CN103642939B - Detect lot of trace target calibration method based on long probe simultaneously - Google Patents

Detect lot of trace target calibration method based on long probe simultaneously Download PDF

Info

Publication number
CN103642939B
CN103642939B CN201310643752.5A CN201310643752A CN103642939B CN 103642939 B CN103642939 B CN 103642939B CN 201310643752 A CN201310643752 A CN 201310643752A CN 103642939 B CN103642939 B CN 103642939B
Authority
CN
China
Prior art keywords
probe
target
sequence
downstream
upstream
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201310643752.5A
Other languages
Chinese (zh)
Other versions
CN103642939A (en
Inventor
汪平
徐英武
吕洪玉
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhejiang A&F University ZAFU
Original Assignee
Zhejiang A&F University ZAFU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhejiang A&F University ZAFU filed Critical Zhejiang A&F University ZAFU
Priority to CN201310643752.5A priority Critical patent/CN103642939B/en
Publication of CN103642939A publication Critical patent/CN103642939A/en
Application granted granted Critical
Publication of CN103642939B publication Critical patent/CN103642939B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6862—Ligase chain reaction [LCR]

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses one and detect multiple target calibration method based on long probe simultaneously, comprise following characteristics: 1), obtain the nucleotide sequence of target to be detected and internal reference 18S rRNA thereof, then the discriminating probe of two oligonucleotide be closely connected in the conserved regions design of often kind of target to be detected and internal reference 18S rRNA thereof; 2), universal primer and the long sequence of Selective filling thing is designed, with upstream, 3 ' of universal sequence Tag2 differentiates that 5 ' of probe is connected to form upstream LDR probe, 5 ' of the long sequence of weighting material and universal sequence Tag1 holds and downstream differentiates that 3 ' of probe holds and be connected to form downstream LDR long probe; 3), upstream LDR probe is carried out Ligase detection reaction with downstream LDR long probe together with target sample to be detected; 4), utilize upstream and downstream universal primer amplification to connect product, obtain stripe information by agarose nucleic acid electrophoresis, thus know hybrid target target infection conditions.

