopted this index of Eisenia foetida coelomocyte DNA damage degree is evaluated, result shows to inoculate the toxicity that degradation bacteria DXZ9 can significantly reduce DDTs contaminated soil, adopt microorganism to repair and can obviously reduce p, p '-DDT and p, the residual toxicity of p '-DDE contaminated soil.

Beneficial effect of the present invention is mainly reflected in: DDT of the present invention and DDE degradation bacteria DXZ9 are made after bacteria suspension and can be applied to by the mode in soil of directly adding the degraded of DDT and DDE in soil; residual DDT and DDE on the objects such as water body, soil can safely, efficiently, fastly degrade; thereby reduce the genetoxic that DDT and DDE cause environment, the effect of play reparation DDT and DDE contaminated soil, preserving the ecological environment.The microbial inoculum preparation technology of this bacterial strain is simple, and cost is low, efficiency is high, non-secondary pollution, has good application prospect.

(4) accompanying drawing explanation

Fig. 1 is bacterial strain DXZ9 scanning electron microscope picture of the present invention

Fig. 2 is the gas chromatogram of tetra-kinds of standard model results of DDT

This figure can find out the appearance time of DDT and isomer thereof, and determines thus the concentration of DDT and DDE sample in isolation and purification culture base;

Fig. 3 is the gas chromatogram of DDT sample in isolation and purification culture base

Fig. 4 is the gas chromatogram of DDE sample in isolation and purification culture base

Take Fig. 3 and Fig. 4 goes out the degradation rate of DXZ9 to DDT and DDE as benchmark;

Fig. 5 is the growth curve of DXZ9 and is 10 μ gmL to concentration ^-1the degradation curve figure of DDT

Fig. 6 is the growth curve of DXZ9 and is 10 μ gmL to concentration ^-1the degradation curve figure of DDE

Fig. 5 and Fig. 6 have illustrated that bacterial strain DXZ9 is respectively 55.0% and 39.4% to the degradation rate of DDT and DDE when 5d;

Fig. 7～Figure 10 is respectively DDT at the total ion current scanning spectra (red lines are formed automatically by gas chromatography mass spectrometry instrument system) of the degraded sample of contrast in 10 days, 3 days, 5 days and 10 days

By Fig. 7～Figure 10, can determine the degraded product that DXZ9 degraded DDT produces;

Figure 11 is the DGGE collection of illustrative plates of degradation bacteria DXZ9

Figure 12 adds the impact of degradation bacteria strains DXZ9 on soil bacteria quantity in soil

Figure 11 and Figure 12 concentrated expression breeding and the survival condition of degradation bacteria DXZ9 in soil;

Figure 13 is DDT and DDE and total DDT degradation results in soil under Different treatments thereof

This figure reflected in 4 treatment group DDT and DDE and the degraded of total DDT in soil dynamic;

Figure 14 is p, p '-DDT and p, the impact of the degraded product of p '-DDE in soil on Eisenia foetida coelomocyte DNA damage degree (Olive back range)

This figure has reflected the degree of injury of pedo relict DDTs to earthworm coelomocyte in three typical time, six different treatment groups, the group S+D+B that adds degradation bacteria DXZ9 does not significantly reduce the degree of injury of earthworm coelomocyte than not adding group S+D pedo relict DDTs, thereby has reflected that DXZ9 can reduce the genetoxic of soil;

(5) embodiment

Below in conjunction with concrete case study on implementation, the present invention is described further, but protection scope of the present invention is not limited in this:

Screening and the evaluation of embodiment 1:DDT and DDE degradation bacteria DXZ9

Inorganic salt basic medium:

NaNO ₃4.00g, KH ₂pO ₄1.50g, Na ₂hPO ₄0.50g, FeCl ₃0.005g, CaCl ₂0.01g, MgSO ₄0.20g, deionized water 1L, is adjusted to pH7.0,121 ℃ of sterilizing 30min.

Contain a small amount of nitrogenous source substratum: in above-mentioned inorganic salt basic medium, add 5.0g peptone, be adjusted to pH7.0,121 ℃ of sterilizing 30min.

DDT isolation and purification culture base: add DDT above-mentioned containing in a small amount of nitrogenous source substratum, and the concentration that makes DDT in substratum is 10 μ gmL ^-1, agar 15.0g, is adjusted to pH7.0,121 ℃ of sterilizing 30min.

