CN103642916A - Method for quickly and effectively identifying genome E<e> of elytrigia desv. - Google Patents
Method for quickly and effectively identifying genome E<e> of elytrigia desv. Download PDFInfo
- Publication number
- CN103642916A CN103642916A CN201310640042.7A CN201310640042A CN103642916A CN 103642916 A CN103642916 A CN 103642916A CN 201310640042 A CN201310640042 A CN 201310640042A CN 103642916 A CN103642916 A CN 103642916A
- Authority
- CN
- China
- Prior art keywords
- genome
- pcr amplification
- plant
- genus agropyron
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the biotechnology field and relates to a method for quickly and effectively identifying a genome E<e> of elytrigia desv. The method comprises the following steps: S1. extracting genomic DNA (deoxyribonucleic acid) of an elytrigia desv. plant to be measured; S2. designing a PCR (polymerase chain reaction) amplification specific primer of the genome E<e> and carrying out PCR amplification; and S3. detecting and identifying the PCR amplification product through gel electrophoresis. By applying the primer, the method has the characteristics that the method has high accuracy, is stable in results and is not affected by environmental conditions, plant development stages and the like and can be used for quickly and accurately identifying whether polyploidy elytrigia desv. plants have the genome E<e>. The method helps solve the problems that a previous method for identifying a genome through genome in situ hybridization, specific sequence fluorescence in situ hybridization and whole genome Southern hybridization is tedious to operate, is greatly affected by human factors and is high in cost and a method for identifying a genome with a specific RAPD (random amplified polymorphic DNA) fragment of the genome is easily affected by the repetitive sequence of the genome and has low stability. The method is simple to operate, is single in the amplification product, has high repeatability, is small in template DNA amount and is economic and fast.
Description
Technical field
The invention belongs to biological technical field, be specifically related to a kind of Genus Agropyron E that effectively identifies fast
egenomic method.
Background technology
Wheat is the important food crop in the world, and China's cultivated area declines in recent years, and wheat breed genetic background is narrow, causes the total product of wheat and per unit area yield to occur the serious situation declining.Breed breeding is the main path that improves Per Unit Area Grain Yield with promoting.Realize the important breakthrough on breeding of new variety, must rely on initiative and the utilization of breeding novel material, and the innovation of breeding technique, its important foundation will be excavated and Innovation Germplasm resource exactly, strengthens the evaluation of valuable source and utilizes research.
Wild relatives in Triticeae contains abundant excellent genes, is the huge gene pool of Wheat Quality Improvement.Genus Agropyron (Elytrigia Desv.) is perennial wheat wild relative genus, is under the jurisdiction of Gramineae (Poaceae) Tribe Triticeae (Triticeae).Whole world Genus Agropyron approximately has 50 kinds, is distributed in temperate zone and refrigerant latitudes, and China has 10 kinds, and wherein 6 kinds have cultivation history, are mainly distributed in North China and the Northwest.This platymiscium strong adaptability, fecundity is strong, often do herbage, wherein a plurality of kinds is the important parent material of wheat distance edge hybrid, it is the important anti-source of Powdery Mildew, leaf rust, stripe rust and yellow dwart etc., also very strong to the resistibility of aphid, spend more in addition, long fringe, grain protein content is high and resistance to low-phosphorous Nutrient Stress, the good character such as cold-resistant, drought-enduring, is that the most successful wheat sibling species of wheat breeding utilization one of belongs to.
The basic genome of Genus Agropyron plant is St and E(E
e, E
b) genome, St genome comes from intends goose grass genus (Pseudoroegneria) plant, E
e, E
bsame genomic two modification, E
egenome comes from Diploid Thinopyron elongatum grass (Lophopyrum elongatum), E
bgenome is from diploid Piza couchgrass (Thinopyrum bessarabicum).Genus Agropyron polyploid plant consists of these three basi gene groups, but the composition of genome of polyploid plant is comparatively complicated, and the genome of some species does not still have consistent conclusion, has arguement.St genome and E have been studies have found that
e, E
bcan there is a large amount of pairings in genomic interchromosomal, during genomic in situ hybridization, cross hybridization can occur, and shows St genome and E
e, E
bgenome has higher similarity, so when making probe with St genomic dna, E genomic dna is blockaded when the higher Genus Agropyron plant of ploidy is carried out in situ hybridization, there will be all karyomit(e) to have hybridization signal, otherwise, with E genomic dna, make probe, St genomic dna is blockaded, and also occurs that all karyomit(e) has hybridization signal.Therefore, new, more effective method is to St and E
e, E
bgenome is identified, is familiar with the genome constitutions of polyploid Genus Agropyron plant, will contribute to put in order genome constitutions and the evolutionary history of Genus Agropyron plant, and the detection after exogenous genetic material in distant hybridization breeding is imported highly significant.
