CN103665130A

CN103665130A - Alpha-conotoxin peptide TxIC/Txd1 and medicinal composition and application thereof

Info

Publication number: CN103665130A
Application number: CN201210325531.9A
Authority: CN
Inventors: 罗素兰; 长孙东亭; 胡远艳; 朱晓鹏; 吴勇; J·迈克尔·麦金托什
Original assignee: Hainan University
Current assignee: Hainan University
Priority date: 2012-09-06
Filing date: 2012-09-06
Publication date: 2014-03-26
Anticipated expiration: 2032-09-06
Also published as: CN103665130B

Abstract

The invention belongs to the field of biochemistry and molecular biology, and relates to an alpha-conotoxin peptide TxIC/Txd1 and a medicinal composition and application thereof. The alpha-conotoxin peptide can specifically block an acetyl choline receptor (nAChRs, such as alpha3beta4 nAChR (nicotinic acetylcholine receptor)), has curative activity to habituation, neuralgia, Parkinsonism, dementia, schizophrenia, depression, cancers, fear and the like, and has a good application prospect on the aspect of preparation of smoking cessation, drug treatment and pain relieving medicaments, medicaments relevant to the treatment of mental diseases and cancers, neuroscience tool medicaments and the like.

Description

Alpha-conotoxin peptides TxIC/Txd1, its pharmaceutical composition and purposes

Technical field

The invention belongs to biological chemistry and biology field, relate to alpha-conotoxin peptides TxIC/Txd1, its pharmaceutical composition and purposes.

Background technology

Cone shell (Conus) is the carnivorous mollusk of a class Tropical Ocean of cheek subclass Conidae Conus before Gastropoda, and its venom by venom duct secrete polypeptide class is preyed on and defends.Conotoxin contains 10-46 amino acid conventionally, is rich in disulfide linkage, and biological activity is strong, can act on specifically the receptors and ion cha nnels on animal cell membrane.Especially valtage-gated or ligand-gated ion channel (comprising minority G-albumen associated receptor etc.) are had to higher selectivity.Conotoxin is by the similarity of the endoplasmic reticulum signal peptide sequence of its precursor protein, and halfcystine pattern, be divided into different gene families, so far, all known conotoxins can be divided into 18 superfamilies, be respectively A, C, D, S, M, I1, I2, I3, J, L, O1, O2, O3, P, T, V, Y, K(Kaas Q, Yu R, Jin AH, Dutertre S and Craik DJ.ConoServer:updated content, knowledge, and discovery tools in the conopeptide database.Nucleic Acids Research (2012) [Ahead of print], Ye M, Khoo KK, Xu S, Zhou M, Boonyalai N, Perugini MA, Shao X, Chi C, Galea CA, Wang C & Norton RS (2012) A helical conotoxin from Conus imperialis has a novel cysteine framework and defines a new superfamily.Journal of Biological Chemistry 287,14973-14983).Conotoxin can be divided into the multiple pharmacology such as α, ω, μ, δ family by its acceptor target position.Each superfamily, according to acceptor target type, can be divided into again α, α A, κ A(A-superfamily), ω, δ, κ, μ O(O-superfamily), μ, ψ, KM(M-superfamily) etc. family's (hypotype).

Wherein, alpha-conotoxin is current discovery, best nAChR (nAChRs) the subtype sepcific blocker of selectivity.Alpha-conotoxin and action target spot nAChRs thereof are in the research of various diseases mechanism, and medicament research and development aspect has extremely important value.Alpha-conotoxin is the class conotoxin that people find the earliest, and molecular weight, is generally comprised of 12-19 amino-acid residue conventionally, is rich in disulfide linkage.Alpha-conotoxin is of a great variety, and active various, structural changes is complicated.Signal peptide sequence, pharmacological activity and halfcystine pattern by its high conservative can be classified to alpha-conotoxin.The halfcystine pattern of alpha-conotoxin is CC-C-C, and wherein the disulfide linkage mode of connection of native peptides is C1-C3 and C2-C4, is called spherical isomer (globular isomer), forms 2 loop rings between disulfide linkage.After the alpha-conotoxin linear peptides oxidative folding that contains 4 halfcystines, often produce 3 kinds of isomer, native peptides disulfide linkage mode of connection (spherical isomer) except between C1-C3 and C2-C4, other two kinds of isomer are respectively banded isomer (ribbon isomer) and pearl shape isomer (bead isomer).The disulfide linkage mode of connection of banded isomer is C1-C4 and C2-C3; The disulfide linkage mode of connection of pearl shape isomer is C1-C2 and C3-C4.Spherical isomer has biological activity completely, and banded isomer is also brought into play biological activity by different mechanism of action sometimes, and pearl shape isomer activity often reduces.According to amino acid quantity difference between 23 and 34 halfcystines, alpha-conotoxin can be divided into α 3/5 again; α 4/7; α 4/6; the multiple subfamilies such as α 4/4 and α 4/3; what the feature of each loop and residue formed is not both detoxifying function in the basis of different receptor subtypes (Ulens C; Hogg RC; Celie PH, et al.Structural determinants of selective alpha-conotoxin binding to a nicotinic acetylcholine receptor homolog AChBP[J] .Proc Natl Acad Sci USA 2006; 103:3615 – 20; Gehrmann J; Alewood PF; Craik DJ.Structure determination of the three disulfide bond isomers of alpha-conotoxin GI:a model for the role of disulfide bonds in structural stability.J Mol Biol.1998,278 (2): 401-15; Grishin AA, Wang CI, Muttenthaler M, Alewood PF, Lewis RJ, Adams DJ.Alpha-conotoxin AuIB isomers exhibit distinct inhibitory mechanisms and differential sensitivity to stoichiometry of alpha3beta4 nicotinic acetylcholine receptors.J Biol Chem.2010,285 (29): 22254-63).

NAChR (nAChRs) is the ubiquitous epicyte protein with important physiological action and clinical study meaning of animal kingdom, be the receptoroid that the mankind find the earliest, can be divided into two classes: muscularity acetylcholine receptor and nervous system type acetylcholine receptor.NAChRs is the allosteric membranin on cytolemma, mediates the physiological function of numerous maincenters and peripheral nervous system, comprises study, remembers, replys, analgesia and motion control etc.NAChRs activates the release of the various neurotransmitters such as Dopamine HCL, norepinephrine, serotonin, γ-aminobutyric acid.Confirmed that nAChRs is the crucial target spot of Screening Diagnosis and treatment one large class important diseases medicine, these diseases comprise pain, tobacco and wine and drug addiction, amentia, dementia, schizophrenia, nervus centralis disorder, epilepsy, Parkinson's disease, psychosis, neuromuscular blockade, myasthenia gravis, dysthymia disorders, hypertension, arrhythmia, asthma, of flaccid muscles, apoplexy, mammary cancer and lung cancer etc.So far for above-mentioned disease, also there is no the medicine of symptomatic treatment.Conventional nonselective nAChR agonist is as nicotine, although can alleviate the symptom of above-mentioned sacred disease, they produce strong side effect to heart and gi tract, and have habituation.Therefore; the part medicine that exploitation has highly selective for the various hypotypes of nAChRs is key point (the Livett BG of the above-mentioned disease for the treatment of; Sandall DW; Keays D, Down J, Gayler KR; Satkunanathan N; Khalil Z.Therapeutic applications of conotoxins that target the neuronal nicotinic acetylcholine receptor.Toxicon, 2006,48 (7): 810-829; Taly A, Corringer PJ, Guedin D, Lestage P, Changeux JP.Nicotinic receptors:allosteric transitions and therapeutic targets in the nervous system.Nat Rev Drug Discov.2009,8 (9): 733-50; Layla A, McIntosh JM.Alpha-conotoxins as pharmacological probes of nicotinic acetylcholine receptors[J] .Acta Pharmacol Sin 2009 Jun; 30 (6): 771 – 783.).

Yet the prerequisite that will develop such medicine is, obtain can the various hypotypes of specific combination nAChRs alternative cpd, as instrument medicine, study and identify meticulous composition and the physiological function of various hypotypes, or directly as the medicine of relative disease.

NAChRs is assembled into a variety of hypotypes by different α and β subunit, and every kind of hypotype has distinct pharmacological characteristic.Wherein muscularity acetylcholine receptor consists of 5 subunits, containing 2 α 1 subunits, and 1 β subunit, 1 δ subunit and 1 γ or epsilon subunit, γ or epsilon subunit depend on whether it is the acetylcholine receptor of fetus or adult.Mammalian nervous type nAChRs hypotype than muscularity nAChRs complexity many, have 8 kinds of α subunits, 3 kinds of β subunits at least, be respectively α 2-α 7, α 9, in chick, there is α 8 in α 10() and β 2-β 4.Wherein α 2, and α 3 and α 4 can, respectively with β 2 or β 4 combinations, form functional receptor, such as α 2 β 2, α 3 β 2, α 2 β 4 etc.In addition, α 7 and α 9 can form homology polymer.Due to the highly selective ligand compound lacking for various hypotypes, fine structure and the function that study and illustrate various nAChRs hypotypes face lot of challenges.