DDE isolation and purification culture base: add DDE above-mentioned containing in a small amount of nitrogenous source substratum, makes the concentration of DDE in substratum be respectively 10 μ gmL ^-1, agar 15.0g, is adjusted to pH7.0,121 ℃ of sterilizing 30min.

1) bacterial strain concentration and separation

The DDT discharge outlet mud that Jiang Cong insecticide factory and chemical plant gather and sewage sample are as the source of microorganism enrichment separation and Culture.Adopt direct method of isolation from gathered sample, to isolate DDT and DDE degradation bacteria.

Direct method of isolation: get mud 5g(sewage 5mL) in containing in the triangular flask of sterilized water 95mL, obtain 10 ^-2soil diluent; With the 1mL transfer pipet of sterilizing, pipette 1.0mL, inject a test tube that fills 9mL sterilized water, fully shake up, obtain 10 ^-3diluent; Change again the pipette, extract 1.0mL of a 1mL sterilizing, inject a test tube that fills 9mL sterilized water, fully shake up, obtain 10 ^-4diluent.The rest may be inferred, and serial dilution is made into 10 ^-5, 10 ^-6etc. a series of concentration dilution liquid, for plate isolation.By 10 ^-4, 10 ^-5, 10 ^-6the mud diluent of three concentration is inoculated on DDT isolation and purification culture base, with spreading rod coating evenly, being placed in 30 ℃ of biochemical cultivation cases cultivates, the microorganism of gained carries out separation and purification, inoculate on DDE isolation and purification culture base, after domestication is cultivated, choose the single bacterium colony inoculation inclined-plane growing on DDE isolation and purification culture base, cultivation obtains six strains may have the bacterial strain of degradation capability to DDT and DDE, numbering is preserved, and is numbered respectively: DXZ1, DXZ4, DXZ9, DXZ27, DXZ31 and DXZ32.

Configuration degradation bacteria bacteria suspension: adopt the 500mL wide-necked bottle wet thallus of above-mentioned six bacterial strains of enrichment culture respectively, use aqua sterilisa to adjust cell concentration, be mixed with OD ₆₀₀be 1.0 DDT degradation bacteria bacteria suspension, standby.

Preparation is containing 10 μ gmL ^-1the isolation and purification culture base of DDT, gets in the test tube that 5mL joins 18mm * 180mm (18 test tubes) totally; 6 bacterial strains (DXZ1, DXZ4, DXZ9, DXZ27, DXZ31 and DXZ32) of institute's separation and Culture are configured respectively to degradation bacteria bacteria suspension according to the method described above, by the bacterium amount that the connects inoculation of each test tube 1%, each bacterial strain arranges the test tube of 3 repetitions, and 30 ℃, 160rmin ^-1lucifuge shaking culture, takes out test tube after cultivation 5d, measures the residual concentration of DDT, obtains degradation rate, selects the bacterial strain higher to DDT degradation rate, and numbering is respectively DXZ9, DXZ27 and DXZ31.

Preparation is containing 10 μ gmL ^-1the isolation and purification culture base of DDE, in the test tube of nine 18mm * 180mm, add respectively 5mLDDE isolation and purification culture base, will be numbered the bacterial strain of DXZ9, DXZ27 and DXZ31 by the bacterium amount that the connects inoculation of each test tube 1%, each bacterial strain arranges the test tube of three repetitions, 30 ℃, 160rmin ^-1lucifuge shaking culture, takes out test tube after cultivation 5d, measures the residual concentration of DDE, obtains degradation rate, filters out the bacterial strain higher to DDE degradation rate, called after DDT and DDE degradation bacteria DXZ9.

2) identification of strains

The DXZ9 bacterial strain of above-mentioned acquisition is carried out to colonial morphology and Physiology and biochemistry evaluation, and the electromicroscopic photograph of this bacterial strain as shown in Figure 1.The main biological property of this bacterial strain is: be rod-short, do not produce gemma, band has raw flagellum; Gram positive, indoles, nitrate reduction, D-R, wood-sugar fermentation, lactose fermentation, seminose fermentation test are all negative.

The optimum growth conditions of this bacterial strain is pH value 7.0,30 ℃ of temperature.This bacterial strain is accredited as Stenotrophomonas through 16S rDNA sequential analysis and belongs to.