The careless platymiscium genome constitutions of laying down is at present complicated, St, E
eand E
bgenomic homology is high, thereby has limited the utilization of Genus Agropyron plant in breeding.
Summary of the invention
The invention provides a kind of Genus Agropyron E that effectively identifies fast
egenomic method.
The present invention effectively identifies Genus Agropyron E fast
egenomic method, its method comprises the steps:
The extracting genome DNA of S1, Genus Agropyron plant to be measured:
(1) get Genus Agropyron Young Plant leaflet tablet 3-5g to be measured, in liquid nitrogen, be ground to Powderedly, put into 50mL centrifuge tube;
(2) add 15mL to be preheated to 2 * CTAB damping fluid of 65 ℃, jog mixes, and 65 ℃ of water bath heat preservation 30min, shake up several times therebetween gently;
(3) add isopyknic chloroform and primary isoamyl alcohol mixed solvent, the volume ratio of chloroform and primary isoamyl alcohol is 24:1, shakes up to supernatant liquor and is creamy white, and 4 ℃, 10, the centrifugal 10min of 000g, gets supernatant;
(4) repeat above step, clarify to separation surface;
(5) add the pre-cold isopropanol of equal-volume, shake up, put into-20 ℃ of refrigerator precipitation 30min;
(6) tick DNA precipitation, with 70% alcohol, wash 2-3 time, dehydrated alcohol is washed 1-2 time;
(7) after air-dry, DNA is dissolved in to TE solution, is placed in-20 ℃ of refrigerators standby.
S2, design pcr amplification special primer and pcr amplification:
(1) Genus Agropyron E
ethe sequence of Genomic PCR amplifying specific primer:
PER1:CTACCTCCGTCCAGAAATAACT，
PEF1:CTCCCTCCCTCCAGAAATAACT；
(2) use above-mentioned special primer to carry out pcr amplification:
PCR reaction system 50 μ L, containing 10 * ExTaq buffer, MgCl
22mmol/L, dNTP200 μ mol/L, primer 0.4 μ mol/L, ExTaq enzyme 1.5U, the DNA of 100ng Genus Agropyron plant to be measured is template, adding redistilled water to final volume is 50 μ L;
(3) pcr amplification program:
94 ℃ of denaturation 4min; 94 ℃ of sex change 30sec, 55 ℃ of annealing 30sec, 72 ℃ are extended 1min, totally 35 circulations; 72 ℃ of insulation 10min;
S3, pcr amplification product is carried out to detected through gel electrophoresis and evaluation.
In the present invention, CTAB damping fluid composition is 100mmol/L Tris-HCl pH8.0,10mmol/L EDTA pH8.0, and 100mmol/L NaCl, mass concentration is 2%CTAB, with front adding mass concentration, is 2% beta-mercaptoethanol.
The present invention be take the genomic dna of Genus Agropyron plant to be measured as template, uses E
egenomic PCR amplifying specific primer carries out pcr amplification, the separated pcr amplification product of the agarose gel electrophoresis that is 1.0% by mass concentration, and gel imaging system is observed photographic recording.If obtain the pcr amplification product band of 110bp through electrophoresis detection, Genus Agropyron plant to be measured has E
egenome.
Advantage of the present invention and beneficial effect are as follows:
Development and Design of the present invention a kind of new special primer, can amplify Genus Agropyron E
ethe closely-related crucial band of genome, and banding pattern is clear, reproducible, reliability is strong, can be used as Genus Agropyron E
ethe special primer of genome identification.
The application of primer of the present invention, has that accuracy is high, result is stable, be not subject to the feature that affects in envrionment conditions and development of plants period etc., can identify quickly and accurately whether polyploid Genus Agropyron plant has E
egenome.
The present invention can be used for take the quick indoor evaluation of the distant hybrid progeny that Genus Agropyron plant is parent, just can to material, identify by PCR method in early days, strengthen the breeding utilization of Genus Agropyron plant, the exogenous genetic material that is conducive to improve Genus Agropyron plant imports the detection after wheat, the external source fragment determine importing and Fineness gene etc., the intermediate materials such as addition line, substitution line, translocation line and derivative offspring's thereof seed selection in assistant breeding.The invention solves the fluorescence in situ hybridization of genomic in situ hybridization technology, distinguished sequence in the past, the operation of full genome Southern hybridization identified gene prescription method is cumbersome, human factor impact is large, expense is high and the method for genome specific RAPD fragment identified gene group is subject to the impact of genome tumor-necrosis factor glycoproteins, the problems such as stability is not high, have the advantages such as simple to operate, amplified production is single, repeatability is high, template DNA consumption is few, economy is quick.