According to investigations, ache influence is 1/6 crowd almost, comprises sacroiliitis, neurodynia, swells and ache.Wherein neurodynia affects the crowd of 4-8%, comprises that alcoholism, sciatica, cancer and cancer chemotherapy, diabetes, trigeminal neuralgia, sclerosis, zoster, mechanical injury and operation wound etc. all can cause neurodynia.The nAChRs that contains α 3-subunit, comprises that α 3 β 2 mainly express in peripheral nervous system with α 3 β 4 hypotypes, is the pharmaceutically-active target spot of neurodynia.The alpha-conotoxin of blocking-up α 3 β 2 or α 3 β 4nAChRs demonstrates good analgesic activities on clinical front multiple intractable pain (chronic pain) model, and habituation not.Intractable pain is a global health problem, is badly in need of new medicine emerge (Napier, I.A.; Klimis, H.; Rycroft, B.K.; Jin, A.H.; Alewood, P.F.; Motin, L.; Adams, D.J.; Christie; M.J.; Intrathecal α-conotoxins Vc1.1; AuIB and MII acting on distinct nicotinic receptor subtypes reverse signs of neuropathic pain.Neuropharmacology 2012; 62 (7); 2202-2207.Blyth, F.M.; March, L.M.; Brnabic, A.J.; Jorm, L.R.; Williamson, M.; Cousins, M.J., Chronic pain in Australia:a prevalence study.PAIN 2001,89 (2-3), 127-34.Cousins, M.J.; Brennan, F.; Carr, D.B., Pain relief:a universal human right.PAIN 2004,112 (1-2), 1-4.Eisenberg, E.; McNicol, E.D.; Carr, D.B., Efficacy and safety of opioid agonists in the treatment of neuropathic pain of nonmalignant origin:systematic review and meta-analysis of randomized controlled trials.JAMA:the journal of the American Medical Association 2005,293 (24), 3043-52.).

Drug habit be a medical difficult problem be also serious social concern.Craving for tobacco is that the nicotine (Nicotine) in tobacco causes; its body inner recipient is exactly nAChR (nAChRs) (Azam L, McIntosh JM.Alpha-conotoxins as pharmacological probes of nicotinic acetylcholine receptors.Acta Pharmacol Sin.2009; 30 (6): 771-783).Recently research shows, the nAChRs that blocking-up contains α 3 β 4 can effectively prevent craving for tobacco, the outbreak of M&C drug addiction, significantly suppress desire (the Brunzell DH of smoking and drug abuse, Boschen KE, Hendrick ES, Beardsley PM, McIntosh JM.Alpha-conotoxin MII-sensitive nicotinic acetylcholine receptors in the nucleus accumbens shell regulate progressive ratio responding maintained by nicotine, Neuropsychopharmacology, 2010, 35 (3): 665-73).

Research shows, expressing at the neuronic nAChRs of dopaminergic (DA) is treatment neuropsychiatric disease, as drug target (Larsson, the A. of the habituation of nicotine, morphine and Cocaine etc., Parkinson's disease, dementia, schizophrenia, depression etc.; Jerlhag, E.; Svensson, L.; Soderpalm, B.; Engel, J.A., Is an alpha-conotoxin MII-sensitive mechanism involved in the neurochemical; stimulatory, and rewarding effects of ethanol? Alcohol 2004,34 (2-3); 239-50.Jerlhag, E.; Egecioglu, E.; Dickson, S.L.; Svensson, L.; Engel, J.A., Alpha-conotoxin MII-sensitive nicotinic acetylcholine receptors are involved in mediating the ghrelin-induced locomotor stimulation and dopamine overflow in nucleus accumbens.European neuropsychopharmacology, 2008,18 (7), 508-18).

α 3 β 4nAChR are main acetylcholine receptor subtypes in nervous center sensation and self-discipline.α 3 β 4nAChRs are also the neuronic branches of central nervous system (CNS), for example to habenula, the back marrow of maincenter extension, relate to habituation (Millar, the N.S. of nicotine and other Drug abuse; Gotti, C., Diversity of vertebrate nicotinic acetylcholine receptors.Neuropharmacology 2009,56 (1), 237-46; Tapper, A.R.; McKinney, S.L.; Nashmi, R.; Schwarz, J.; Deshpande, P.; Labarca, C.; Whiteaker, P.; Marks, M.J.; Collins, A.C.; Lester, H.A., Nicotine activation of alpha4* receptors:sufficient for reward, tolerance, and sensitization.Science 2004,306 (5698), 1029-32.).α 3 β 4nAChR relate to maincenter edge Dopamine HCL approach, and the reward effect producing for certain material of abuse (as drugs) plays very important effect.And in the mouse knocking out at β 4 subunits, motion and reward effect that nicotine causes significantly reduce, this means the vital role (24 Salas, 2004) of α 3 β 4nAChR nicotine habituation in CNS.α 3 β 4 nAChR also play a part very important in fear reaction, for the release most important (Zhu, the P.J. that regulate L-glutamic acid and norepinephrine; Stewart, R.R.; McIntosh, J.M.; Weight; F.F.; Activation of nicotinic acetylcholine receptors increases the frequency of spontaneous GABAergic IPSCs in rat basolateral amygdala neurons.Journal of neurophysiology 2005; 94 (5); 3081-91.Alkondon, M.; Albuquerque; E.X., A non-alpha7 nicotinic acetylcholine receptor modulates excitatory input to hippocampal CA1 interneurons.Journal of neurophysiology2002,87 (3); 1651-4.Luo, S.; Kulak, J.M.; Cartier, G.E.; Jacobsen, R.B.; Yoshikami, D.; Olivera, B.M.; McIntosh; J.M.; alpha-conotoxin AuIB selectively blocks alpha3 beta4 nicotinic acetylcholine receptors and nicotine-evoked norepinephrine release.The Journal of neuroscience:the official journal of the Society for Neuroscience 1998; 18 (21); 8571-9.Kulak, J.M.; McIntosh, J.M.; Yoshikami, D.; Olivera, B.M., Nicotine-evoked transmitter release from synaptosomes:functional association of specific presynaptic acetylcholine receptors and voltage-gated calcium channels.Journal of neurochemistry 2001,77 (6), 1581-9.).

Visible, alpha-conotoxin is in pain, smoking cessation, drug rehabilitation, the research and development field of the new drugs such as treatment Parkinson's disease, dementia, depression and schizophrenia has huge potentiality, the original new drug listing of habituation is also badly in need for the treatment of in market, disease loss and the serious social concern to alleviate smoking drug abuse etc., brought.At present, need the nAChRs blocker of finding new high specific badly.

Summary of the invention

The inventor is through deep research and creatively work, found a new alpha-conotoxin peptides, it is blockage of acetylcholine receptor specifically, particularly dependence producing drug target spot α 3 β 4nAChR are had to selectivity and block by force activity, have in preparation smoking cessation drug rehabilitation, analgesic, relevant depression, dementia, schizophrenia, parkinsonism etc., and the applications well prospect of the aspect such as neuroscience instrument medicine.Following invention is provided thus:

One aspect of the present invention relates to a peptide species, its for or comprise and be selected from the aminoacid sequence described in any one in following (1) to (3):

(1) aminoacid sequence shown in SEQ ID NO:5-7 or SEQ ID NO:9;

(2) with the aminoacid sequence at least 80% described in above-mentioned (1), preferred at least 85%, more preferably at least 90%, especially preferably at least 95%, most preferably at least 97% identical aminoacid sequence; Or

(3) by 1-5, preferably 1-3, more preferably 1-2, most preferably 1 amino-acid residue replacement, disappearance, insertion and/or interpolation and with the different aminoacid sequence of sequence shown in above-mentioned (1) or (2).

For one object of the present invention, same degree between two or more aminoacid sequences is by BLAST2.0 queries of protein databases program (Aaltschul etc., 1997, nucleic acids research 25:3389-3402) and adopt following parameters to determine: blastall p blastp-a4-e10-E0-v500-b250-I[inquires about document]-d prot_all, wherein-p refers to program name,-a refers to the server count that will use,-e refers to expected value,-E refers to extend the cost of breach,-v refers to single line description (one-line description) number,-b refers to the ratio logarithm that will show,-I refers to inquire about document,-d refers to the database for inquiring about.

In the aminoacid sequence of homeopeptide and SEQ ID NO:5-7 or SEQ ID NO:9, arbitrary aminoacid sequence difference may be to replace, insert, add and/or lacked 1 or a plurality of, preferred 1-5, more preferably 1-3, especially preferably 1-2,1 amino-acid residue most preferably.Preferably, amino acid change is that character changes less variation, be can remarkably influenced protein folding and/or active conservative amino acid replace; Small segment disappearance, normally 1 to about 5, preferably 1-3, more preferably 1 amino acid whose disappearance; Little amino or C-terminal extend, as the methionine residues of aminoterminal interpolation; There is the little connection peptides that reaches about 20-25 residue; Maybe can contribute to the little extension of purifying as poly Histidine fragment, epitope or land by changing net charge or other function.

The example that conservative property replaces is the replacement of carrying out in basic aminoacids (arginine, Methionin and Histidine), acidic amino acid (L-glutamic acid and aspartic acid), polare Aminosaeren (glutamine and l-asparagine), hydrophobic amino acid (leucine, Isoleucine and α-amino-isovaleric acid), die aromatischen Aminosaeuren (phenylalanine, tryptophane and tyrosine) and p1 amino acid (glycine, L-Ala, Serine, Threonine and methionine(Met)).The aminoacid replacement that conventionally can not change specific activity is known in the art, and by for example H.Neurath and R.L.Hill, 1979, at < < protein G reatT.GreaT.GT > mono-book, Academic Press, described in New York.Modal replacement is Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu, Asp/Gly and the replacement that is reversed.Therefore, the invention still further relates to the polypeptide that above-mentioned amino acid substitution obtains.