Embodiment 2 degradation bacteria DXZ916S rDNA sequential analyses

LB substratum: peptone 10.0g, yeast extract paste 5.0g, NaCl10.0g is dissolved in 1L deionized water, adjusts pH to 7.0,121 ℃ of sterilizing 30min.

The extraction of 1.DDT and the total DNA of DDE degradation bacteria DXZ9

Adopt the total DNA test kit of MO BIO PowerSoil DNA Isolation Kit to extract total DNA in degradation bacteria DXZ9.

1) yeast culture: inoculate according to a conventional method degradation bacteria DXZ9 in LB substratum, in 30 ℃ of shaking culture 16～18h;

2) microorganism collection: get the LB cultivating after degradation bacteria DXZ9 and cultivate based in 100mL centrifuge tube, 8000rmin ^-1centrifugal 10min, abandons supernatant liquor, collects wet thallus.

3) total DNA extraction: the bath of fetching boiling water in advance, be adjusted to 60 ℃, Solution C1 is put into water-bath, precipitation is disappeared.Take 0.5g wet thallus and add in PowerBead pipe, whirlpool gently mixes.In PowerBead pipe, add 60 μ LSolution C1, of short duration vortex mixes.Vortex oscillation 10min.Under room temperature, the centrifugal 2min of 10000 * g.(rotating speed does not surpass 10,000 * g, otherwise PowerBead pipe may break.) transferase 45 00 μ L supernatant liquor is in new 2mL collection tube again.Add 250 μ L Solution C2 in 2mL collection tube, after vortex vibration 5s, at 4 ℃, cultivate 5min.Under room temperature, 10000 * g, centrifugal collection tube 3min.Shift the supernatant liquor of 650 μ L to new 2mL collection tube.Add in 200 μ L Solution C32mL collection tubes, after of short duration vortex vibration, at 4 ℃, cultivate 5min.Under room temperature, 10000 * g, centrifugal 2mL collection tube 3min.Avoid particle, shift the supernatant liquor of 750 μ L to new 2mL collection tube.Rock and mix after Solution C4, add 1200 μ L Solution C4 in 2mL collection tube, vortex vibration 5s.Pipette about 675 μ L supernatant liquors to Spin Filter, under room temperature, 10000 * g, centrifugal 3min.After outwelling waste liquid, add again 675 μ L supernatant liquors to Spin Filter, under room temperature, 10000 * g, centrifugal 3min.After outwelling waste liquid, add again remaining supernatant liquor to Spin Filter, under room temperature, 10000 * g, centrifugal 3min.In Spin Filter, add 500 μ L Solution C5, under room temperature, 10,000 * g, centrifugal 2min.Outwell after waste liquid, under room temperature, 10000 * g, empty centrifugal Spin Filter3min.Spin Filter is put into new 2mL collection tube, do not allow Solution C5 spill on Spin Filter.Add 60 μ L Solution C6 in the white filter membrane of central authorities place, wash-out SpinFilter film.Under room temperature, 10000 * g, centrifugal 3min.Abandon Spin Filter, in-20 ℃, preserve DNA in pipe.

The 16S rDNA amplification of 2.DDT and DDE degradation bacteria DXZ9

Take above-mentioned DNA as template, use primer: 5 ' end primer is 27F(5 '-AGAGTTTGATCMTGGCTCAG-3 '), 3 ' end primer is 1492R(5 '-CGGYTACCTTGTTACGACTT-3 ') increase.

Pcr amplification reaction system (50 μ L): 5.0 μ L10 * PCR Buffer, 2.0 μ L2.5mM dNTP mixed solutions, 5.0 μ L25mM MgCl ₂solution, 2.0 μ L primer 1(27F), 2.0 μ L primer 2s (1392R), 1.0 μ L Taq archaeal dna polymerases, 1.0 μ L template DNAs, 32.0 μ L distilled waters.

PCR reaction conditions: 94 ℃ of denaturation 1min; 94 ℃ of sex change 1min, 58 ℃ of annealing 1min, 72 ℃ are extended 2min, circulating reaction 28 times, 72 ℃ are extended 10min, 10 ℃ of insulations.

Get 5 μ L reactants and in suitable sepharose, check that the expection of PCR product is big or small, with EB dyeing, under UV-light, observe goal gene.