Accompanying drawing explanation
Fig. 1 is pcr amplification result gel electrophoresis figure; M in figure---500bp DNA molecular amount standard, 1---Diploid Thinopyron elongatum grass, 2---diploid Piza couchgrass, 3---the tetraploid wheat of laying down that grows thickly, 4---the tetraploid bulb wheat of laying down.
Embodiment
Below in conjunction with embodiment, the present invention is described in further detail, but limitation of the present invention not, all any this areas of doing according to the disclosure of invention be equal to replacement, all belong to protection scope of the present invention.
The experiment material of the present embodiment is Diploid Thinopyron elongatum grass, diploid Piza couchgrass, tetraploid wheat and the tetraploid bulb wheat of laying down of laying down that grows thickly.In the present embodiment, effectively identify fast Genus Agropyron E
egenomic method, comprises the following steps:
The extracting genome DNA of S1, Genus Agropyron plant to be measured:
(1) get respectively Diploid Thinopyron elongatum grass to be measured, diploid Piza couchgrass, tetraploid wheat and the tetraploid bulb wheat young leaflet tablet 3-5g that lays down that lays down of growing thickly, in liquid nitrogen, be ground to Powderedly, put into respectively 50mL centrifuge tube;
(2) in each 50mL centrifuge tube, add 15mL to be preheated to 2 * CTAB damping fluid of 65 ℃, jog mixes, and 65 ℃ of water bath heat preservation 30min, shake up several times therebetween gently;
(3) to adding isopyknic chloroform in each 50mL centrifuge tube: primary isoamyl alcohol (24:1, V:V), shake up to supernatant liquor and be creamy white, 4 ℃, the centrifugal 10min of 10,000g, gets supernatant;
(4) repeat above step, clarify to separation surface;
(5) in above-mentioned every portion of clear liquor, add the pre-cold isopropanol of equal-volume, shake up, put into-20 ℃ of refrigerator precipitation 30min;
(6) tick respectively DNA precipitation, wash 2-3 time successively respectively with 70% alcohol, dehydrated alcohol is washed 1-2 time;
(7) after respectively air-dry, DNA is dissolved in to TE solution, is placed in-20 ℃ of refrigerators standby.
S2, design pcr amplification special primer and pcr amplification:
(1) Genus Agropyron E
ethe sequence of Genomic PCR amplifying specific primer:
PER1:CTACCTCCGTCCAGAAATAACT，
PEF1:CTCCCTCCCTCCAGAAATAACT；
(2) use above-mentioned special primer to carry out pcr amplification:
PCR reaction system 50 μ L, containing 10 * ExTaq buffer5 μ L, MgCl
22mmol/L, dNTP200 μ mol/L, primer 0.4 μ mol/L, ExTaq enzyme 1.5U, Diploid Thinopyron elongatum grass to be measured, diploid Piza couchgrass, tetraploid the lay down DNA100ng of wheat of wheat and tetraploid bulb that lays down of growing thickly, adding redistilled water to final volume is 50 μ L;
(3) pcr amplification program:
94 ℃ of denaturation 4min; 94 ℃ of sex change 30sec, 55 ℃ of annealing 30sec, 72 ℃ are extended 1min, totally 35 circulations; 72 ℃ of insulation 10min;
S3, pcr amplification product is carried out to detected through gel electrophoresis and evaluation: the separated pcr amplification product of the agarose gel electrophoresis that is 1.0% by mass concentration, gel imaging system is observed photographic recording.
Experimental result is shown in Fig. 1, and swimming lane 1,3,4 is for containing E
egenomic Diploid Thinopyron elongatum grass, tetraploid bulb wheat and the tetraploid wheat of laying down that grows thickly of laying down, having size be the specific amplification products band of 110bp, swimming lane 2 is to contain E
bgenomic diploid Piza couchgrass, does not have the specific amplification products band of 110bp.