Description

Detect lot of trace target calibration method based on long probe simultaneously
Technical field
The present invention relates to a kind of multiplicity trace detection analytical procedure, be specifically related to a kind of novel long probe trace dna electrophoretic detection based on ligase enzyme reaction.
Background technology
Pathogenic agent, as the important disease microorganism of a class, has a strong impact on all many-sides such as clinical diagnosis, water and environmental analysis, food safety and biological control.The particularly H7N9 HPAI (High Pathogenic AI) in Central Region outburst in 2013, again proposing to control and detect pathogenic agent to the mankind has become very necessary with a urgent task.Therefore, effective diagnostic method is set up for the control of pathogenic agent and improve vegeto-animal quality and all have very important significance.
Potato, as one of worldwide food crop, is subject to infecting of multiple potato virus for a long time, all causes serious impact to the yield and quality of potato.In the long-term Symbiotic evolution process of virus infection farm crop, host resists infecting of virus by gene silencing, and virus creates the silencing suppressors with antagonism function to resist host's gene silencing defense mechanism, these supressors have function (the Olivier V of the gene silencing approach removed or disturb host, 2001., Lakatos L et al., 2006).Study these supressors, contribute to the deep interaction relationship understood between virus and host, for defending having great importance of pathogenic agent further.Corium solani (Potato leafroll virus has been found at present in potato virus, PLRV) P0 gene, Tobacco rattle virus (Tobacco rattle virus, TRV) 16kDa gene, cucumber mosaic virus (Cucumber mosaic virus, CMV) 2b gene, beet west yellow virus (Beet western yellows virus, BWYV) P0 gene, marmor upsilon (Potato virus Y, PVY) HcPro (Helper component-proteinase) gene, potato virus X (Potato virus X, PVX) P25 gene has function (the Renovell et al. of suppressor gene silence, 2012, Moissiard and Voinnet2004, Chiu et al., 2010, Fukuzawa et al., 2010), these six kinds of supressors are all by Argonaute (AGO) family protein mediated gene silencing.In view of potato can simultaneously by multiple virus infection, very likely multiple supressor participates in the phenomenon suppressing multiple virus infection simultaneously, thus the phenomenon of mediated gene silencing, simultaneously owing to participating in the lower of the content of supressor in potato of mediated gene silencing, therefore, set up a kind of method to detect lot of trace pathogenic agent simultaneously and just seem particularly urgent and necessary.
Relate to the detection method of phytopathogen at present a lot of as the molecular biology method of plant indicator detection method, electron microscopy, immunological method based on albumen, nucleic acid mediation.Plant indicator detection method (Wu Lingjuan etc., 2003; Xu Jie, 2002) have and detect convenient, simple operation and other advantages, but need special insect protected greenhouse, incubation time is longer, and needs regular desinsection and water.In addition, plant indicator is different from viral species, and the condition that the light and temperature of employing is cultivated is also corresponding different.The application of Indexing by indicator plants method in these conditionalities.Wu Xingquan etc. (2004) utilize electron microscopy successful identification to infect PVX virus with the potato of flower leaf paresthesia.But electron microscopy is subject to following restriction: operating environment must be vacuum; require higher to the operative technique of viewer and stock of knowledge; need to draw materials to detected biological sample simultaneously, rinsing, fix, dewater, soak into, embed, be polymerized, cut into slices and the process of the step such as dyeing; elapsed time long (Naja et al., 2008; Nishiyama et al., 2010).Therefore, utilize electron microscopy to detect potato virus to be very restricted.Singh et al(1992) utilize immunological method successfully to distinguish PVY n, PVY o, PVY n:Othree kinds of strains, but Weidemann et is al(1998) utilize immunology detection technology for detection PVY nand PVY nTNtime, occur serum cross reaction, and detected result is unstable.In addition, the viroid that immunological detection method can not be used for purity and the low virus of content and lack coat protein detects.The easy contaminated easy generation false positive of the method (Matic S et al., 2009) simultaneously.
The molecular biology method of nucleic acid mediation, because of simple and quick, is extensively applied in the Check and Inspection of various pathogenic agent at present.The molecular biology method of common nucleic acid mediation has: polymerase chain reaction (Polymerase chain reaction, PCR), hybridization (Nucleic acid hybridization technique).Round pcr utilizes a kind of specificity method of a pair Auele Specific Primer and related reagent DNA amplification, and compared with traditional detection method and immunological method, PCR detection technique greatly improves sensitivity and the accuracy of pathogen detection.Even the extremely DNA of trace, utilize PCR to detect and also can reach the level very easily detected.In addition, PCR detection technique overcome immunological detection method can not detection type virus, the different strain of virus of the same race and the defect (Erlich, 1989., Suo et al, 2009., Song et al, 2009., Lee et al, 2009) of dormancy potato seed.Under normal circumstances, animal and plant body is subject to multiple pathogens invasion simultaneously and infects, and therefore sets up a kind of detection method simultaneously detecting multiple pathogens and just seems particularly important.Compared with regular-PCR detection method, multiplex PCR detection technique has can detect multiple pathogens in primary first-order equation, reduces the time and cost detected.But multiplex PCR is high especially to the design requirements of primer, the difference of the hairpin structure between multipair primer, mispairing and annealing temperature all may cause inefficient amplification, does not even increase.And need to be optimized reaction conditions, need especially to be optimized primer concentration ratio, process is complicated, elapsed time long (Li et al, 2009., Boonham et al, 2003).These factors limit the application of multiplex PCR greatly.