3.16S rDNA sequencing

Order-checking is completed by Shanghai Sheng Gong Science and Technology Ltd., and its 16s rDNA sequence is as shown in SEQ ID.NO1.

Embodiment 3: the degradation characteristic of degradation bacteria DXZ9

The extraction of DDT and DDE in isolation and purification culture base: degradation bacteria DXZ9 is inoculated into described DDT(or DDE) in isolation and purification culture base, cultivate 5d, the normal hexane that adds 5mL, on vortex mixer, abundant mechanical shaking extraction, standing, organic phase, anhydrous Na are collected in centrifugation ₂sO ₄dehydration, upper machine testing.

If contrast is: replace degradation bacteria DXZ9 to contain DDT(or DDE described in being inoculated into sterilized water) isolation and purification culture base in, cultural method is the same.

The mensuration of DDT and DDE: gas chromatographic analysis: Shimadzu GC-14C gas chromatograph, capillary column (OV-1701) (30m * 0.53mm * 1.0 μ m), ECD detector.260 ℃ of injector temperatures, 240 ℃ of column temperatures, 280 ℃ of detectors, N ₂flow velocity 20mLmin ^-1, tail wind drift speed 25mLmin ^-1, sample size 1 μ L.

The calculation formula of bacteria suspension to DDT and DDE degradation rate:

$R=\frac{C_{\mathrm{ck}}-C}{C_{\mathrm{ck}}}\×100\%$

In formula: R: the degradation rate of degradation bacteria (%); C: meet concentration (the μ gmL that bacterium is processed DDT (DDE) in isolation and purification culture base ^-1); C _ck: concentration (the μ gmL of DDT (DDE) in sterilized water contrast isolation and purification culture base ^-1).

The cubage of gas Chromatographic Determination DDT (DDE): the peak height of chromatographic peak and standard specimen chromatographic peak per sample, utilizes external standard method to calculate the concentration of DDT (DDE) in isolation and purification culture base.Calculation formula is as follows:

$\mathrm{Cx}=N\&times;\frac{{\mathrm{<figure-callout\; id="0"\; label="V"\; filenames="HDA0000435790470000033.png,HDA0000435790470000052.png"\; state="\{\{state\}\}">V</figure-callout>}}_0}{\mathrm{VX}}\&times;\frac{{\mathrm{<figure-callout\; id="0"\; label="S\; X\; S"\; filenames="HDA0000435790470000033.png,HDA0000435790470000052.png"\; state="\{\{state\}\}">S</figure-callout>}}_X}{S_{}}\&times;{\mathrm{<figure-callout\; id="0"\; label="C"\; filenames="HDA0000435790470000033.png,HDA0000435790470000052.png"\; state="\{\{state\}\}">C</figure-callout>}}_0$

In formula: C _x: DDT or DDE concentration (μ gmL in isolation and purification culture base ^-1); N: diluted sample multiple; S _x: sample chromatogram peak-to-peak area; V _x: sample feeding amount (μ L); V ₀: standard specimen sample size (μ L); S ₀: standard specimen chromatographic peak peak area; C ₀: standard specimen concentration (μ gmL ^-1)

1) abstraction and quantification test method DDT(DDE) DDT(DDE in the isolation and purification culture base) foundation of residual measuring method: according to above-mentioned DDT(DDE), to DDT(DDE) add 1.0,5.0,10.0,20.0 μ gmL in isolation and purification culture base ^-1the DDT(DDE of four concentration) standard specimen, each adds concentration and repeats 6 times, then under selected GC-ECD chromatographic condition, measure, calculate recovery rate and the variation coefficient, recording four components is 92.22%～99.07% from the interpolation rate of recovery of DDT in pure medium, and the interpolation rate of recovery that the variation coefficient is less than 6.27%, DDE is 80.74%～83.38%, the variation coefficient is less than 4.76%, meets the requirement of pesticide residue extracting method completely.The rate of recovery situation of adding concentration from standard, abstraction and quantification method DDT(DDE) can meet DDT(DDE in isolation and purification culture base) retention analysis requirement.