Claims (3)
1. effectively identify fast Genus Agropyron E for one kind
egenomic method, is characterized in that, comprises the steps:
S1, Genus Agropyron plant genome DNA to be measured extract:
(1) get Genus Agropyron Young Plant leaflet tablet 3-5g to be measured, in liquid nitrogen, be ground to Powderedly, put into 50mL centrifuge tube;
(2) add 15mL to be preheated to 2 * CTAB damping fluid of 65 ℃, jog mixes, and 65 ℃ of water bath heat preservation 30min, shake up several times therebetween gently;
(3) add isopyknic chloroform and primary isoamyl alcohol mixed solvent, the volume ratio of chloroform and primary isoamyl alcohol is 24:1, shakes up to supernatant liquor and is creamy white, and 4 ℃, 10, the centrifugal 10min of 000g, gets supernatant;
(4) repeat above step, clarify to separation surface;
(5) add the pre-cold isopropanol of equal-volume, shake up, put into-20 ℃ of refrigerator precipitation 30min;
(6) tick DNA precipitation, with 70% alcohol, wash 2-3 time, dehydrated alcohol is washed 1-2 time;
(7) after air-dry, DNA is dissolved in to TE solution, is placed in-20 ℃ of refrigerators standby.
S2, design pcr amplification special primer and pcr amplification:
(1) Genus Agropyron E
ethe sequence of Genomic PCR amplifying specific primer:
PER1:CTACCTCCGTCCAGAAATAACT，
PEF1:CTCCCTCCCTCCAGAAATAACT；
(2) use above-mentioned special primer to carry out pcr amplification:
PCR reaction system 50 μ L, containing 10 * ExTaq buffer, MgCl
22mmol/L, dNTP200 μ mol/L, primer 0.4 μ mol/L, ExTaq enzyme 1.5U, the DNA of 100ng Genus Agropyron plant to be measured is template, adding redistilled water to final volume is 50 μ L;
(3) pcr amplification program:
94 ℃ of denaturation 4min; 94 ℃ of sex change 30sec, 55 ℃ of annealing 30sec, 72 ℃ are extended 1min, totally 35 circulations; 72 ℃ of insulation 10min;
S3, pcr amplification product is carried out to detected through gel electrophoresis and evaluation, if obtain the pcr amplification product band of 110bp through electrophoresis detection, described Genus Agropyron plant to be measured has E
egenome.
2. the Genus Agropyron E that identifies fast effectively according to claim 1
egenomic method, is characterized in that: electrophoresis detection described in step S3 is that the agarose gel electrophoresis that is 1.0% by mass concentration detects.
3. the Genus Agropyron E that identifies fast effectively according to claim 1
egenomic method, it is characterized in that: be that to take the genomic dna of Genus Agropyron plant to be measured be template, with pcr amplification special primer described in step S2, carry out pcr amplification, if obtain the pcr amplification product band of 110bp through electrophoresis detection, described Genus Agropyron plant to be measured has E
egenome.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310640042.7A CN103642916B (en) | 2013-12-03 | 2013-12-03 | Method for quickly and effectively identifying genome E<e> of elytrigia desv. |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310640042.7A CN103642916B (en) | 2013-12-03 | 2013-12-03 | Method for quickly and effectively identifying genome E<e> of elytrigia desv. |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103642916A true CN103642916A (en) | 2014-03-19 |
| CN103642916B CN103642916B (en) | 2015-03-25 |
Family
ID=50248196
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310640042.7A Expired - Fee Related CN103642916B (en) | 2013-12-03 | 2013-12-03 | Method for quickly and effectively identifying genome E<e> of elytrigia desv. |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103642916B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104745695A (en) * | 2015-03-23 | 2015-07-01 | 湖北大学 | Method for interspecific hybrid genome in-situ hybridization of crambe cordifolia |
| CN109295251A (en) * | 2018-11-06 | 2019-02-01 | 西北农林科技大学 | Quasi- roegneria kamoji molecular specificity labeled primers, application method and its application |
| CN110129473A (en) * | 2019-04-29 | 2019-08-16 | 四川农业大学 | A kind of E. elongata EeGenome specific molecular labeling and its application |
| CN114277181A (en) * | 2022-01-21 | 2022-04-05 | 四川农业大学 | Specific molecular marker for detecting elytrigia repens 7StL chromosome and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1092782A2 (en) * | 1999-10-15 | 2001-04-18 | Hitachi, Ltd. | Genetic screening method and genetic screening apparatus |
| CN101760513A (en) * | 2008-11-19 | 2010-06-30 | 李祥 | Chromosome mapping and molecule marking research on powdery mildew resisting gene of Elytrigia intermedium |
-