Be that the molecular hybridization of the nucleic acid mediation of representative is widely used in the detection of pathogenic agent in recent years with gene chip, Busti etc. (2002) design 6 species specific Ligase detection reactions (ligase detection reaction, LDR) probe, wherein every a pair probe is by differentiating that few nucleic acid and general probe form, general probe is carried out fluorescent mark, thus reaches the object of detection.Szemes etc. (2005) are by anchor probe (padlock probes, PLPs) technology and general-purpose chip combine with technique are for detecting the plant pathogeny organism qualification of genus and species and sub-species, the connection product of anchor probe carries out fluorescent mark under the effect of general fluorescence labeling primer, what hybridized by slide reaches discriminating different pathogens, and the method has good specificity and susceptibility.Wang etc. (2011) design 11 groups of LDR probes, and by upstream, its middle and upper reaches LDR probe differentiates that probe and the general target in upstream form, downstream LDR probe differentiates probe by downstream, the general target sequence of Zip code sequence and downstream forms.Hybridizing with the Zip general-purpose chip that point makes in advance by designing these 11 groups of LDR probes, successfully detecting 10 kinds of potato viruses and 18S rRNA positive control sample.Aforesaid method is because the advantages such as multiplicity is good, highly sensitive, high specificity are extensively by the favor of investigator, but because chip hybridization easily occurs false positive, the probe that testing process needs the sample being optimized different parameters, detecting to need fluorescent mark, needs to synthesize length certainly will increase the cost of detection.Therefore need to set up that a kind of multiplicity is good, high specificity, sensitivity is relatively high, simple and quick, cost is low detection method.
Summary of the invention
The technical problem to be solved in the present invention is to provide one and detects multiple target calibration method based on long probe simultaneously, the method belongs to the long probe LDR-PCR amplification method for electrophoresis detection lot of trace target, the method can have simple and direct reliable, easy handling, highly sensitive, high specificity, multiplicity are good and the advantage such as low price, use the method can to any not equal, to belong to and the pathogenic agent of kind detects and identifies.
In order to solve the problems of the technologies described above, the invention provides one and detecting multiple target calibration method (namely multi-LDR-PCR detects lot of trace hybrid target calibration method simultaneously) based on long probe simultaneously, comprising the following steps:
1), obtain the nucleotide sequence of target to be detected and internal reference 18S rRNA thereof, utilize related software (such as NCBI) comparison often to plant the nucleotide sequence of each strain of target, obtain the conserved regions of often kind of target; The discriminating probe (length is 20 ~ 25bp) of two oligonucleotide be closely connected in the conserved regions design of often kind of target to be detected and internal reference 18SrRNA thereof again, namely upstream differentiates that probe is differentiated in probe and downstream, described upstream and downstream differentiate probe be join end to end for a pair and with the oligonucleotide of respective target sequence complementation, often kind of target to be detected and internal reference 18S rRNA thereof design two groups of upstream and downstream respectively and differentiate probes;
Namely, obtain the nucleotide sequence of target to be detected, utilize the full length sequence obtaining often kind of target sequence, synthesize corresponding upstream and downstream primer, corresponding total length target sequence is obtained by RT-PCR, and utilize the nucleotide sequence of corresponding software to multiple strains of often kind of target to carry out corresponding comparison, thus obtain corresponding conserved regions; Be that probe differentiated by the oligonucleotide that 20 ~ 25bp two is closely connected in the conserved regions design length of often kind of target respectively again, namely upstream differentiates that probe is differentiated in probe and downstream, upstream and downstream differentiate probe be join end to end for a pair and with the oligonucleotide of respective target complement sequence;
2), design universal primer and the long sequence of Selective filling thing, described universal primer is made up of upstream and downstream universal primer, and described weighting material, universal primer and target sequence to be detected all do not form the oligonucleotide of stable space structure without homology; With upstream, 3 ' of universal sequence Tag2 differentiates that 5 ' of probe is connected to form upstream LDR probe, 5 ' of the long sequence of weighting material and universal sequence Tag1 holds and downstream differentiates that 3 ' of probe holds and be connected to form downstream LDR long probe; Universal sequence Tag1 and the complementation of downstream universal primer, universal sequence Tag2 is identical with upstream universal primer;
Remarks illustrate: the length of the weighting material of the correspondence of often kind of target to be detected is different, and the length that often kind of target to be detected is corresponding is all unique;
Gradient long segment weighting material and upstream and downstream universal primer are all do not form stable space structure (as hairpin structure and dimer) without homology according to size and space structure and target sequence.Gradient long segment weighting material is the oligonucleotide of length range at 126 ~ 716bp, holds respectively, probe is differentiated in downstream 3 ' holds and be connected to form downstream LDR long probe with 5 ' of Tag1; With upstream, 3 ' of Tag2 differentiates that 5 ' of probe is connected to form upstream LDR probe; The weighting material of gradient long segment is for detecting the connection product of universal primer amplification.
3), by upstream LDR probe carry out Ligase detection reaction with downstream LDR long probe together with target sample to be detected, obtain connecting product;
4) utilize upstream and downstream universal primer amplification to connect product, obtain stripe information by agarose nucleic acid electrophoresis, thus know hybrid target target infection conditions;
When there is the band identical with above-mentioned target length to be detected, being identified as and having infected this target to be detected;
Otherwise, when not there is any band, being identified as and not infecting target to be detected.
As the improvement detecting multiple target calibration method based on long probe of the present invention simultaneously:
Described target to be detected is 16kDa tRV, 2b cMV, P0 bWYV, HcPro pVY, P25 pVX, P0 pLRV;
Described step 4) is:
16kDa tRVconnecting product amplification length is 204bp; 2b cMVconnecting product amplification length is 312bp; P0 bWYVconnecting product amplification length is 398bp; It is 474bp that 18S rRNA connects product amplification length; HcPro pVYconnecting product amplification length is 578bp; P25 pVXconnecting product amplification length is 647bp; P0 pLRVconnecting product amplification length is 793bp.
As the further improvements in methods detecting multiple target based on long probe of the present invention simultaneously:
Described upstream universal primer is: 5 ' >GGCATCGCATAACATAAGCA<3 ', and downstream universal primer is:
5 ' >GTCCGTCCAACCGTCTG<3 '; Universal sequence Tag1 and the complementation of downstream universal primer, universal sequence Tag2 is identical with upstream universal primer.
As the further improvements in methods detecting multiple target based on long probe of the present invention simultaneously: the long sequence of described weighting material is a part for following sequence:
5′>ATG GGGAGGGGAAGGGTTCAGTTGAAGAGGATCGAAAACAAAATCAACAGGCAGGTCACTTTCTCAAAGAGAAGGTCTGGTTTGCTGAAGAAAGCCCATGAGATCTCTGTGCT TTGTGATGCTGAGGTGGCTCTGATTGTTTTCTCTACCAAAGGGAAGGTCTTTGAGTATTCTACTGATTCTTGTATGGAAAGGATTCTTGAAAGGTATGAGAGATATT CATATGCAGAGAGGCAACTTATTGCACATGATCTCGAACAAAATGGAAGCTGGACTCTGGAGCATGCGAAGCTCAAGGCTAGGATGGAGATTTTACAAAGAA ATCAAAAGTATTTCATGGGAGAAGATCTCGACTCCTTGAGTCTTAAAGAGCTTCAAAATTTGGAGCAGCAGCTTGATT CTGCTCTCAAACACATCAGGTCGAGAAAGAACCAAGTTATGCACGAATCCATTTCGGATCTTCAGAAAAA GGATAAGGCATTGCAG GAGCAAAACAACGTGCTTGCCAAGCAGGTGAAGGAGAAAGAAAAGGAATTACTTGCCGAACAGGCACAATGGGATATTCAGCATAATCAAACACTTGACACATCCTC TATCCTTCCACAAACGTTGCTGCCCTTGGACACTATTGGGACTGCGTCCTACCAAGCAATTAGAAGCAGCGAAAGAGAAGATGAGGCAAGACCATCTCGACATCG CCCTTGGATGCTTAGCCATCTTGATTAATAG<3′；
Wherein 16kDa tRVweighting material is 594 ~ 719 bases, totally 126 bases; 2b cMVweighting material is 487 ~ 719 bases, totally 233 bases; P0 bWYVweighting material is 401 ~ 719 bases, totally 319 bases; 18S rRNA weighting material is 323 ~ 719 bases, totally 397 bases; HcPro pVYweighting material is 221 ~ 719 bases, totally 499 bases; P25 pVXweighting material is 114 ~ 719 bases, totally 606 bases; P0 pLRVweighting material is 4 ~ 719 bases, totally 716 bases.
Remarks illustrate: single line be the position of upstream primer, two line be downstream primer (all).
Detect the further of multiple target calibration method as of the present invention based on long probe: the connection product producing gradient length, often kind of fixing target of length correspondence, adopts the method for electrophoresis it can be distinguished clearly simultaneously.
Of the present inventionly detect multiple target calibration method based on long probe: the downstream long probe being obtained gradient length by asymmetric PCR, and it is identical to make the downstream primer used in the long probe process of all target downstreams simultaneously, has saved experiment synthesis cost.Of the present inventionly detect lot of trace target calibration method based on long probe simultaneously, overcome existing multi-LDR-PCR method synthesis long probe and use the defect that gene chip cost is high, have cost low, detect fast, multiple target can be detected simultaneously.The present invention designs 7 pairs of specific probes, and wherein upstream probe is directly synthesized by biotech firm, and this part is made up of the specific upstream probe of the sequence of template complementation to be detected and Tag2 two portions sequence; Downstream long probe is reclaimed by asymmetric PCR rubber tapping strand and obtains, and this part is made up of the specific Down Stream probe sequence of template complementation to be detected, long segment weighting material and Tag1 tri-part.The length being connected product by Ligase detection reaction (ligase detection reaction, LDR) 7 kinds can obviously be distinguished; The present invention design specific probe there is high annealing temperature and connect product there is identical Tag, the product size of amplification is between 203-793bp.According to the multi-LDR-PCR reaction system that the present invention sets up, a LDR-PCR reaction can be realized and detect 7 kinds of targets, i.e. 16kDa simultaneously tRV, 2b cMV, P0 bWYV, 18S rRNA, HcPro pVY, P25 pVX, P0 pLRVdetection results.
In sum, the present invention designs 7 groups of LDR probes, and wherein by the general target in upstream and upstream, upstream probe LDR differentiates that probe forms, by downstream, downstream LDR probe differentiates that the general target of the long sequence of probe, weighting material and downstream forms.The present invention does not need to carry out chip hybridization by means such as fluorescent marks, only need just can reach by simple electrophoresis the object distinguishing detection lot of trace target, have that multiplicity is good, high specificity, sensitivity is relatively high, simple and quick, cost is low detection advantage.Not only to the development of new detection method, there is important theory significance, and for lifting Pathogen test level, prevent dangerous cause of disease from importing China into and there is important practice significance and application prospect.
Accompanying drawing explanation
Below in conjunction with accompanying drawing, the specific embodiment of the present invention is described in further detail.
Fig. 1 is the principle schematic simultaneously detecting the micro-target calibration method of multiple mixing of the present invention.
Embodiment
Of the present inventionly detect lot of trace target calibration method based on long probe, specific embodiments comprises the following steps simultaneously:
1) respectively the potato samples of potato-infecting virus is detected, determine the kind of the factor that gene silencing suppresses in potato virus.In potato virus, find that there is 6 kinds of silencing suppressors at present, be respectively Tobacco rattle virus 16kDa(16kDa tRV) gene, cucumber mosaic virus 2b(2b cMV) gene, the yellow of beet west virus P0(P0 bWYV) gene, marmor upsilon HcPro(HcPro pVY) gene, potato virus X P25(P25 pVX) gene, corium solani P0(P0 pLRV) gene;
Download 6 kinds of supressors to be detected and the nucleotide sequence of internal reference 18S rRNA from NCBI website, and clone the partial nucleic acid sequence of 6 kinds of silencing suppressors complete sequences and internal reference 18S rRNA.The comparison of DNAStar software is used often to plant the nucleic acid sequence alignment of each strain of supressor and internal reference 18S rRNA, find conserved regions, utilize Primer5.0 to differentiate probes (join end to end for a pair and with the oligonucleotide of about the 20 ~ 25bp of respective target complement sequence) at two oligonucleotide that conserved regions design is closely connected;
2) design the long sequence of weighting material and general target: the long sequence of weighting material and between general target and target to be detected without any the oligonucleotide of homology.5 ' holds, probe is differentiated in downstream 3 ' of the long sequence of weighting material and Tag1 holds and is connected to form downstream long probe; With upstream, 3 ' of Tag2 differentiates that 5 ' of probe is connected to form upstream probe; The weighting material of gradient long segment is for detecting the connection product of universal primer amplification, and the principle of detection and process are as shown in Figure 1;
3) upstream and downstream probe is carried out Ligase detection reaction together with detected sample target, only have when detecting that target sequence is mated completely with two complementary oligonucleotide joint corresponding position bases, ligation just can be carried out, the discriminating probe in downstream and the long sequence of weighting material could be increased by upstream and downstream universal primer, obtain the pcr amplification product of corresponding length gradient through electrophoresis; Otherwise then can not form connection product, the discriminating probe in downstream and the long sequence of weighting material also can not be amplified;
4) detection of amplification adopts method well known in the art, obtain nucleic acid electrophoresis image file, adopt negative control and positive control, determine that the value of positive control is 30ng, negative control is less than 10ng, through the gray-scale value of software and image analysis amplified band, and then supressor distribution situation in the potato samples learning infection.