N-end and/or C-terminal that the present invention is also included in alpha-conotoxin peptides of the present invention have merged the fusion polypeptide of other peptide/polypeptide or the fusion polypeptide of cleavable.The technology that produces fusion polypeptide is known in the art, comprise and connect the encoding sequence of code book invention peptide and the encoding sequence of described other the peptide/polypeptide of coding, make them in same frame, and the expression of fusion polypeptide is controlled by identical promotor and terminator.

Polypeptide according to the present invention described in any one, wherein, first halfcystine of the N-terminal of described polypeptide and the 3rd halfcystine form disulfide linkage, and second halfcystine and the 4th halfcystine formation disulfide linkage; Or first halfcystine of the N-terminal of described polypeptide and the 4th halfcystine formation disulfide linkage, and second halfcystine and the 3rd halfcystine formation disulfide linkage; Or first halfcystine of the N-terminal of described polypeptide and second halfcystine formation disulfide linkage, and the 3rd halfcystine and the 4th halfcystine formation disulfide linkage; Particularly, the C-terminal of described polypeptide is amidated.

Aforementioned polypeptides of the present invention is conotoxin peptide; Particularly, be alpha-conotoxin peptides.

The Conus textile (Conus textile) that above-mentioned conotoxin peptide can produce from China Hainan, extract.Also can chemosynthesis amino acid sequence (for example method in reference example 2); Or by the means of gene recombination, express its Nucleotide (preparing reference example 1 or directly carrying out the synthetic of polypeptide according to the method in embodiment 2 of nucleotide sequence), obtain polypeptide.Also can be with reference to method below:

Another aspect of the present invention relates to the preparation method of the polypeptide described in any one of the present invention, comprises the steps:

1), on ABI Prism 433a Peptide synthesizer or manual method synthesizing linear polypeptide, the amino acid whose Side chain protective group of Fmoc is: Pmc (Arg), Trt (Cys), But (Thr, Ser, Tyr), OBut (Asp), Boc (Lys); Trt or Acm blocking group for halfcystine, between corresponding halfcystine, fixed point forms disulfide linkage respectively;

2) linear polypeptide obtaining in step 1) is cut down from resin, and with ice ether sedimentation and washing and recycling linear polypeptide crude product, with preparative reverse hplc C18 post (Vydac) purifying;

3) by step 2) in the product that obtains to carry out two-step oxidation folding.

Of the present inventionly relate in one aspect to again a kind of polynucleotide, the aminoacid sequence of polypeptide described in its code book invention any one.

Polynucleotide according to the present invention described in any one, its for or comprise and be selected from the nucleotide sequence described in any one in following (1) to (3):

(1) nucleotide sequence shown in SEQ ID NO:1-4 or SEQ ID NO:8 or SEQ ID NO:10;

(2) complementary sequence of nucleotide sequence in above-mentioned (1);

(3) under rigorous condition can with the nucleotide sequence of nucleotide sequence hybridization described in above-mentioned (1).

About the hybridization between polynucleotide, there is in the prior art numerous documents can be for reference, comprise such as Sambrook etc., molecular cloning laboratory manual, second edition, cold spring harbor laboratory, cold spring port, 1989.In hybridization, can apply the rigorous condition of various degree, for example moderate, moderate-highly, or highly rigorous condition.More rigorous condition, the complementary degree that forms duplex requirement is higher.Can pass through temperature, concentration and probe concentration, probe length, ionic strength, time etc. and control rigorous degree.For double-stranded DNA gene probe, hybridize in lower than DNA heterozygote melting temperature (Tm) [melting temperature, Tm]) in 6X SSPE, 5XDenhardtShi solution, 0.1%SDS, 0.1mg/ml denatured DNA, spend the night at 20-25 ℃.Clean and conventionally to carry out as follows: in Tm-20 ℃ in 0.2X SSPE, 0.1%SDS one time 15 minutes (the rigorous condition of moderate is cleaned).

Of the present inventionly relate in one aspect to a kind of nucleic acid construct, it comprises the polynucleotide described in any one of the present invention again.

Of the present inventionly relate in one aspect to a kind of expression vector, it comprises the nucleic acid construct described in any one of the present invention again.

The cell that relates in one aspect to again a kind of conversion of the present invention, it comprises the expression vector described in any one of the present invention.

Of the present inventionly relate in one aspect to a kind of fusion rotein, it comprises the polypeptide described in any one of the present invention again.

Of the present inventionly relate in one aspect to a kind of pharmaceutical composition, it comprises the polypeptide described in any one of the present invention, and/or comprises fusion rotein of the present invention again; Alternatively, it also comprises pharmaceutically acceptable carrier or auxiliary material.

A kind of method that relates in one aspect to again blockage of acetylcholine receptor of the present invention, comprises polypeptide described in any one of the present invention of using significant quantity or the step of fusion rotein; Particularly, described acetylcholine receptor is α 3 β 4 acetylcholine receptors.

Of the present inventionly relate in one aspect to a kind of method of screening acetylcholine receptor inhibitor or definite acetylcholine receptor subtypes, the method comprises again: by the step in the situation that there is and do not exist candidate compound existence, acetylcholine receptor being contacted with polypeptide described in any one of the present invention or fusion rotein; Particularly, described acetylcholine receptor is α 3 β 4 acetylcholine receptors.When alpha-conotoxin TxIC/Txd1 can specific blockage α 3 β 4 acetylcholine receptor, infer that this acetylcholine receptor is the acetylcholine receptor of α 3 β 4 hypotypes.

Polypeptide described in any one of the present invention or the fusion rotein of relating in one aspect to again of the present invention is for the purposes of blockage of acetylcholine receptor; Particularly, described acetylcholine receptor is α 3 β 4 acetylcholine receptors.

Polypeptide or the fusion rotein relating in one aspect to again described in any one of the present invention of the present invention prepared the medicine of blockage of acetylcholine receptor or the purposes in reagent; Particularly, described acetylcholine receptor is α 3 β 4 acetylcholine receptors.

Polypeptide described in any one of the present invention or the fusion rotein of relating in one aspect to again of the present invention be at preparation treatment or prevention nervous system disorders such as habituation, neurodynia, parkinsonism or dull-witted etc. medicine, or for the preparation of the purposes of the medicine of kill pests, analgesia, smoking cessation or drug rehabilitation, particularly, described neurodynia is caused by following reason: cancer and cancer chemotherapy, alcoholism, sciatica, diabetes, trigeminal neuralgia, sclerosis, zoster, mechanical injury and operation wound, acquired immune deficiency syndrome (AIDS), head nerves paralysis, drug intoxication, industrial pollution is poisoning, lymph neurodynia, myelomatosis, multiple spot motorius pain, chronic congenital sensory neuropathy, acute violent idiopathic neuralgia, extruding neurodynia, vasculitis, vasculitis, local asphyxia, uremia, children's bile hepatic diseases, chronic respiratory obstacle, composite nerve pain, multiple organ failure, sepsis/pyemia, hepatitis, porphyria, vitamin deficiency, Chronic Liver popular name for, primary bile sclerosis, hyperlipidemia, leprosy, Lyme arthritis, sensory nerve bundle film is scorching, allergy etc.

Of the present inventionly relate in one aspect to again a kind of for example pain of nervous system disorders that treats and/or prevents, tobacco and wine and drug addiction, amentia, dull-witted, schizophrenia, nervus centralis is disorderly, epilepsy, Parkinson's disease, psychosis, neuromuscular blockade, myasthenia gravis, dysthymia disorders, hypertension, arrhythmia, asthma, of flaccid muscles, apoplexy, the method of mammary cancer and lung cancer etc., or a kind of kill pests, analgesia, smoking cessation, or the method for drug rehabilitation, comprise and give the polypeptide of the present invention (conotoxin peptide or its propetide) of significant quantity or the step of fusion rotein or pharmaceutical composition of the present invention, particularly, described habituation can cause addicted material by nicotine, morphine, Cocaine, alcohol etc., described neurodynia is caused by following reason: cancer and cancer chemotherapy, alcoholism, sciatica, diabetes, trigeminal neuralgia, sclerosis, zoster, mechanical injury and operation wound, acquired immune deficiency syndrome (AIDS), head nerves paralysis, drug intoxication, industrial pollution is poisoning, lymph neurodynia, myelomatosis, multiple spot motorius pain, chronic congenital sensory neuropathy, acute violent idiopathic neuralgia, extruding neurodynia, vasculitis, vasculitis, local asphyxia, uremia, children's bile hepatic diseases, chronic respiratory obstacle, composite nerve pain, multiple organ failure, sepsis/pyemia, hepatitis, porphyria, vitamin deficiency, Chronic Liver popular name for, primary bile sclerosis, hyperlipidemia, leprosy, Lyme arthritis, sensory nerve bundle film is scorching, allergy etc.

Conotoxin peptide of the present invention can, by playing a role in conjunction with α 3 β 4 acetylcholine receptors (nAChR), have the habituation of withdrawal and analgesic active.Can be applicable to the nervous system disorderss such as research, diagnosis and treatment habituation, neurodynia, Parkinson's disease, dementia, schizophrenia, depression and as useful molecular probe for aspects such as researchs.Different α-CTX is different to the affinity of vertebrates acceptor, sometimes differs several orders of magnitude.Difference between this germline makes α-CTX can be used as useful probe for studying the germline generation of vertebrates nAChR, can be used as the different subtype that molecular probe is determined nAchR.They are drug candidate, lead drug and the medicine of new drug development.