Under described chromatographic condition, DDT and DDE standard specimen, working sample spectrogram are respectively Fig. 2, Fig. 3 and Fig. 4.By above three spectrograms, can be found out, under this chromatographic condition, sample peak shape is good, and inclusion-free peak disturbs, highly sensitive, and retention time is also proper, illustrates that the chromatographic condition of selecting is relatively applicable to measuring the DDT(DDE in isolation and purification culture base).

2) the concentration impact of pH value on the growth of bacterium for degrading and degradation capability: adjustment DDT(DDE) the pH value of isolation and purification culture base is respectively 4.0,5.0,6.0,7.0,8.0,9.0,10.0, wherein DDT(DDE) is 10 μ gmL ^-1, the bacteria suspension of the bacterium amount that the connects inoculation degradation bacteria DXZ9 by 1%, 30 ℃, 160rmin ^-1lower lucifuge shaking culture, samples after 5d, measures the OD600 value of isolation and purification culture base, calculates the increment of degradation bacteria; Repeat 3 times, establish 3 DDT(DDE that do not connect bacterium (adding sterilized water) contrast simultaneously) isolation and purification culture base, to residual DDT(DDE in isolation and purification culture base) and carry out extraction and determination, calculate degradation rate.Experimental result shows: in the scope of pH 6.0～8.0, pH value is not very large on the impact of the increment of bacterium, compared with the growth of this bacterial strain preferably under neutrallty condition.In the scope of pH4.0～6.0, pH value has a certain impact to the degradation rate of bacterium.Under acidic conditions, along with the raising of pH value, degradation rate increases, and under the partial neutral condition of pH6.0～8.0, the degradation rate of DDT is reached to 54.38%, to the degradation rate of DDE, can reach 39.88%; Under alkaline condition, from pH7.0～10.0, along with the rising of pH value, degradation rate reduces.In sum, this bacterium has higher degradation capability under the condition of meta-alkalescence, and degradation rate reaches maximum value under neutral condition.

3) impact of temperature on the growth of bacterium for degrading and degradation capability: the concentration of DDT or DDE is 10 μ gmL ^-1, the bacterium amount that the connects inoculation degradation bacteria DXZ9 by 1%, initial pH7.0, the temperature of setting shaking culture is respectively 10,20,30,40 ℃, 160rmin ^-1lucifuge shaking culture, samples after 5d, measures DDT(DDE) the OD600 value of isolation and purification culture base, the increment of calculating degradation bacteria; Repeat 3 times, establish 3 simultaneously and do not connect bacterium contrast isolation and purification culture base, to DDT(DDE) residual DDT(DDE in isolation and purification culture base) carry out extraction and determination, calculate degradation rate.Experimental result shows: under different culture temperature, the increment of bacterium increases along with the rising of temperature, to 30 ℃, reaches maximum, to the degradation rate of DDT, is now 54.4%, to the degradation rate of DDE, be 39.7%, then the increment with the rising bacterium of temperature declines rapidly.

4) DDT(DDE) impact of concentration on the growth of bacterium for degrading and degradation capability: according to above-mentioned 2) and 3) in the result of temperature, initial pH value experiment, control DDT(DDE) in isolation and purification culture base initial DDT or DDE concentration be respectively 1,5,10,20mgL ^-1, by 1% the bacterium amount that connects inoculation degradation bacteria DXZ9, pH7.0,30 ℃ of lucifuge shaking culture, the increment of sampling and measuring bacterium and to DDT or DDE degradation rate after 5d.Experimental result shows: the increment of degradation bacteria DXZ9 declines along with the increase of DDT concentration.Along with the rising of DDT concentration in DDT isolation and purification culture base, degraded takes the lead in raising, rear reduction.With the rising of DDT concentration in isolation and purification culture base, after taking the lead in raising, degraded reduces, when DDT concentration is 10 μ gmL ^-1time, it is 54.99% that degradation rate reaches the highest; When DDT concentration continue to increase, degradation rate starts to reduce, when the concentration of DDT reaches 20 μ gmL ^-1time this bacterium degradation rate still in 40% left and right, illustrate that this bacterial strain still has higher degradation rate to high density DDT.Along with the rising of DDE concentration in DDE isolation and purification culture base, degraded takes the lead in raising, rear reduction.When DDE concentration is 10 μ gmL ^-1time, it is the highest by 38.98% that degradation rate reaches; When DDE concentration continue to increase, degradation rate starts to reduce, when the concentration of DDE reaches 20 μ gmL ^-1time, the degradation rate of this bacterium is still in 30% left and right.