Below in conjunction with specific embodiment, set forth the present invention further.Should be understood that these embodiments are only not used in for illustration of the present invention to limit the scope of the invention.
Embodiment 1: one detects lot of trace target calibration method based on novel long probe simultaneously, respectively the leaf sample of 50 parts of potato viruses of suspected infection is detected, determine the kind of the silencing suppressors infected in sample, known commonly have 6 kinds, is respectively Tobacco rattle virus 16kDa gene (16kDa tRV), cucumber mosaic virus 2b gene (2b cMV), beet west yellow virus P0 gene (P0 bWYV), marmor upsilon HcPro gene (HcPro pVY), potato virus X P25 gene (P25 pVX), corium solani P0 gene (P0 pLRV); The inventive method specifically carries out following steps successively:
1) 6 kinds of supressors to be detected and the nucleotide sequence of internal reference 18S rRNA is downloaded from NCBI website, clone corresponding full length sequence, total length primer is in table 1, and carry out sequence with the nucleotide sequence of DNAstar software to each strain of each supressor and internal reference and compare, find conserved regions; Probe differentiated by recycling Primer5.0 software two oligonucleotide that design is closely connected in often kind of supressor with the conserved regions of internal reference respectively, and often kind is designed two groups, specifically as shown in table 2:
The total length primer of target to be detected and connection product in table 1 the present invention
Remarks illustrate: UP is universal primer, and the object arranging internal reference is to play contrast effect.
The discriminating probe of table 2 the present invention design
2) universal primer, Tag1, Tag2 and the long sequence of weighting material is designed:
Universal primer is made up of upstream universal primer 5 ' >GGCATCGCATAACATAAGCA<3 ' and downstream universal primer 5 ' >GTCCGTCCAACCGTCTG<3 '.Tag1 and the complementation of downstream universal primer, Tag2 is identical with upstream universal primer.That is, Tag1 is: 5 ' >CAGACGGTTGGACGGAC<3 '.
The long sequence involving filler specifically5′>ATGGGGAGGGGAAGGGTTCAGTTGAAGAGGATCGAAAACAAAATCAACAGGCAGGTCACTTTCTCAAAGAGAAGGTCTGGTTTGCTGAAGAAAGCCCATGAGATCTCTGTGCTTTGTGATGCTGAGGTGGCTCTGATTGTTTTCTCTACCAAAGGGAAGGTCTTTGAGTATTCTACTGATTCTTGTATGGAAAGGATTCTTGAAAGGTATGAGAGATATTCATATGCAGAGAGGCAACTTATTGCACATGATCTCGAACAAAATGGAAGCTGGACTCTGGAGCATGCGAAGCTCAAGGCTAGGATGGAGATTTTACAAAGAAATCAAAAGTATTTCATGGGAGAAGATCTCGACTCCTTGAGTCTTAAAGAGCTTCAAAATTTGGAGCAGCAGCTTGATTCTGCTCTCAAACACATCAGGTCGAGAAAGAACCAAGTTATGCACGAATCCATTTCGGATCTTCAGAAAAAGGATAAGGCATTGCAGGAGCAAAACAACGTGCTTGCCAAGCAGGTGAAGGAGAAAGAAAAGGAATTACTTGCCGAACAGGCACAATGGGATATTCAGCATAATCAAACACTTGACACATCCTCTATCCTTCCACAAACGTTGCTGCCCTTGGACACTATTGGGACTGCGTCCTACCAAGCAATTAGAAGCAGCGAAAGAGAAGATGAGGCAAGACCATCTCGACATCGAGCCAATGCAGTACTCCTGCCCCCTTGGATGCTTAGCCATCTTGATTAATAG<3′,wherein 16kDa tRVweighting material is 594 ~ 719 bases, totally 126 bases; 2b cMVweighting material is 487 ~ 719 bases, totally 233 bases; P0 bWYVweighting material is 401 ~ 719 bases, totally 319 bases; 18S rRNA weighting material is 323 ~ 719 bases, totally 397 bases; HcPro pVYweighting material is 221 ~ 719 bases, totally 499 bases; P25 pVXweighting material is 114 ~ 719 bases, totally 606 bases; P0 pLRVweighting material is 4 ~ 719 bases, totally 716 bases.The long sequence of weighting material and universal primer are without any homology.
Weighting material connect differentiate with downstream respectively 3 ' of probe to hold, 5 ' the holding and be connected to form downstream LDR long probe of Tag1, upstream is differentiated that 5 ' end of probe is held with 3 ' of Tag2 and is connected to form upstream LDR probe, the probe of often kind of target assembling formation has two groups, obtains downstream long probe sequence in table 3 by asymmetric PCR amplification.
Table 3 middle and lower reaches long probe of the present invention sequence
Note: tag1=CAGACGGTTGGACGGAC.
Described upstream probe is specially table 4:
Table 4 middle and upper reaches probe sequence of the present invention
Note: tag2=GGCATCGCATAACATAAGCA.
3) extract suspected infection 50 parts of potato virus leaf textures total serum IgE and reverse transcription becomes cDNA
(1) potato leaf sample Total RNAs extraction
100mg blade lyophilized powder (liquid nitrogen grinding) is placed in 1.5ml EP pipe, adds 1ml Trizol immediately, homogenate is in placing 5min on ice.Add 200ul chloroform.Concuss 30s, be put in 5 ~ 10min on ice, after layering 4, DEG C centrifugal 20min of 12000r/min, get supernatant liquor in another 1.5ml centrifuge tube, add isopyknic Virahol (about 0.5ml) to mix gently, place 2h or-80 DEG C for-20 DEG C and place 1h, 4 DEG C of centrifugal 10min of 12000r/min, abandon supernatant, add 1ml75% washing with alcohol, mix gently, 4 DEG C of centrifugal 10min of 12000r/min, blot ethanol with rifle head, vacuum-drying 5-10min(object does not want overdrying), the RNA of gained is dissolved in 25 μ L DEPC aqua sterilisas.Rifle head involved by above-mentioned all operations and EP pipe all need 0.1%(w/v) process of DEPC aqua sterilisa.
(2) reverse transcription of total serum IgE
CDNA synthetic system (total reaction volume 20 μ L): by the total serum IgE 2.0 μ L of (1) gained, random primer (50 μMs) 1 μ L, 5 × RT Buffer4 μ L, dNTP (2.5m Μ) 4 μ L, Rnase Inhibior0.5 μ L, RNase1 μ L, DEPC H 2o7.5 μ L.Reaction conditions is 5min, 425 DEG C of 0min.Reaction gained transcription product-20 DEG C is saved backup.
3) by 7 of above-mentioned gained kinds of upstream probe and downstream long probe, (first group of probe all selected by often kind of target to be detected, second group is for subsequent use) carry out Ligase detection reaction (Ligase detection reaction, LDR) with the transcription product of 50 parts of potato viruses of above-mentioned suspected infection.
LDR reaction system
Actual conditions is: first carry out 95 DEG C of 3min reaction of degeneration, then 95 DEG C of 30s, 65 DEG C of 4min, carries out 35 circulations, obtains connecting product.
Remarks illustrate: the transcription product of each product as above operates respectively.
4) then product is connected with general upstream primer 5 ' >GGCATCGCATAACATAAGCA<3 ' with downstream universal primer 5 ' >GTCCGTCCAACCGTCTG<3 ' pcr amplification,
PCR amplification system is:
Pcr amplification condition is as follows: first carry out 95 DEG C of 3min reaction of degeneration, then 95 DEG C of 30s, 58 DEG C of 30s, 72 DEG C of 1min, carries out 35 circulations.Then get 5 μ l amplified productions and carry out electrophoresis.
Through running glue analysis, gained electrophoresis result is:
In 50 samples, that detects " 204bp " has 3 examples, " 312bp " has 2 examples, and " 398bp " has 4 examples, and " 578bp " has 5 examples, " 647bp " has 4 examples, " 793bp " has 2 examples, and wherein, having of " 204bp " and " 398bp " polyinfection is 2 routine, " 578bp " and " 647bp " polyinfection have 2 examples, " 204bp ", " 398bp " and " 578bp " polyinfection have 1 example.
In order to absolutely prove the superiority of the inventive method, contriver does following contrast experiment:
1. reference examples 1:
Adopt method based on normal PCR, respectively detection is carried out to the sample of the 50 routine suspected infection potato viruses identical with embodiment 1 and detect, determine that sample infects the kind of silencing suppressors.The kind of the silencing suppressors confirmed in potato virus at present has 6 kinds, is respectively Tobacco rattle virus 16kDa(16kDa tRV) gene, cucumber mosaic virus 2b(2b cMV) gene, the yellow of beet west virus P0(P0 bWYV) gene, marmor upsilon HcPro(HcPro pVY) gene, potato virus X P25(P25 pVX) gene, corium solani P0(P0 pLRV) gene.The conventional PCR method detection primer of 6 kinds of supressors and internal reference 18S rRNA is specifically as shown in table 1.
Compared with embodiment 1, reference examples 1 adopts traditional PCR method, and it is 100% that two kinds of methods detect coincidence rate, but PCR once can only detect a kind of target, detect 50 samples, 7 kinds of targets need the PCR of 350 times, operational cost duration, reagent consumption is many, although the present invention's step detecting step more than regular-PCR, but once can detect multiple target, operation total time is short, and reagent consumption is few, has the superiority on obvious method and cost.
2. reference examples 2:
Adopt the LDR-PCR universal genetic chip method (see, Wang Ping Biosen Bioelectron26:3719724 in 2011) of random primed reverse transcription, samples identical with enforcement 1 to 50 examples respectively detect, and determine the kind of the supressor that sample infects.The kind of the silencing suppressors confirmed in potato virus at present has 6 kinds, is respectively Tobacco rattle virus 16kDa(16kDa tRV) gene, cucumber mosaic virus 2b(2b cMV) gene, the yellow of beet west virus P0(P0 bWYV) gene, marmor upsilon HcPro(HcPro pVY) gene, potato virus X P25(P25 pVX) gene, corium solani P0(P0 pLRV) gene.
1) nucleotide sequence of above-mentioned 6 kinds of supressor sequences and internal reference 18S rRNA is downloaded from NCBI, and the nucleotide sequence of often planting each strain of supressor and internal reference with the comparison of DNAstar software carries out sequence alignment, find conserved regions, Primer5.0 software two oligonucleotide that design is closely connected in often kind of supressor with the conserved regions of internal reference are respectively utilized to differentiate probe, often kind is designed two groups, design 14 groups altogether, specifically as shown in table 2.
2) Zip code and the cZip code of universal primer and complete complementary is designed:
The Zip code of universal primer and complete complementary and cZip code each other and target sequence there is no the oligonucleotide of homology.CZip code differentiates that probe 3 ' is held respectively with downstream, 5 ' being connected respectively of Tag2, composition downstream probe; Upstream differentiates that probe 5 ' is connected to form upstream probe with 3 ' of Tag1.Tag2 is identical respectively with upstream universal primer, Tag1 and the complementation of downstream universal primer.Universal primer is made up of upstream universal primer 5 ' >GGCATCGCATAACATAAGCA<3 ' and downstream universal primer 5 ' >GTCCGTCCAACCGTCTG<3 '.
Probe is differentiated in the downstream of often kind of supressor and internal reference, Tag2 and Zip code is connected (30 groups) totally, form downstream probe; Upstream differentiates that probe and Tag1 form upstream probe.The upstream probe and downstream probe that utilize Primer5.0 to analyze to connect, unique optimum that screening meets target to be detected differentiates probe and Zip code sequence (see table 5).Zip code and cZip code is used for the connection product of the same primer amplification of hybridization check complementation, and Cleaning Principle and process are specifically see the article that Wang etc. delivers at Biosen Bioelectron26:3719-3724 for 2011.The connection product of the length ~ 100bp obtained by Ligase detection reaction is all containing a pair Tag sequence, one group of Zip-code sequence and a pair discriminating probe.Often kind of corresponding Zip-code of target to be detected
Table 5:Zip code and cZip code sequence
3) by step 2) in the upstream probe of gained and downstream probe and above-mentioned 50 routine detected sample transcription products put together and carry out Ligase detection reaction (Ligase detection reaction, LDR), actual conditions is: first carry out 95 DEG C of 3min reaction of degeneration, then 95 DEG C of 30s, 65 DEG C of 4min, carry out 35 circulations, obtain the connection product of length ~ 100bp.Only have when detecting that DNA mates completely with the complementary oligonucleotide adapters place corresponding position base of two, ligation just can be carried out, Zip code by the amplification of upstream and downstream universal primer and mark, then could be hybridized to the corresponding cZip code sequence probes on universal genetic chip; Otherwise then can not form connection product, Zip code can not be amplified.Wherein 5 ' of upstream universal primer end is carried out Cy5 fluorescent mark, completed by the raw work in Shanghai.
4) prepare general-purpose chip, particular content is as follows: adopt aldehyde group modified slide glass as solid phase carrier, holds (dT) respectively to it being fixed 3 ' corresponding to 6 kinds of supressors and internal reference 10nH 2zip code sequence as general-purpose chip.Being dissolved in the hybridization solution of 10 μ l through vacuum concentration containing Cy5 fluorescent mark pcr amplification product then by 25 μ l in step 3), hybridizes 3h with general-purpose chip at 42 DEG C.
5) use respectively subsequently after hybridizing in 0.2 × SSC and 0.1 × SSC and rinse 5 minutes; Dry up rear scanner with rubber suction bulb to scan.By scanner scanning, results of hybridization detects and adopts method well known in the art, adopts laser focusing scanner (GenPix Tm Personal4100A, Axon Instruments) sweep and read, obtain Cy5 image file, through software analysis, result fits like a glove with the result implementing 1.
Remarks illustrate: the present invention has following technical superiority relative to above-mentioned reference examples 2:
Compared with above-mentioned reference examples 2, testing cost of the present invention is cheap, does not need to carry out numerous and diverse operation such as Cy5 fluorescent mark, synthesis long probe, the some system of probe and hybrid optimization to the probe detected.Easily there is false positive in above-mentioned contrast 2 simultaneously, certainly will affect the reliability of detection in crossover process.The present invention is that a kind of multiplicity is good, high specificity, sensitivity is relatively high, simple and quick, cost is low detection method.
Finally, it is also to be noted that what enumerate above is only several specific embodiments of the present invention.Obviously, the invention is not restricted to above embodiment, many distortion can also be had.All distortion that those of ordinary skill in the art can directly derive from content disclosed by the invention or associate, all should think protection scope of the present invention.
<110> Zhejiang A & F University
 