Provided the explanation of the term the present invention relates to below.

Habituation (addiction)

Polypeptide of the present invention relates to can treat the various habituation that have dependency material to cause.Habituation refers to that Reusability psychoactive drug substance person is in periodicity or chronic poisoning state.Psychoactive drug substance refer to Nicotine, opium, heroine, methyl amphetamine (methamphetamine), morphine, hemp, Cocaine and national regulation control other can make the narcotics of humanoid one-tenth addiction and psychotropic substances etc.Habituation is relevant with a large amount of Dopamine HCLs (Dopamine) that produce in brain.Show as can not contain apply preference material and be difficult to self-control or be difficult to correct usage behavior, for obtaining psychoactive drug substance, reach the object of feeling good or avoiding giving up misery, can be by fair means or foul.Typical case is that tolerance increases, and has no progeny and often occur Withrawal symptom in material is used.Addict's life may completely be used and be dominated by material, thereby has a strong impact on, and has even abandoned other key activitiess and all responsibilities.Therefore, individual had both been given in material use, also to society, brought infringement.When using for alcohol, be equal to the concept of chronic alcoholism.The content of body and psychological two aspects also contained in habituation one word.Psychology habituation is emphasized the impaired experience of autocontrol force to drinking, taking medicine, and body habituation refers to tolerance and Withrawal symptom.

Neurodynia

Polypeptide of the present invention relates to the various neuralgic purposes for the treatment of.Neurodynia is around or the pain that causes of former of central nervous system or secondary lesion or dysfunction or of short duration disorder, shows as spontaneous pain, allodynia, hyperpathia etc.A lot of diseases all can cause neurodynia, comprise cancer and cancer chemotherapy, alcoholism, sciatica, diabetes, trigeminal neuralgia, sclerosis, zoster, mechanical injury and operation wound, acquired immune deficiency syndrome (AIDS), head nerves paralysis, drug intoxication, industrial pollution is poisoning, lymph neurodynia, myelomatosis, multiple spot motorius pain, chronic congenital sensory neuropathy, acute violent idiopathic neuralgia, extruding neurodynia, vasculitis (vasculitis)/local asphyxia, uremia, children's bile hepatic diseases, chronic respiratory obstacle, composite nerve pain, multiple organ failure, sepsis/pyemia, hepatitis, porphyria, vitamin deficiency, Chronic Liver popular name for, primary bile sclerosis, hyperlipidemia, leprosy, Lyme arthritis, sensory nerve bundle film is scorching, allergy etc.

Nucleic acid construct

The invention still further relates to the nucleic acid construct of 1 or a plurality of regulating and controlling sequences that comprise nucleotide sequence of the present invention and be operatively connected with it, described regulating and controlling sequence can instruct encoding sequence to express in suitable host cell under its consistency condition.Expression be understood to include polypeptide produce in related any step, include, but are not limited to transcribe, post transcriptional modificaiton, translation, posttranslational modification and secretion.

" nucleic acid construct " is defined as strand or double chain acid molecule in the text, and their separation are from natural gene, or modified and contain in non-natural mode and combine and nucleic acid fragment arranged side by side.When nucleic acid construct comprises while expressing the essential all regulating and controlling sequences of encoding sequence of the present invention, term nucleic acid construct and expression cassette synonym.Term " encoding sequence " is defined as the part of directly determining the aminoacid sequence of its protein product in nucleotide sequence in the text.The border of encoding sequence is normally determined by the ribosome bind site (for prokaryotic cell prokaryocyte) of next-door neighbour mRNA 5 ' end opening code-reading frame upstream and the transcription termination sequence in next-door neighbour mRNA 3 ' end opening code-reading frame downstream.Encoding sequence can include, but are not limited to DNA, cDNA and recombinant nucleic acid sequence.

The separated nucleotide sequence of operate coding peptide of the present invention, makes it express described peptide in many ways.May expect or must before insertion vector, to nucleotide sequence, process, this depends on expression vector.The technology of application recombinant DNA method modification of nucleic acids sequence is known in the art.

Herein term " regulating and controlling sequence " be defined as comprise express peptide of the present invention institute must or favourable all components.Each regulating and controlling sequence can be natural that contain or external for the nucleotide sequence of coded polypeptide.These regulating and controlling sequences include, but not limited to leader sequence, Polyadenylation sequence, propeptide sequence, promotor, signal sequence and transcription terminator.Bottom line, regulating and controlling sequence will comprise promotor and the termination signal of transcribing and translating.In order to import specific restriction site, to regulating and controlling sequence is connected with the coding region of the nucleotide sequence of coded polypeptide, can provide the regulating and controlling sequence of belt lacing.Term " is operatively connected " and is defined as in the text a kind of like this conformation, and wherein regulating and controlling sequence is positioned at the appropriate location of the encoding sequence of relative DNA sequence dna, so that regulating and controlling sequence instructs the expression of polypeptide.

Regulating and controlling sequence can be suitable promoter sequence, can be expressed the nucleotide sequence of the host cell identification of nucleotide sequence.Promoter sequence contains the transcription regulating nucleotide sequence that mediates expression of polypeptides.Promotor can be any nucleotide sequence that has transcriptional activity in selected host cell, comprises sudden change, brachymemma and promotor heterozygosis, can obtain the gene of polypeptide in the outer or born of the same parents of the born of the same parents of own coding and host cell homology or allos.

Regulating and controlling sequence can also be suitable transcription termination sequence, thereby can be identified one section of sequence that termination is transcribed by host cell.Terminator sequence is operatively connected the 3 ' end at the nucleotide sequence of coded polypeptide.Any terminator that can bring into play function in selected host cell may be used to the present invention.

Regulating and controlling sequence can also be suitable leader sequence, i.e. the mRNA non-translational region very important to the translation of host cell.Leader sequence is operatively connected the 5 ' end in the nucleotide sequence of coded polypeptide.Any leader sequence that can bring into play function in selected host cell all can be used for the present invention.

Regulating and controlling sequence can also be signal peptide coding region, and encoding one section and be connected in the N-terminal aminoacid sequence of polypeptide in this district, can guide coded polypeptide to enter emiocytosis approach.5 ' the end in nucleic acid sequence encoding district may be natural contain translation frame as one man with the signal peptide coding region of the coding region fragment Nature Link of secrete polypeptide.Or it is external signal peptide coding region that 5 ' end of coding region can contain encoding sequence.When encoding sequence does not contain signal peptide coding region under normal circumstances, may need to add extraneous signal peptide-coding region.Or, can replace simply natural signal peptide coding region to strengthen polypeptide secretion with external signal peptide coding region.But the signal peptide coding region that the polypeptide after any energy guiding is expressed enters the Secretory Pathway of host cell used may be used to the present invention.

The all right Shi Tai original encoding of regulating and controlling sequence district, this district's coding is positioned at the aminoterminal one section of aminoacid sequence of polypeptide.Gained polypeptide is called as proenzyme or propolypeptide.Propolypeptide does not have activity conventionally, can be by catalysis or self-catalysis and be converted into ripe active polypeptide from propolypeptide cutting peptide is former.

When the N-terminal of polypeptide has signal peptide You Youtaiyuan district, the N-terminal of Tai Yuan district next-door neighbour polypeptide, signal peptide district is close to the N-terminal in Tai Yuan district.

Interpolation can regulate the regulating and controlling sequence of expression of polypeptides also to need according to the growing state of host cell.The example of regulator control system is that those can be reacted to chemistry or physical stimulation thing (being included in the situation of regulating compound), thereby opens or close the system of genetic expression.Other examples of regulating and controlling sequence are those regulating and controlling sequences that can make gene amplification.In these examples, together with the nucleotide sequence of coded polypeptide should being operatively connected with regulating and controlling sequence.

Expression vector

The invention still further relates to and comprise nucleotide sequence of the present invention, promotor and transcribe and the recombinant expression vector of translation termination signal.Above-mentioned various nucleic acid and regulating and controlling sequence can be linked together to prepare recombinant expression vector, this carrier can comprise 1 or a plurality of restriction site easily, to insert or replace the nucleotide sequence of coded polypeptide in these sites.Or, can express nucleotide sequence of the present invention by nucleotide sequence or the nucleic acid construct that comprises this sequence are inserted to suitable expression vector.While preparing expression vector, can make encoding sequence be arranged in carrier to be operatively connected with suitable expression regulation sequence.

Recombinant expression vector can be any carrier (for example plasmid or virus) of being convenient to carry out recombinant DNA operation express nucleic acid sequence.The consistency of the host cell that carrier and it will import is depended in the selection of carrier conventionally.Carrier can be linearity or closed loop plasmid.

Carrier can be self-replicating type carrier (be present in extrachromosomal complete structure, can be independent of karyomit(e) and copy), for example plasmid, extra-chromosomal element, minute chromosome or artificial chromosome.Carrier can comprise any mechanism that guarantees self-replacation.Or, carrier be one when importing host cell, by be incorporated in genome and with the carrier copying together be incorporated into karyomit(e).In addition, can apply single carrier or plasmid, or totally comprise and will import two or more carriers or the plasmid of all DNA of host cell gene group, or transposon.

Preferred carrier of the present invention contains 1 or a plurality of selective marker of being convenient to select transformant.Selective marker is such gene, and its product is given the resistance, the resistance to heavy metal to biocide or virus, or gives auxotroph prototroph etc.The example of bacterium selective marker is as the dal gene of subtilis or Bacillus licheniformis, or microbiotic is as the resistance marker of penbritin, kantlex, paraxin or tsiklomitsin.