2013
- 2013-12-03 CN CN201310640042.7A patent/CN103642916B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1092782A2 (en) * | 1999-10-15 | 2001-04-18 | Hitachi, Ltd. | Genetic screening method and genetic screening apparatus |
| CN101760513A (en) * | 2008-11-19 | 2010-06-30 | 李祥 | Chromosome mapping and molecule marking research on powdery mildew resisting gene of Elytrigia intermedium |
Non-Patent Citations (1)
| Title |
|---|
| 张超: "长穗偃麦草E组染色体特异性PCR标记开发", 《全国优秀硕士论文数据库农业科技辑》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104745695A (en) * | 2015-03-23 | 2015-07-01 | 湖北大学 | Method for interspecific hybrid genome in-situ hybridization of crambe cordifolia |
| CN104745695B (en) * | 2015-03-23 | 2016-11-02 | 湖北大学 | A kind of method of Crambe abyssinica species hybrid genomic in situ hybridization |
| CN109295251A (en) * | 2018-11-06 | 2019-02-01 | 西北农林科技大学 | Quasi- roegneria kamoji molecular specificity labeled primers, application method and its application |
| CN110129473A (en) * | 2019-04-29 | 2019-08-16 | 四川农业大学 | A kind of E. elongata EeGenome specific molecular labeling and its application |
| CN114277181A (en) * | 2022-01-21 | 2022-04-05 | 四川农业大学 | Specific molecular marker for detecting elytrigia repens 7StL chromosome and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103642916B (en) | 2015-03-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107012243A (en) | A kind of molecular labeling for identifying the true hybrid of lichee and its application | |
| CN108588272A (en) | A kind of molecular labeling and its application with Plant Height in Wheat and spike length character main effect QTL compact linkage | |
| CN102888400B (en) | Long rachis elytrigia repens 7E chromosome specific molecular marker based on SLAF-seq development and application thereof | |
| CN103642916B (en) | Method for quickly and effectively identifying genome E<e> of elytrigia desv. | |
| CN106048056B (en) | A kind of significant relevant SNP marker of wheat seed suspend mode duration and its CAPS label and application | |
| CN103409418B (en) | With the closely linked molecule marker of rice big grain gene GS2 and application thereof | |
| CN109929945A (en) | The molecular labeling BrSF2604 primer and its application in cabbage type rape florescence and maturity period main effect QTL site | |
| CN107674922A (en) | Cucumber anti cucumber mosaic virus ospc gene cmv InDel marks and its application | |
| CN106498048A (en) | A kind of QTL related to soybean nodulation number, SNP marker and application | |
| CN108384873A (en) | SSR marker and method for the green phoenix hybrid seed purity identification of watermelon | |
| CN110878300A (en) | DNA marker closely linked with wheat 7DL chromosome gibberellic disease resistant gene and application thereof | |
| CN105506075A (en) | SNP (Single Nucleotide Polymorphism) marker related to resistance to alternaria kikuchiana and application | |
| CN105063201A (en) | Molecular marker of corn chromosome 9 ear row number major QTL and application thereof | |
| CN101845504B (en) | Primer sequence for identifying resistance of cucumber against alternaria cucumerina and identification method thereof | |
| CN108179221A (en) | Detect the specific molecular marker of high mass of 1000 kernel allele on rice mass of 1000 kernel QTL qTGW10.2a | |
| CN107988423A (en) | The SNP marker of rice non-transgenic anti-herbicide gene OsALS and its application | |
| KR20150121794A (en) | Primer set for selecting cucumber downy mildew disease resistant variety and selection method using the same | |
| CN105567790B (en) | The selection of the plant of DNA fragmentation containing target gene group | |
| CN102925440B (en) | SLAF-seq-based developed elytrigia elongata 1E chromosome specific molecular markers and application thereof | |
| CN103131755A (en) | Method for rapidly detecting brassica oleracea var. italic hybrid purity by using SRAP mark | |
| CN108728576B (en) | Marker of wheat chlorophyll content related gene and application thereof | |
| KR20130091434A (en) | Primer for selecting variety resistant to rice stripe disease containing stv-bi gene and the selecting method thereof | |
| CN102676515B (en) | Lophopyrum elongatum genome-specific molecular markers and application thereof | |
| CN106244683B (en) | Primer for detecting " Qiong Li " small watermelon purity of hybrid combines and its methods and applications | |
| Jiang et al. | Analysis of genetic diversity of salt-tolerant alfalfa germplasms |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150325 Termination date: 20201203 |