5) growth curve of bacterial strain DXZ9 and DDT(DDE under top condition) degradation curve: preparation DDT(DDE) content is 10 μ gmL ^-1isolation and purification culture base, by the bacteria suspension of 1% the bacterium amount that connects inoculation degradation bacteria DXZ9.30 ℃, 160rmin-1 lucifuge shaking culture.Repeat 3 times, establish 3 simultaneously and do not connect bacterium contrast isolation and purification culture base, according to sample time, 3d, 5d, 7d, 10d take out test tube, mensuration DDT(DDE) residual concentration, obtain degradation rate.DDT and DDE degradation curve figure are shown in respectively Fig. 5 and Fig. 6, prolongation along with incubation time, at DDT(DDE) increment of bacterium reduces generally gradually in isolation and purification culture base, degradation bacteria is to DDT(DDE) degradation rate keep generally increasing, to 5d, reach respectively 55.0% and 39.4%, the trend increasing after 5d is relatively mild, the most of decline of thalline, activity decreased.By this experiment, determine that degradation bacteria is 5d to the best degradation time of DDT and DDE.

By experimental results show that above: suitable DXZ9 growth and temperature when DDT and DDE degradation rate are reached to maximum thereof are 30 ℃, and pH is 7.0; Under optimum temps and pH condition, degradation bacteria DXZ95d is interior to 10 μ gmL ^-1the degradation rate of DDT and DDE is respectively 54.99% and 39.68%, when the concentration of DDT reaches 20 μ gmL ^-1time this bacterium degradation rate still in 40% left and right, when the concentration of DDE reaches 20 μ gmL ^-1time, the degradation rate of this bacterium is still in 30% left and right.Illustrate that bacterial strain DXZ9 DDT and the DDE of higher concentration that can degrade in isolation and purification culture base is residual.

Embodiment 4:DDT degraded product is analyzed

The preparation of degradation solution and extraction: what cultivate 3d, 5d and 10d, containing concentration, be 10mgL ^-1in DDT isolation and purification culture base, first use 5mL normal hexane extraction, fully mechanical shaking extraction, standing, and organic phase is collected in centrifugation; Isolation and purification culture base extracts by 5mL ethyl acetate again, and fully mechanical shaking extraction, standing, and organic phase, anhydrous Na are collected in centrifugation ₂sO ₄dehydration, united extraction liquid, after Nitrogen evaporator dries up, with utilizing GC-MS instrument to detect analysis after normal hexane constant volume.

Gas-matter analysis condition: gas chromatograph-mass spectrometer model: PE Clarus500; GC conditions: Elite-5MS capillary gas chromatographic column (30m * 0.25mm * 0.25 μ m); Carrier gas is helium, purity 99.999%, flow velocity 1mLmin ^-1; Injector temperature: 250 ℃; Column temperature: 70 ℃ keep 1min, then rise to 180 ℃ with 20 ℃/min, keep 5min, then rise to 260 ℃ with 5 ℃/min, keep 5min.Splitless injecting samples pattern; Transmission line temperature: 250 ℃; Mass spectrum condition: EI ion source temperature: 200 ℃; Ionic current sweep limit: 40～500m/z; Solvent delay: 3.5min; Automatic sampling.

Atlas analysis method: mass spectroscopy is used PE TurboMass5.1 to carry database analysis system, resolves in conjunction with artificial material.

The total ion current figure that different time extracts degraded product is shown in shown in Fig. 7～Figure 10, analysis collection of illustrative plates is known, DDT is first degraded to p under degradation bacteria DXZ9 effect, p '-DDE and p, p-DDD, then generate intermediate product 9-Methylidenefluorene, finally may be decomposed into 1,2-benzenedicarboxylic Acid, 2,6-bis (1,1-dimethylethyl)-4-methyl-phenol, 2-benzenedicarboxic Acid, Dodecanoic Acid and 2,6-bis (1,1-dimethylethyl)-4-methyl-phenol.

Embodiment 5: under condition of pot bacterial strain DXZ9 to p in soil, p '-DDT and p, the degraded of p '-DDE

1) experimental design

30 flowerpots are divided into 6 groups (i.e. 6 processing), 5 every group; In each flowerpot of every group, according to following, establish respectively

Put and be respectively charged into corresponding soils 8kg.