Preferred carrier of the present invention comprises can make carrier stable integration in host cell gene group, or guarantees carrier to be independent of cellular genome in cell and carry out the element of self-replicating.

With regard to carrying out the situation of self-replicating, carrier can also comprise replication orgin, and carrier can independently be copied in target host cell.Replication orgin can be with making its sudden change that becomes responsive to temperature type in host cell (referring to for example, fEhrlich, 1978, the journal 75:1433 of NAS).

The nucleotide sequence of the present invention that can insert 1 above copy to host cell is to improve the output of this gene product.The gene copy number increase of this nucleotide sequence can pass through at least 1 additional copies Insertion Into Host Cell genome of this sequence, or insert a selective marker that can increase together with this nucleotide sequence, by having suitable selective reagents exist under culturing cell, thereby pick out the cell that selected marker that containing amplification copy is contained additional copies nucleotide sequence.

For connect operation that above-mentioned each element builds recombinant expression vector of the present invention be well-known to those skilled in the art (referring to such as Sambrook etc., molecular cloning laboratory manual, second edition, press of cold spring harbor laboratory, cold spring port, New York, 1989).

Host cell

The invention still further relates to the recombinant host cell that comprises the nucleotide sequence of the present invention that can be used to recombinant production polypeptide.The carrier of the nucleotide sequence that comprises the present invention can be imported to host cell, thereby this carrier is maintained with the outer carrier format of karyomit(e) of above-mentioned chromosomal integration body or self-replacation.Any offspring different from parental cell due to the sudden change occurring between replicative phase contained in term " host cell ".Peptide coding gene and source thereof are depended in the selection of host cell to a great extent.

Host cell can be prokaryotic cell prokaryocyte or eukaryotic cell, for example bacterium or yeast cell.Can carrier be imported to host cell by technology well known to those skilled in the art.

Preparation method

The invention still further relates to restructuring and prepare the method for peptide of the present invention, the method comprises: (a) be suitable for producing under the condition of described peptide, cultivating the host cell that contains nucleic acid construct, the nucleotide sequence that this nucleic acid construct comprises coding for said peptides; (b) reclaim this peptide.

In preparation method of the present invention, culturing cell in the nutritional medium producing at suitable polypeptide by means known in the art.For example; can be in suitable substratum; allowing under expression of polypeptides and/or separated condition, by shake-flask culture, laboratory or industrial fermentation tank middle and small scale or large scale fermentation (comprise continuously, in batches, batch charging or solid state fermentation), carrying out culturing cell.In comprising the suitable substratum of carbon and nitrogenous source and inorganic salt, adopt step known in the art to cultivate.Suitable substratum Ke You supplier provides or can for example, with reference to disclosed composition (, described in the catalogue of American type culture collection), prepare.If polypeptide is secreted in substratum, can directly from substratum, reclaim polypeptide.If polypeptide is not secreted, can from cell lysate, reclaim.

Can reclaim the polypeptide producing by means known in the art.For example, can from substratum, reclaim polypeptide by routine operation (include, but are not limited to that centrifugal, filtration, extracting, spraying are dry, evaporation or precipitation).

Can carry out purifying polypeptide of the present invention by various operations known in the art, these operations comprise, but (be for example not limited to chromatography, ion exchange chromatography, affinity chromatography, hydrophobic interaction chromatography, chromatofocusing and size exclusion chromatography), HPLC, electrophoresis (for example, the isoelectric focusing of preparation property), differential solubleness (for example ammonium sulfate precipitation), SDS-PAGE or extracting is (referring to for example, protein purification, J.C.Janson and Lars Ryden compile, VCHPublishers, New York, 1989).

Transgenic animals and plants

The invention still further relates to the animal or plant cell that has transformed nucleotide sequence of the present invention, the vegetable cells such as preferably wheat, corn, give and are converted the new proterties of host (as insect-resistance).This can be by technology well known to those skilled in the art, with construct transformed animal disclosed herein or vegetable cell and realize.

Method and formulation for Control pests

Can, by the several different methods those skilled in the art will know that, with conotoxin peptide of the present invention or polynucleotide, realize Control pests.These methods comprise for example recombinant microorganism is applied to insect (or their location) and with coding conotoxin peptide of the present invention gene-transformed plant.Conversion can be used routine techniques to carry out by those skilled in the art.Disclosed herein is the necessary material for these conversions, or those skilled in the art can be easy to obtain by other method.

Can be by the formulation application of the recombinant microorganism that contains conotoxin peptide or comprise polynucleotide of the present invention of preparation in soil.Can also cover using the product of preparation as seed material or root processing or the whole plant in late period in plant growth cycle and process application.Preparation can comprise diffusion-thickening adjuvant, stablizer, other insecticidal additive or tensio-active agent.Liquid preparation can be based on water water or non-, and uses with foam, gel, suspension, emulsifiable concentrate etc. form.Composition can comprise rheological agent, tensio-active agent, emulsifying agent, dispersion agent or polymkeric substance.

It will be understood by those skilled in the art that insecticide concentration extensively changes the person's character due to special preparation, particularly can be used as enriched material or directly use.Sterilant will be with 1%(weighing scale at least) exist, and may be 100%(weighing scale).Drying agent has about 1-95%(weighing scale conventionally) sterilant, and liquid preparation will be normally the about 1-60% of solid weight in liquid phase.The preparation that contains cell will contain about 104 the cell/mg of about 102-conventionally.These preparations are by with the about 50mg(liquid of per hectare or dry)-1kg or more amount used.By spraying, spread, spilling etc., can be by formulation application for example, in insect environment, soil and plant.

Pharmaceutical composition

The invention still further relates to the pharmaceutical composition that contains peptide of the present invention and pharmaceutical acceptable carrier and/or vehicle.Described pharmaceutical composition can be used for research, diagnosis, alleviation or treatment disease or the illness relevant with habituation, neurodynia, amentia, pain, parkinsonism, psychosis, depression, myasthenia gravis, cancer etc.In one embodiment, the pharmaceutical composition that contains the peptide of the present invention for the treatment of significant quantity is beneficial to medicinal mode and prepares and administration, and need consider individual patient clinical condition, transport site, medication, administration schedule and the known other factors of doctor.Therefore for " significant quantity " of this paper object, the consideration by these aspects determines.

Containing administration in the pharmaceutical composition parenterai administration of the polypeptide of the present invention for the treatment of significant quantity, oral, brain pond, intrathecal drug delivery etc." pharmaceutical acceptable carrier " refers to the formula subsidiary of nontoxic solid, semisolid or liquid filler material, diluent, capsule material or any type.The administering mode that term used herein " parenteral " represents comprises intravenously, intramuscular, intraperitoneal, breastbone is interior, subcutaneous, sheath interior and intra-articular injection and infusion.Polypeptide of the present invention also can pass through slow-released system administration rightly.

The invention still further relates to the pharmaceutical composition of specific blockage nAChRs.

Can apply conotoxin peptide of the present invention occurs for zoologizeing the germline of nAChR as useful probe; As molecular probe, determine the different subtype of nAChR; As molecular model, design new drug; As studying, diagnose nervous system disease as instrument medicine and the medicine of habituation, Parkinson's disease, action obstacle, schizophrenia etc.; The candidate medicine for the treatment of mammary cancer, lung cancer, small cell lung cancer etc.As polypeptide sterilant, be developed as novel biopesticide etc.

The beneficial effect of the invention

The present invention has obtained a kind of Novel alpha 4/6-conotoxin (called after α-CTX TxIC), it is the strong blocker of α 3 β 4nAChR, also be the strongest α 3 β 4nAChR blockers of finding up to now, it also has certain blocking effect to α 6/ α 3 β 4nAChR, α 2 β 4nAChR is had to extremely weak blocking-up active.α-CTX TxIC is the new tool of α 3 β 4nAChR structures and functional study, and contributes to exploitation for relevant medicines such as habituation, pain, fears.

Alpha-conotoxin peptides of the present invention is blockage of acetylcholine receptor (nAChRs) specifically, and has the habituation of withdrawal and analgesic activities and the effect for the treatment of the diseases such as parkinsonism, dementia, schizophrenia, depression, fear.

Accompanying drawing explanation

Fig. 1: the mature peptide that the propetide that alpha-conotoxin TxIC/Txd1(TxIC) propetide gene order and coding thereof produce and posttranslational modification produce.Arrow indication is the Processing position of posttranslational modification.The protease hydrolysis Processing position 1(processing site 1 inferring) after basic amino acids arginine (R); C-terminal amidation Processing position is in the position of the glycine of arrow indication, with character shading, represent, it is first glycine residue Processing position of amidation posttranslational modification often of the processing site adjacent halfcystine of 2. mature peptide C-terminal (Cys), from processing site 2, carry out mature peptide called after TxIC/Txd1(or the TxIC of amidation generation), sequence is: GCCSHPVCSAMSPIC# (# represents C-terminal amidation).Propetide district represents with italics, and mature peptide represents with underscore, and boldface type shows for halfcystine wherein (C), and terminator codon represents with *.