<120> detects lot of trace target calibration method based on long probe simultaneously
 
<160> 14
 
<210> 1
<211> 20
<212> DNA
<213> artificial sequence
 
<220>
<223> 16 kDa tRVupstream differentiate probe
 
<400> 1
gtaaacgctt tgaagcaaga 20
 
 
<210> 2
<211> 20
<212> DNA
<213> artificial sequence
 
<220>
<223> 16 kDa tRVdownstream differentiate probe
 
<400> 2
aatcgagaaa tctggaaaca 20
 
 
<210> 3
<211> 23
<212> DNA
<213> artificial sequence
 
<220>
<223> 2b cMVupstream differentiate probe
 
<400> 3
ttaccgtttt atcagataga tgg 23
 
 
<210> 4
<211> 19
<212> DNA
<213> artificial sequence
 
<220>
<223> 2b cMVdownstream differentiate probe
 
<400> 4
ttcggaacta atagagatg 19
 
 
<210> 5
<211> 20
<212> DNA
<213> artificial sequence
 
<220>
<223> P0 bWYVupstream differentiate probe
 
<400> 5
acagtttcac ttgttcgttg 20
 
 
<210> 6
<211> 22
<212> DNA
<213> artificial sequence
 
<220>
<223> P0 bWYVdownstream differentiate probe
 
<400> 6
aaccgaccgc taacagctac ag 22
 
 
<210> 7
<211> 21
<212> DNA
<213> artificial sequence
 
<220>
Probe is differentiated in the upstream of <223> 18S rRNA
 
<400> 7
cgatcagata ccgtcctagt c 21
 
 
<210> 8
<211> 19
<212> DNA
<213> artificial sequence
 
<220>
Probe is differentiated in the downstream of <223> 18S rRNA
 
<400> 8
tcaaccataa acgatgccg 19
 
 
<210> 9
<211> 21
<212> DNA
<213> artificial sequence
 
<220>
<223> HcPro pVYupstream differentiate probe
 
<400> 9
tatgaaatcc gcaagcatcc a 21
 
 
<210> 10
<211> 19
<212> DNA
<213> artificial sequence
 
<220>
<223> HcPro pVYdownstream differentiate probe
 
<400> 10
aatggaacaa ggaaactct 19
 
 
<210> 11
<211> 21
<212> DNA
<213> artificial sequence
 
<220>
<223> P25 pVXupstream differentiate probe
 
<400> 11
gagtttagcc tagagcccca c 21
 
 
<210> 12
<211> 20
<212> DNA
<213> artificial sequence
 
<220>
<223> P25 pVXdownstream differentiate probe
 
<400> 12
ttctacttgg aaacatcatt 20
 
 
<210> 13
<211> 19
<212> DNA
<213> artificial sequence
 
<220>
<223> P0 pLRVupstream differentiate probe
 
<400> 13
ccgtgacctt atgggcaat 19
 
 
<210> 14
<211> 21
<212> DNA
<213> artificial sequence
 
<220>
<223> P0 pLRVdownstream differentiate probe
 
<400> 14
catcagcatt tggttcggtc t 21
 

Claims (3)

1. detect multiple target calibration method based on long probe, target is phytopathogen simultaneously; It is characterized in that comprising following characteristics:
1), obtain the nucleotide sequence of target to be detected and internal reference 18S rRNA thereof, utilize related software comparison often to plant the nucleotide sequence of each strain of target, obtain the conserved regions of often kind of target; The discriminating probe of two oligonucleotide be closely connected in the conserved regions design of often kind of target to be detected and internal reference 18S rRNA thereof again, namely upstream differentiates that probe is differentiated in probe and downstream, described upstream and downstream differentiate probe be join end to end for a pair and with the oligonucleotide of respective target sequence complementation, often kind of target to be detected and internal reference 18S rRNA thereof design two groups of upstream and downstream respectively and differentiate probes;
Discriminating probe is specific as follows:
2), design universal primer and the long sequence of Selective filling thing, described universal primer is made up of upstream and downstream universal primer, and described weighting material, universal primer and target sequence to be detected all do not form the oligonucleotide of stable space structure without homology; With upstream, 3 ' of universal sequence Tag2 differentiates that 5 ' of probe is connected to form upstream LDR probe, 5 ' of the long sequence of weighting material and universal sequence Tag1 holds and downstream differentiates that 3 ' of probe holds and be connected to form downstream LDR long probe; Universal sequence Tag1 and the complementation of downstream universal primer, universal sequence Tag2 is identical with upstream universal primer;
3), by upstream LDR probe carry out Ligase detection reaction with downstream LDR long probe together with target sample to be detected, obtain connecting product;
4), utilize upstream and downstream universal primer amplification to connect product, obtain stripe information by agarose nucleic acid electrophoresis, thus know hybrid target target infection conditions;
When there is the band identical with above-mentioned target length to be detected, being identified as and having infected this target to be detected;
Otherwise, when not there is any band, being identified as and not infecting target to be detected;
Described target to be detected is 16kDa tRV, 2b cMV, P0 bWYV, HcPro pVY, P25 pVX, P0 pLRV;
16kDa tRVconnecting product amplification length is 204bp; 2b cMVconnecting product amplification length is 312bp; P0 bWYVconnecting product amplification length is 398bp; It is 474bp that 18S rRNA connects product amplification length; HcPro pVYconnecting product amplification length is 578bp; P25 pVXconnecting product amplification length is 647bp; P0 pLRVconnecting product amplification length is 793bp;
The long sequence of described weighting material is a part for following sequence:
5′>ATG GGGAGGGGAAGGGTTCAGTTGAAGAGGATCGAAAACAAAATCAACAGGCAGGTCACTTTCTCAAAGAGAAGGTCTGGTTTGCTGAAGAAAGCCCATGAGATCTCTGTGCT T TGTGATGCTGAGGTGGCTCTGATTGTTTTCTCTACCAAAGGGAAGGTCTTTGAGTATTCTACTGATTCTTGTATGGAAAGGATTCTTGAAAGGTATGAGAGATATT CATATGCAGAGAGG CAACTTATTGCACATGATCTCGAACAAAATGGAAGCTGGACTCTGGAGCATGCGAAGCTCAAGGCTAGGATGGAGATTTTACAAAGAA ATCAAAAGTATTTCATGGGAGAAGATCTCGACTCCTTGAGTCTTAAAGAGCTTCAAAATTTGGAGCAGCAGCTTGATT CTGCTCTCAAA CACATCAGGTCGAGAAAGAACCAAGTTATGCACGAATCCATTTCGGATCTTCAGAAAAAGGATAAGGCATTGCAG GAGCAAAACAACGTGCTTGCCAAGCAGGTGAAGGAGAAAGAAAAGGAATTACTTGCCGAACAGGCACAATGGGATATTCAGCATAATCAAACACTTGACACATCCTC TATCCTTCCACAAACGTTGCTGCCCTTGGACACTATTGGGACTGCGTCCTACCAAGCAATTAGAAGCAGCGAAAGAGAAGATGAGGCAAGACCATCTCGACATCG CCCTTGGATGCTTAGCCATCTTGATTAATAG<3′；
Wherein 16kDa tRVweighting material is 594 ~ 719 bases, totally 126 bases; 2b cMVweighting material is 487 ~ 719 bases, totally 233 bases; P0 bWYVweighting material is 401 ~ 719 bases, totally 319 bases; 18S rRNA weighting material is 323 ~ 719 bases, totally 397 bases; HcPro pVYweighting material is 221 ~ 719 bases, totally 499 bases; P25 pVXweighting material is 114 ~ 719 bases, totally 606 bases; P0 pLRVweighting material is 4 ~ 719 bases, totally 716 bases;
The total length primer connecting product is specific as follows:
2. according to claim 1ly detect multiple target calibration method based on long probe simultaneously, it is characterized in that:
Described upstream universal primer is: 5 ' >GGCATCGCATAACATAAGCA<3 ', and downstream universal primer is:
5 ' >GTCCGTCCAACCGTCTG<3 '; Universal sequence Tag1 and the complementation of downstream universal primer, universal sequence Tag2 is identical with upstream universal primer.
3. according to claim 2ly detect multiple target calibration method based on long probe simultaneously, it is characterized in that: the connection product producing gradient length, often kind of fixing target of length correspondence, adopts the method for electrophoresis it can be distinguished clearly.
CN201310643752.5A 2013-12-03 2013-12-03 Detect lot of trace target calibration method based on long probe simultaneously Expired - Fee Related CN103642939B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201310643752.5A CN103642939B (en) 2013-12-03 2013-12-03 Detect lot of trace target calibration method based on long probe simultaneously