1. natural soils (S): the earth that fetches earth, does not add agricultural chemicals and degradation bacteria strains DXZ9.2. soil+agricultural chemicals (S+D): to differentiate indigenous microorganism to p in soil, p '-DDT and p, the degraded situation of p '-DDE, understands natural degradation situation.3. soil+add agricultural chemicals+degradation bacteria (S+D+B): differentiate and add bacterial strain DXZ9 and indigenous microorganism combined action to p in soil, p '-DDT and p, the degraded situation of p '-DDE, repairs p in soil to understand microorganism, p '-DDT and p, the biological degradation situation of p '-DDE.4. soil+plantation rye grass (S+G): the earth that fetches earth, does not add agricultural chemicals and degradation bacteria strains DXZ9.5. soil+plantation rye grass+agricultural chemicals (S+G+D): to understand kind of the plant in the situation that, p in soil, p '-DDT and p, the degraded situation of p '-DDE.6. soil+plantation rye grass+agricultural chemicals+bacterial strain (S+G+D+B): to understand kind of the plant in the situation that, add bacterial strain DXZ9 and the two combined action of indigenous microorganism to p in soil, p '-DDT and p, the degraded situation of p '-DDE.

Above-mentioned soil treatment is as follows: take certain agricultural land soil veneer of soil after simple pre-treatment, according to conventional fertilizer application method, add 2%(weight ratio) fermentation cow dung; In 80kg crosses the soil of above-mentioned interpolation cow dung of 20 mesh sieves, add 80mL acetone soln, mix rear average mark and pack 10 flowerpots into and process in contrast, every group of 5 basins, every basin 8kg, in order to 1. above-mentioned and 4. group test with soil, use; (p, p '-DDT concentration is 2000 μ gmL in 160kg crosses the soil of above-mentioned interpolation cow dung of 20 mesh sieves, to add the mixed mark acetone soln of DDT and DDE ^-1, p, p '-DDE concentration is 1000 μ gmL ^-1) 160mL, make the starting point concentration of Pesticide Residue in Soil reach preset value, i.e. p, p '-DDT concentration is 2mgkg ^-1, p, p '-DDE concentration is 1mgkg ^-1, the soil of these contaminations is packed in flowerpot, every basin 8kg, totally 20 basins, every group of 5 basins, in order to above-mentioned 2., 3., 5., 6. group test is used with soil.

2) soil inoculation bacterial strain

According to the experimental design of step 1), the flowerpot of corresponding each group is carried out to inoculating strain DXZ9 processing, in the treatment group of inoculating strain DXZ9, every basin adds 200mL bacteria suspension (DXZ9 thalline weight/sterilized water is 1:3(weight ratio)).

3) cultivation rye grass is processed

According to the experimental design plantation rye grass of step 1), the treatment group of plantation rye grass 4. in, every basin is broadcast before ryegrass seed 5.0g(sowing first reserved 100g dry ground, and seed is evenly spread in basin, is then covered with dry ground).Test with basin all in outdoor placement, weather conditions and water aqueous condition and all carry out record every day.Rainstorm weather is moved to flowerpot under the eaves that can take shelter from rain, and common rainwater is placed on outdoor season as usual.

4) collection of soil and pre-treatment

At 2h, 5d, 10d, 30d, 60d, 90d, 150d and 210d, adopt long 25cm respectively, the earth boring auger of internal diameter 1.5cm samples with five point samplings in each flowerpot.By fetched earth earth sample blending, adopt the quartering earth that fetches earth, after sieving, take 1000g pedotheque and put into sample sack, take back after carrying out mark.Then take 20g soil and put into the aluminium box that claimed weight, be placed in 105 ℃ of oven dry of baking oven, measure its water content at once.Adopt denaturing gradient gel electrophoresis technique (DGGE) judgement to add the survival condition of bacterial strain DXZ9 in soil, get respectively the pedotheque gathering for the 10th, 30,90,210 days, take bacterial strain as contrast, the soil that relatively S+D+B and S+G+D+B process.Get respectively the soil research p of 5d, 10d and 210d, p '-DDT and p, p '-DDE genotoxic variation before and after degraded in soil.