That Fig. 2: A shows is mature peptide α-TxIC/Txd1(SEQ ID NO:7) sequence and disulfide linkage mode of connection I-III thereof, II-IV.What B showed is to contain I-III, the HPLC color atlas of the α-TxIC/Txd1 of II-IV disulfide linkage mode of connection, the chromatographiccondition of this toxin peptide is: with Vydac C18 HPLC inverse analysis post, in 40 minutes, carry out linear gradient elution, B liquid is 0.65% trifluoroacetic acid (trifluoroacetic acid from 15% to 50%, A liquid from 85% to 50%, A liquid, TFA), B is the aqueous solution of 0.5% TFA and 90% acetonitrile (acetonitrile).Ultra-violet analysis wavelength is 214nm, the appearance time of TxIC, and retention time is 23.366 minutes.

Fig. 3: α-TxIC is the strong blocker of selectivity of α 3 β 4nAChR.What A showed is the current affects situation of 1 μ M α-TxIC to α 3 β 4nAChR.The contrast electric current that in figure A, " C " refers to, arrow referred to 1 μ M α-TxIC incubation after 5 minutes, the current locus of first Ach pulse formation (～0nA).What B showed is the concentration dose response curve of α-TxIC to other 10 various hypotypes of nAChRs, the logarithmic value of the volumetric molar concentration that in figure, X-coordinate is α-TxIC used (M) (Log[TxIC] M); Ordinate zou is dose response percentage ratio (%Response), is acetylcholine receptor electric current and the ratio percentage ratio that contrasts electric current under the detoxifying function of respective concentration.α-TxIC specific blockage α 3 β 4nAChR, it partly blocks dosage (IC ₅₀) be only 12.5nM; α-TxIC also has certain blocking effect to α 6/ α 3 β 4nAChR, and it partly blocks dosage (IC ₅₀) be 94nM; α-TxIC has very faint blocking effect to α 2 β 4nAChR, and it partly blocks dosage up to 4550nM.Under 10 μ M toxin concentrations, TxIC does not have blocking effect to other hypotypes, its IC ₅₀> 10 μ M.In figure, each numerical value is the current average of taking from 3-8 Xenopus Oocytes.

Fig. 4: demonstration be that 1 μ M α-TxIC is to α 3 β 4nAChR(A), and 10 μ M α-TxIC are to its very approaching α 4 β 4 (B), the current affects situation of α 7 (C) nAChRs.The contrast electric current that in figure, " C " refers to, immediately " C " below be the toxin concentration of α-TxIC.After incubation that arrow refers to 5 minutes, TxIC blocks the current locus of first Ach pulse formation of corresponding receptor subtype.1 μ M α-TxIC specific blockage α 3 β 4nAChR, and 10 μ M do not block α 4 β 4 (B) and α 7 (C) nAChRs hypotype completely.

Embodiment

Below in conjunction with embodiment, embodiment of the present invention are described in detail.It will be understood to those of skill in the art that the following examples are only for the present invention is described, and should not be considered as limiting scope of the present invention.Unreceipted concrete technology or condition person in embodiment, according to the described technology of the document in this area or condition (such as with reference to works such as J. Pehanorm Brookers, the < < molecular cloning experiment guide > > that Huang Peitang etc. translate, the third edition, Science Press), corresponding reference or carry out according to product description.The unreceipted person of production firm of agents useful for same or instrument, being can be by the conventional products of commercial acquisition.

embodiment 1: the gene clone of alpha-conotoxin TxIC/Txd1 and sequential analysis

1. the extraction of Conus textile poison gland genomic dna

Take respectively from Conus textile (C.textile Linnaeus) live body of the coastal collections such as Hainan Island, the Xisha Islands is material, be stored in-80 ℃ standby.First cone shell poison gland is dissected out, and weigh.Then use marine animal genome DNA extracting reagent kit (purchased from BeiJing, China Tian Gen biochemical technology company limited), extract the genomic dna of poison gland, concrete operations are carried out according to test kit specification sheets.Obtain the genomic dna of poison gland.

The poison gland genomic dna of extraction is dissolved in 100 μ L TE, gets 5 μ L and carry out 1.0% agarose gel electrophoresis, λ-EcoT14 I digest DNA Marker of take is standard, detects integrity and the size of gained DNA.OD with nucleic acid protein analysis-e/or determining DNA solution ₂₆₀, OD ₂₈₀value and OD ₂₆₀/ OD ₂₈₀ratio, and calculate concentration (the μ gml of DNA ^-1), purity and DNA productive rate (μ gg ^-1).

The DNA extracting is as the template of carrying out conotoxin gene clone, for pcr amplification below.

Clone, order-checking and the sequential analysis of 2.PCR reaction and product thereof

According to α-CTX precursor-gene intron sequences and 3 ' end non-translational region (3 '-UTR) sequence thereof, design α-CTX special primer.Every primer is the oligonucleotide fragment of 18 bases.

Upstream intron primer sequence:

5’-GTGGTTCTGGGTCCAGCA-3’（SEQ?ID?NO：11）；

Downstream 3 '-UTR primer sequence:

5’-GTCGTGGTTCAGAGGGTC-3’（SEQ?ID?NO：12）。

It is 3 μ gml that extracted poison gland genomic dna stoste is diluted to final concentration ^-1, stand-by as the template of pcr amplification.

Respectively the conditions such as primer concentration and annealing temperature are optimized, finally determine that desirable PCR system is: DNA profiling 4 μ l, primer (each 5 μ mol/L) each 0.5 μ l, 2 * Taq PCRMasterMix, 12.5 μ l, sterilizing distilled water are supplemented to 25 μ l.

PCR response procedures is: 94 ℃ of heating 7min carry out denaturation, then according to 94 ℃, and 30s sex change; 50 ℃, 1min annealing; 72 ℃, 2min extension is increased, totally 35 circulations, and 72 ℃ are extended 10min, react rear 4 ℃ of preservations.

Get 8 μ l amplified productions and detect with 1.5% agarose gel electrophoresis, voltage 90V, electrophoresis 20min, the DL2000 DNA Marker of take is standard, detects the size of amplified production.

The clone of 3.PCR product, order-checking and sequential analysis

Reclaim pcr amplification product, after being connected with T-easy carrier (Promega), transform intestinal bacteria XL1 bacterial strains (also can use other business-like competence intestinal bacteria), utilize blue white bacterium colony and amicillin resistance to select recon, extracting and purifying recon plasmid is for sequencing analysis.Obtain two sequencing results, i.e. SEQ ID NO:1 and SEQ ID NO:2(Fig. 1,168bp), as follows respectively:

GTGGTTCTGGGTCCAGCA tTTGATGGCAGGA ATGCTGCA gGCAACGACAAAATGTCCGCCCTGATGGCTCTGACCA

cAGG gGATGCTGTTCCCATCCTGTCTGTAGCGCGATGAGTCCAATCT gTGGCTGAaGACGCTGATGCTCCAGGACCCTCTGAACCACGACA(SEQ ID NO:1) or,

GTGGTTCTGGGTCCAGCA TTTGATGGCAGGAATGCTGCA GGCAACGACAAAATGTCCGCCCTGATGGCTCTGACCA

CAGG GGATGCTGTTCCCATCCTGTCTGTAGCGCGATGAGTCCAATCT GTGGCTGAAGACGCTGATGCTCCAGGACCCTCTGAACCACGACA（SEQ?ID?NO：2）。

Two sequences above only have the base of the 77th different, with adding collimation mark, go out.

The sequencing result of the pcr amplification product obtaining, through DNAStar software analysis, is known its coding protein sequence, 3 '-non-translational region (UTR) sequence.Through sequential analysis comparison, obtained the precursor-gene of Novel alpha 4/6-CTX TxIC/Txd1 of the present invention.Be in EQ ID NO:1 and EQ ID NO:2 with the part of underscore, it is the nucleotide sequence of coding TxIC/Txd1 conotoxin propetide, following (114aa):

TTTGATGGCAGGAATGCTGCAGGCAACGACAAAATGTCCGCCCTGATGGCTCTGACCA

CAGGGGATGCTGTTCCCATCCTGTCTGTAGCGCGATGAGTCCAATCTGTGGCTGA（SEQ?ID?NO：3）；

TTTGATGGCAGGAATGCTGCAGGCAACGACAAAATGTCCGCCCTGATGGCTCTGACCA

CAGGGGATGCTGTTCCCATCCTGTCTGTAGCGCGATGAGTCCAATCTGTGGCTGA（SEQ?ID?NO：4）。

According to precursor-gene and conotoxin feature, infer and TxIC/Txd1 conotoxin propetide, it has the aminoacid sequence (37aa) shown in SEQ ID NO:5 or SEQ ID NO:6, hereinafter also referred to as α-conotoxin TxIC/Txd1 precursor or α-TxIC/Txd1precursor or TxIC/Txd1 precursor or TxIC precursor):

FDGRNAAGNDKMSALMALT TR↓GCCSHPVCSAMSPIC G（SEQ?ID?NO：5）；

FDGRNAAGNDKMSALMALT IR↓GCCSHPVCSAMSPIC G（SEQ?ID?NO：6）。

The prediction of the signal peptide of conotoxin precursor protein, propetide and mature peptide, adopts online ProP 1.0 Server to analyze (Duckert, P.; Brunak, S.; Blom, N., Prediction of proprotein convertase cleavage sites.Protein engineering, design & selection:PEDS 2004,17 (1), 107-12.).Method and the principle inferred please refer to Luo S, Zhangsun D, Zhang B, Quan Y, Wu Y.Novel alpha-conotoxins identified by gene sequencing from cone snails native to Hainan, and their sequence diversity.J Pept Sci.2006,12 (11): 693-704.Derivation and result are also referring to Fig. 1.