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201310643752.5A CN103642939B (en) 2013-12-03 2013-12-03 Detect lot of trace target calibration method based on long probe simultaneously

Publications (2)

Publication Number Publication Date
CN103642939A CN103642939A (en) 2014-03-19
CN103642939B true CN103642939B (en) 2015-08-26

Family

ID=50248219

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201310643752.5A Expired - Fee Related CN103642939B (en) 2013-12-03 2013-12-03 Detect lot of trace target calibration method based on long probe simultaneously

Country Status (1)

Country Link
CN (1) CN103642939B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105803114A (en) * 2016-04-18 2016-07-27 浙江理工大学 Porcine bocavirus detection and parting enrichment multiple PCR rapid diagnostic kit
CN106755443B (en) * 2016-12-30 2018-11-30 人和未来生物科技（长沙）有限公司 A kind of method and reagent of the super sensitivity detection trace amount DNA from a variety of hybrid dnas

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
同时检测猪圆环病毒2型、猪细小病毒和伪狂犬病毒连接酶检测反应-PCR基因芯片检测方法的建立;郭瑶等;《中国预防兽医学报》;20110731;第33卷(第7期);526-530 *
汪平.基于LDR-PCR通用寡核苷酸芯片同时检测十种马铃薯病毒研究.《中国优秀硕士学位论文全文数据库(农业科技辑)》.2012,(第6期), *
马铃薯卷叶病毒的RT-LDR-PCR 检测马铃薯卷叶病毒的RT-LDR-PCR检测;汪平等;《植物保护学报》;20111031;第38卷(第5期);471-472 *

Also Published As

Publication number Publication date
CN103642939A (en) 2014-03-19

Similar Documents

Publication Publication Date Title
CN101058833B (en) Primer system and method for detecting and analyzing avian influenza virus
CN104232798B (en) The multiple fluorescence quantitative PCR method of DHAV detection and Gene A type and the discriminating of C type and test kit
CN102352416B (en) Primer, probe and kit for detecting mouse hantaviruses
CN101260431A (en) Method for detecting transgene species based on rolling ring amplification technique
CN102559935A (en) M-gene based fluorescent RT-PCR (Reverse Transcription Polymerase Chain Reaction) detection method of Nipah virus
CN104178585A (en) Potato virus detection primers and potato virus detection method
CN110592268A (en) RAA constant temperature fluorescence detection method and reagent for lake luo virus (TiLV)
CN102251061A (en) Nucleic acid dual fluorescence PCR (Polymerase Chain Reaction) detection kit for influenza A/B virus
CN110184387B (en) RT-LAMP detection primer for detecting ANSVV, application thereof, detection reagent and detection method
CN103642939B (en) Detect lot of trace target calibration method based on long probe simultaneously
CN102286639A (en) Type A H1N1/influenza A virus nucleic acid dual fluorescent polymerase chain reaction (PCR) detection kit
CN104195269B (en) A kind of method detecting tomato spotted wilf virus
CN110387440B (en) Reagent for multiple detection of salmon and trout viruses and application thereof
CN110184386B (en) RT-LAMP (reverse transcription loop-mediated isothermal amplification) detection primer for detecting ANRSV (ANRSV), application thereof, detection reagent and detection method
CN108998575B (en) Establishment of double PCR detection method for chicken parvovirus and chicken newcastle disease virus
CN105255864A (en) Primer group and method for rapidly identifying influenza A virus subtypes through combination of DNA barcodes and second-generation high-throughput sequencing
CN109735658A (en) A kind of fluorescence quantitative RT-PCR detecting method of newcastle disease virus
CN103397106B (en) Hybridized snakehead fish rhabdovirus fluorescent quantificationally PCR detecting kit and detection method thereof
CN104451893A (en) Lily virus gene chip and preparation method thereof as well as method for detecting lily viruses using lily virus gene chip
CN104946799A (en) RT-LAMP (reverse transcription loop-mediated isothermal amplification) nucleic acid detection primers and kit of Hantaan viruses
KR20110039575A (en) Method for simultaneous detection of viroid pstvd and tcdvd
CN103757138A (en) Quick sensitive detection method of potato viruses
CN108998576A (en) For detect the specific primer of spring viremia of carp virus to, probe, detection kit
CN108866245B (en) Establishment of triple PCR detection method for chicken parvovirus, avian influenza virus and newcastle disease virus
CN103088150B (en) Primer, primer pair, method and kit for simultaneously detecting four viruses

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20150826

Termination date: 20171203

CF01 Termination of patent right due to non-payment of annual fee