5) extraction and cleanup of soil DDT: the residual extraction of Organochlorine Pesticides In Soil adopts soxhlet extraction, and purifying method is selected concentrated sulfuric acid cleanup method, and this purifying method is applicable to soil and biological sample.

By DGGE, test and detect degradation bacteria DXZ9 determine the situation of growing as shown in figure 11 in soil, in pot experiment, utilize DGGE clear and definite bacterial strain DXZ9 in soil, determine the situation of growing.In rye grass and bacterial strain DXZ9 associating repair process, the situation of growing of determining of bacterial strain DXZ9 adopts the band of DGGE electrophoretogram to evaluate, in the processing soil of DXZ9 bacterial strain within 30 days, advantage is more obvious, band is more clear than the target stripe of 210 days, illustrate that bacterial strain DXZ9 can become a kind of of dominant microflora at the initial stage of test, along with the prolongation of time, bacterial strain DXZ9 dominance weakens gradually.In these 210 days of repair process, in soil, the variation tendency of bacterium as shown in figure 12, there is larger variation in educable (living) bacterial number, when the 5th day and the 10th day, between the treatment group of inoculating strain DXZ9 and other treatment group, difference is extremely remarkable, this is because the rapid amount reproduction of inoculating strain DXZ9 is caused, illustrates that inoculating degradation bacteria DXZ9 has survived and amount reproduction in soil the inside.

DDT and the DDE degradation results in soil as shown in figure 13.Research shows under different treatment p in soil, p '-DDT and p, the residual concentration of p '-DDE and DDTs changes widely different, all show as the slower feature of very fast later stage degradation of degrading early stage, evaluate its degradation effect see according to degradation rate, S+G+D+B treatment effect is best, degradation rate to Pesticide Residue in Soil is the highest, p, p '-DDT and p, p '-DDE and DDTs degradation rate are respectively 80.7%, 54.5% and 69%; It is also very good that S+D+B processes, and degradation rate is respectively 77.1%, 52.4% and 65.5%; P, the T1/2 of p '-DDT in S+G+D+B, S+D+B, S+G+D and S+D process is respectively 48.0,58.5,75.5 and 1055 days, p, the T1/2 of p '-DDE in four different treatment is respectively 162.5,229,235 and 745 days, and the T1/2 of DDTs in four different treatment is respectively 71.8,86.5,114.8 and 1095 days.By comparing the degradation half life of different treatment Pesticide Residue in Soil, due to inoculating strain DXZ9, significantly reduced the pesticide concentration in soil.

Inoculation degradation bacteria DXZ9 can significantly reduce the toxicity of DDTs contaminated soil.P in soil, p '-DDT and p, adopt this index of Eisenia foetida coelomocyte DNA damage degree evaluated biological genetoxic before and after p '-DDE degraded, and experimental result is as shown in figure 13.S+D processes earthworm DNA degree of injury maximum, S+G+D+B processes earthworm DNA degree of injury minimum, S+G+D processes earthworm DNA degree of injury is slightly larger than to S+D+B processing, inoculation degradation bacteria strains is described and plants the toxicity that rye grass can significantly reduce pollutant in soil, in conjunction with residual concentration above, find, show p in the processing soil that toxicity is little, p '-DDT and p, p '-DDE residual concentration is also little.In the time of 210 days, S+G+D+B, S+D+B, S+G+D process and compare with S+D, and pollutant in soil has reduced respectively 58.1%, 52%, 36.9% to biological genetoxic, visible, utilize the reparation of plant and microorganism can obviously reduce p, p '-DDT and p, the toxicity of p '-DDE contaminated soil.

In sum, degradation bacteria DXZ9 can accelerate the degraded of DDT and DDE in contaminated soil and breeding in soil fast, can effectively reduce DDT and the genetoxic of DDE in soil.Therefore, DDT and the DDE in application degradation bacteria DXZ9 degraded soil has good application prospect.

Claims (2)

1. a strain preserving number is DDT and the DDE degradation bacteria DXZ9 of CCTCC No:M2013304, it is characterized in that on June 28th, 2013, being preserved in Wuhan, China typical case's culture collection center; Its 16s rDNA sequence is as shown in SEQ ID.NO1.

2. the application of DDT as claimed in claim 1 and DDE degradation bacteria DXZ9 DDT and DDE in degraded soil.

Images