According to propeptide sequence, infer and mature peptide TxIC/Txd1, it has the aminoacid sequence shown in SEQ ID NO:7 (hereinafter also referred to as α-conotoxin TxIC/Txd1 or α-TxIC/Txd1 or TxIC/Txd1 or TxIC):

GCCSHPVCSAMSPIC #(SEQ ID NO:7, # represents C-terminal amidation, 15aa)

TxIC/Txd1 contains the peculiar CC-C-C halfcystine of α-CTX pattern, disulfide linkage mode of connection I-III, II-IV(Fig. 2 A), between first and the 3rd halfcystine, and form respectively two pairs of disulfide linkage between second and the 4th halfcystine.TxIC/Txd1 is 4/6 type α-CTX(Fig. 1 and Fig. 2 A).TxIC/Txd1 is new alpha-conotoxin, with the sequence of other α-CTX and specific activity in Table 1.

In fact, mature peptide TxIC/Txd1 of the present invention also can by propetide (SEQ ID NO:5 or 6 or 9) in vivo or external process process accordingly (example as shown in Figure 1) and obtain, alternatively, in vivo or externally by amidating enzyme, its C-terminal is carried out to amidation.

The nucleotide sequence following (45bp) of coding TxIC/Txd1 mature peptide:

GGATGCTGTTCCCATCCTGTCTGTAGCGCGATGAGTCCAATCTGT（SEQ?ID?NO：8）。

The invention still further relates to mature peptide in the sequence (16aa) without second Processing position (processing 2):

GCCSHPVCSAMSPIC?G（SEQ?ID?NO：9），

Its corresponding nucleotide sequence following (51bp):

GGATGCTGTTCCCATCCTGTCTGTAGCGCGATGAGTCCAATCTGTGGCTGA（SEQ?ID?NO：10）。

embodiment 2: the synthetic of alpha-conotoxin TxIC

According to the aminoacid sequence of alpha-conotoxin TxIC mature peptide (SEQ ID NO:7, C-terminal amidation), adopt Fmoc method synthetic TxIC linear peptides (Fig. 2 A).Concrete grammar is as follows:

Resin peptide adopts Fmoc chemical process to carry out synthetic, available Peptide synthesizer or manual synthesis method synthetic resins peptide.Except halfcystine, the side chain protected group of standard for all the other amino acid.The the 1st and the 3rd halfcystine (Cys) of TxIC-Trt for SH (S-trityl) protection, the 2nd and the 4th halfcystine-Acm for SH (S-acetamidomethyl) protects in pairs.Its synthesis step is: adopt Fmoc and FastMoc method in solid-phase synthesis, on ABI Prism 433a Peptide synthesizer, synthesized 3 isomer linear peptides.The amino acid whose Side chain protective group of Fmoc is: Pmc (Arg), Trt (Cys), But (Thr, Ser, Tyr), OBut (Asp), Boc (Lys). adopt Fmoc HOBT DCC method; Rink amidated resin and Fmoc amino acid, the synthetic handbook of synthesis step reference instrument carries out.For reacting completely, at piperidines deprotection and on the coupling time, distinguish proper extension, difficulty is connect to amino acid and adopt two couplings, obtain resin peptide.With reagent K (trifluoroacetic acid/water/ethanedithiol/phenol/thioanisole; 90:5:2.5:7.5:5; v/v/v/v/v) linear peptides is cut down from resin; and with ice ether sedimentation and washing and recycling linear peptides crude product; with preparative reverse hplc C18 post (Vydac) purifying; wash-out linear gradient is 15-50% B90 in 0-40min; 40-45min 50-100% B90. solvent B90 is 90% ACN(acetonitrile), 10% H20,0.5% TFA(trifluoroacetic acid); Solvent orange 2 A is the aqueous solution of 0.65% TFA.Ultraviolet absorption value analysis is carried out under 214nm wavelength.Linear peptides after purifying carries out purity detecting with the HPLC C18 post (Vydac) of analysis mode, and gradient is 0 – 40min 2 – 42% B60,42-47min 42 – 100% B60, and flow velocity is 1mL/min.Its purity reaches more than 95%, for oxidative folding.

Reference literature (Dowell, C.; Olivera, B.M.; Garrett, J.E.; Staheli, S.T.; Watkins, M.; Kuryatov, A.; Yoshikami, D.; Lindstrom, J.M.; McIntosh, J.M., Alpha-conotoxin PIA is selective for alpha6 subunit-containing nicotinic acetylcholine receptors.The Journal of neuroscience 2003,23 (24), 8445-52.) linear peptides of TxIC is carried out to the folding reaction of two-step oxidation, process is summarized as follows:

First by Tripotassium iron hexacyanide oxidation style, (pH 7.5 for 20mM potassium ferricyanide, 0.1MTris, 30min) between two halfcystines of Trt blocking group, form first pair of disulfide linkage.Monocyclic peptide, after reversed-phase HPLC C18 post (Vydac) purifying, is carried out iodine oxidation (10mM iodine in H ₂o:trifluoroacetic acid:acetonitrile (78:2:20by volume, 10min), removes the Acm on other 2 halfcystines, forms second pair of disulfide linkage between these 2 halfcystines simultaneously.Two cyclic peptide are again through reversed-phase HPLC C18 post (Vydac) purifying, and wash-out linear gradient is still 15-50% B90 in 0-40min, and 40-45min 50-100% B90. solvent B90 is 90% ACN(acetonitrile), 10% H ₂o, 0.5% TFA(trifluoroacetic acid); Solvent orange 2 A is the aqueous solution of 0.65% TFA.Ultraviolet absorption value analysis is carried out under 214nm wavelength.Obtain according to order directed alpha-conotoxin that forms disulfide linkage between corresponding halfcystine of holding from N to C end, the appearance time of TxIC is 23.366min(Fig. 2 B), and be accredited as correctly by mass spectrum (MS).

(monoisotopic mass) is consistent with determining molecular weight for the theoretical molecular of TxIC after oxidative folding: the theoretical molecular of TxIC is 1488.81Da, the determining molecular weight of TxIC is 1488.4266Da, than its linear peptides molecular weight 1492.815Da, reduces 4Da.Colorimetric estimation under 280nm wavelength for peptide concentration, calculates peptide concentration and quality according to Beer-Lambert equation (equation).The toxin peptide folding of these quantitative mistakes is for the activity experiment of embodiment below.

embodiment 3: alpha-conotoxin TxIC specific blockage α 3 β 4nAChR experiments

Reference literature (Azam L; Yoshikami D; McIntosh JM.Amino acid residues that confer high selectivity of the alpha6 nicotinic acetylcholine receptor subunit to alpha-conotoxinMII[S4A; E11A, L15A] .J Biol Chem.2008; 283 (17): the method 11625-32.), and in-vitro transcription test kit (mMessage mMachine in vitro transcription kit (Ambion, Austin, TX)) specification sheets, prepare various rat nervous system type nAChRs hypotype (α 3 β 4, α 6/ α 3 β 4, α 9 α 10, α 4 β 2, α 4 β 4, α 3 β 4, α 2 β 2, α 2 β 4, α 7), mankind α 3 β 4 and mouse muscle type nAChRs(α 1 β 1 δ ε) cRNA, its concentration is calculated by the OD value under UV 260nm.Dissect and collect Africa xenopus (Xenopus laveis) ovocyte (frog's egg), cRNA is injected in frog's egg, the injection volume of each subunit is 5ng cRNA.Each subunit injection 0.5-2.5ng DNA of muscle nAChR.Frog's egg is cultivated in ND-96.Injection cRNA in 1-2 days after frog's egg collection, the 1-4 days interior voltage clamp records for nAChRs after injection.

1 frog's egg of injecting cRNA is placed in to the Sylgard track (diameter 4mm * degree of depth 2mm) of 30uL, ND96 perfusate (the 96.0mM NaCl that gravity perfusion contains 0.1mg/ml BSA (bovine serum albumin), 2.0mM KCl, 1.8mM CaCl ₂, 1.0mM MgCl ₂, 5mM HEPES, pH 7.1-7.5) or the ND96 (ND96A) that contains 1mM atropine, flow velocity is 1ml/min.All conotoxin solution also contains 0.1mg/ml BSA to reduce the non-specific adsorption of toxin, with transforming valve (SmartValve, Cavro Scientific Instruments, Sunnyvale, CA) can between perfusion toxin or vagusstoff (ACh), carry out free switching, and a series of threeway solenoid valve (solenoid valves, model 161TO31, Neptune Research, Northboro, MA) make to pour between ND96 and ACh etc. and carry out free switching.The electric current of Ach gate is arranged on " slowly " pincers by two electrodes voltage clamp amplifier (model OC-725B, Warner Instrument Corp., Hamden, CT), and clamp gain carries out online record when maximum value (* 2000) position.With glass capillary (fiber-filled borosilicate capillaries, WPI Inc., Sarasota, FL) the drawn glass electrode of 1mm external diameter * 0.75 internal diameter mm, and be full of 3M KCl as voltage and current electrode.Membrane voltage strangulation is controlled and record data by computer in-70mV. whole system.ACh pulse is the ACh every 5min automatic filling 1s.The concentration of ACh is respectively, and nAChRs and the nervous system type α 9 α 10 nAChRs ovum of expressing muscularity are 10 μ M; The α 7 that expresses the nAChRs of nervous system type is 200 μ M, and other hypotype is all 100 μ M.At least record 4 ovum and express the current response situation of certain hypotype to different toxin concentrations, and current locus.

The current data of test is carried out statistical study with GraphPad Prism software (San Diego, CA), draws dose response curve, calculates the hemiblock concentration IC of conotoxin ₅₀various parameters etc. multiple relevant toxin blocking-up nAChRs.

Result shows, TxIC(embodiment 2 preparations) rat α 3 β 4 nAChR are all had to specific blockage effect, wash-out very fast (Fig. 3).TxIC is the strongest blocker of activity of the α 3 β 4nAChR that find up to now, and it partly blocks dosage IC ₅₀be only 12.5nM, see table 1 below with the specific activity of other known conotoxins.

1 μ M α-TxIC/Txd1 has blocked the open electric current producing of rat α 3 β 4 nAChR by Ach gate completely, and wash-out is very fast, and blocking-up is reversible (Fig. 3 A).TxIC is the strongest to the blocking-up activity of α 3 β 4nAChR, and it partly blocks dosage IC ₅₀with limit of error be 12.5nM (9.4-16.5nM); TxIC takes second place to the blocking-up activity of α 6/ α 3 β 4 nAChR, and it partly blocks dosage IC ₅₀with limit of error be 94.1nM (73-121nM); TxIC is very faint to the blocking-up activity of α 2 β 4nAChR, and it partly blocks dosage IC ₅₀with limit of error be 4550nM (3950-5230nM).TxIC is respectively the slope of their dose response curve (Hillslope) and limit of error: α 3 β 4 nAChR, 0.19 (0.66-1.44); α 6/ α 3 β 4 nAChR, 0.26 (0.73-1.87); α 2 β 4 nAChR, 0.20 (1.48-2.42).α-TxIC does not block activity to other nAChRs hypotypes, comprises α 4 β 4, α 4 β 2, α 6/ α 3 β 2 β 3, α 2 β 2, α 9 α 10, α 7, α 1 β 1 δ ε, its IC ₅₀> 10 μ M(Fig. 3 B, table 2), by contrast, α-TxIC blocks α 3 β 4 and is eager to excel 7.5 times than the activity of blocking-up α 6/ α 3 β 4, than the activity 524 times (Fig. 3 B, table 2) eager to excel in whatever one does of blocking-up α 2 β 4.

α-TxIC/Txd1 is high to the blocking-up selectivity of α 3 β 4 nAChR.From 1 μ M α-TxIC/Txd1 to α 3 β 4 nAChR, and 10 μ M α-TxIC/Txd1 to its very approaching α 4 β 4 (B), the current affects situation of α 7 (C) nAChRs can be found out (Fig. 4), 1 μ M α-TxIC/Txd1 specific blockage α 3 β 4 nAChR(Fig. 4 A), and the toxin of the high 10 times of concentration that compare is to α 4 β 4 (Fig. 4 B), do not block activity with α 7 (Fig. 4 C) nAChRs hypotype.To mankind α 3 β 4 nAChR, it is active that α-TxIC has the blocking-up similar to rat α 3 β 4 nAChR.

Therefore, α-TxIC be find at present to the strongest alpha-conotoxin of α 3 β 4 nAChR activity, its specific activity is shown in table 1 below.

Table 1: α-TxIC and other alpha-conotoxin sequences and specific activity thereof are

Asterisk in table (*) represents C-terminal amidation, and halfcystine shows with character frame and black matrix.Short-term (-) indication notch.

Table 2: α-TxIC partly blocks dosage IC to various nAChRs hypotypes ₅₀slope with dose response curve

Hypotype	IC ₅₀(nM) ^a	Ratio ^b	Slope ^a	Hypotype	IC ₅₀(nM) ^c
						α3β4	12.5(9.4-16.5)	1	0.19(0.66-1.44)	α6/α3β2β3	?>10000
α6/α3β4	94.1(73-121)	7.5	0.26(0.73-1.87)	α2β2	>10000
						α2β4	4550(3950-5230)	524	0.20(1.48-2.42)	α9α10	>10000
α4β4	>10000	--	--	α7	>10000
						α4β2	>10000	--	--	α1β1δε	>10000

In table ^athat degree of confidence is 95% interval; ^bthat other hypotypes and α 3 β 4 nAChR partly block dosage (IC ₅₀) ratio; ^cthat blocking-up is not active under 10 μ M.

The research of prior art shows, α 3 β 4 nAChR are treatment neuropsychiatric diseases, as the drug target (referring to the pertinent literature in background technology) of the habituation of nicotine, morphine and Cocaine etc., neurodynia, Parkinson's disease, dementia, schizophrenia, depression, fear etc.Therefore, new alpha-conotoxin TxIC/Txd1 of the present invention has high using value aspect the mechanism research of above-mentioned disease, diagnosis, treatment.

Although the specific embodiment of the present invention has obtained detailed description, it will be understood to those of skill in the art that.According to disclosed all instructions, can carry out various modifications and replacement to those details, these change all within protection scope of the present invention.Four corner of the present invention is provided by claims and any equivalent thereof.

Claims

1. a peptide species, its for or comprise and be selected from the aminoacid sequence described in any one in following (1) to (3):

(1) aminoacid sequence shown in SEQ ID NO:5-7 or SEQ ID NO:9;

2. polypeptide according to claim 1, wherein, first halfcystine of the N-terminal of described polypeptide and the 3rd halfcystine form disulfide linkage, and second halfcystine and the 4th halfcystine formation disulfide linkage; Or first halfcystine of the N-terminal of described polypeptide and the 4th halfcystine formation disulfide linkage, and second halfcystine and the 3rd halfcystine formation disulfide linkage; Or first halfcystine of the N-terminal of described polypeptide and second halfcystine formation disulfide linkage, and the 3rd halfcystine and the 4th halfcystine formation disulfide linkage; Particularly, the C-terminal of described polypeptide is amidated.

3. a fusion rotein, it comprises the polypeptide described in claim 1 or 2.

4. polynucleotide, the aminoacid sequence of polypeptide described in its coding claim 1 or 2.

5. polynucleotide according to claim 4, its for or comprise and be selected from the nucleotide sequence described in any one in following (1) to (3):

(1) nucleotide sequence shown in SEQ ID NO:1-4 or SEQ ID NO:8 or SEQ ID NO:10;

(2) complementary sequence of nucleotide sequence in above-mentioned (1);

6. a nucleic acid construct, it comprises the polynucleotide described in claim 4 or 5.

7. an expression vector, it comprises nucleic acid construct claimed in claim 6.

8. a cell for conversion, it comprises expression vector claimed in claim 7.

9. a pharmaceutical composition, it comprises the polypeptide described in claim 1 or 2, or comprises fusion rotein claimed in claim 3; Alternatively, it also comprises pharmaceutically acceptable carrier or auxiliary material.

10. in vivo or extracorporeal blocking acetylcholine receptor or regulate the method for levels of acetylcholine, comprise polypeptide described in the claim 1 or 2 of using significant quantity or the step of fusion rotein claimed in claim 3; Particularly, described acetylcholine receptor is α 3 β 4 acetylcholine receptors.

11. 1 kinds of methods of screening acetylcholine receptor inhibitor or definite acetylcholine receptor subtypes, the method comprises: by the step in the situation that there is and do not exist candidate compound existence, acetylcholine receptor being contacted with polypeptide described in claim 1 or 2 or fusion rotein claimed in claim 3; Particularly, described acetylcholine receptor is α 3 β 4 acetylcholine receptors.

Polypeptide described in 12. claims 1 or 2 or fusion rotein claimed in claim 3 are for the purposes of blockage of acetylcholine receptor; Particularly, described acetylcholine receptor is α 3 β 4 acetylcholine receptors.

Polypeptide described in 13. claims 1 or 2 or fusion rotein claimed in claim 3 are being prepared the medicine of blockage of acetylcholine receptor or the purposes in reagent; Particularly, described acetylcholine receptor is α 3 β 4 acetylcholine receptors.

Polypeptide described in 14. claims 1 or 2 or fusion rotein claimed in claim 3 treat and/or prevent nervous system disorders for example habituation and neurodynia in preparation, and the purposes of the medicine for the treatment of parkinsonism, dementia, schizophrenia, depression, cancer etc., or for the preparation of the purposes of the medicine of kill pests, analgesia, smoking cessation, drug rehabilitation; Particularly, described habituation is caused by following reason: various psychoactive drug substances, other that comprise Nicotine, opium, heroine, methyl amphetamine (methamphetamine), morphine, hemp, Cocaine and national regulation control can make the narcotics of humanoid one-tenth addiction and psychotropic substances etc.Particularly, described neurodynia is caused by following reason: cancer and cancer chemotherapy, alcoholism, sciatica, diabetes, trigeminal neuralgia, sclerosis, zoster, mechanical injury and operation wound, acquired immune deficiency syndrome (AIDS), head nerves paralysis, drug intoxication, industrial pollution is poisoning, lymph neurodynia, myelomatosis, multiple spot motorius pain, chronic congenital sensory neuropathy, acute violent idiopathic neuralgia, extruding neurodynia, vasculitis, vasculitis, local asphyxia, uremia, children's bile hepatic diseases, chronic respiratory obstacle, composite nerve pain, multiple organ failure, sepsis/pyemia, hepatitis, porphyria, vitamin deficiency, Chronic Liver popular name for, primary bile sclerosis, hyperlipidemia, leprosy, Lyme arthritis, sensory nerve bundle film is scorching, or allergy.

The preparation method of the polypeptide described in 15. claims 1 or 2, comprises the steps: