CN103642827B - RNA interference vector suitable for herbicide selection marker Bar gene - Google Patents

Abstract

The invention relates to an RNA interference vector suitable for a herbicide selection marker Bar gene. The RNA interference vector includes a paddy rice GAS1 gene LOC-Os01g68860 intron, upstream multi-cloning sites and downstream multi-cloning sites, wherein the upstream multi-cloning sites and the downstream multi-cloning sites are respectively located at two sides of the paddy rice GAS1 gene intron; a nucleotide sequence of the paddy rice GAS1 gene LOC-Os01g68860 intron comprises 9621st-10099th nucleotides from the 5' terminal of a sequence 1 in a sequence table. Compared with an annular-structure RNA interference vector adopting a GUS gene as shRNA, the annular-structure RNA interference vector applying the gene intron as the shRNA has higher interference efficiency, at the same time, allows the experimental operation to become simple and easy to implement, so as to be beneficial for reducing errors and improving the work efficiency.

Description

The rna interference vector of suitable herbicide selection marker Bar gene

Technical field

The present invention relates to a kind of rna interference vector of suitable herbicide selection marker Bar gene, belongs to Plant Biotechnology Field.

Background technology

Conventional plant RNA interference carrier is except core parts, such as promoter, polyclone essential to conventional binary vector Site, outside resistant maker gene, also comprising section of DNA sequence as shRNA（Short hairpin RNA, short hairpin RNA）'s Circulus.Plant RNA i interference carriers are typically with the GUS of antibacterial（Turn beta-Glucuronidase）Genetic fragment or plant gene Intron is used as circulus.Compared with the rna interference vector with gus gene as the circulus of shRNA, with band montage position The gene intron of point has higher jamming effectiveness as the rna interference vector of the circulus of shRNA.

In engineered continuous evolution, with scientific and technical each branch continuous development and people to gene Function understanding deepens continuously, and selectable marker gene is also at during constantly development is improved.Till now in gene work The selectable marker gene widely applied in journey operation can substantially be divided into four classes：Be respectively antibiotics resistance gene, herbicide resist Property gene, compound detoxifying gene and plant saccharide metabolic enzyme gene.They can rise on corresponding Selective agar medium To the effect of label so that meet that the cell of our conditions can project displays.Wherein, Bar genes and careless fourth phosphine sieve System is selected to be that at present most widely used classes of herbicides selected marker screens system.

Exogenous sequences are being cloned in the molecular biology manipulations of carrier, homologous recombination directed cloning and double digestion connect It is two kinds of conventional cloning process.The latter is compared, the former advantage is need not to be cloned with digestion with restriction enzyme purpose Fragment, overcomes the restriction of restriction enzyme site, while reducing operating procedure, contributes to reducing workload, improves work efficiency.

The content of the invention

It is an object of the invention to provide a kind of rna interference vector of suitable herbicide selection marker Bar gene, it is included Design, clone's target gene interference fragment, screen the recombinant vector containing target gene interference fragment, detection transgenic interference plant etc. The standardized method of sequence of operations；And in screening containing target gene interference fragment recombinant vector, detection transgenic interference plant Etc. the PCR detection primers used in application process.When using the rna interference vector, experimental implementation becomes simple, has Beneficial to error is reduced, work efficiency is improved.

The technical scheme is that what is be achieved in that：A kind of RNA interference of suitable herbicide selection marker Bar gene is carried Body, nucleotides sequence is classified as the sequence 1 in sequence table, including the basic framework of pTF101.1 carriers, 35s promoteres and Oryza sativa L. GAS1 gene LOC_Os01g68860 introns, the upstream multiple clone site positioned at the Oryza sativa L. GAS1 gene introns both sides and Multicloning sites downstream；

The nucleotides sequence of the Oryza sativa L. GAS1 gene introns is classified as in sequence table sequence 1 from 5 ' end 9621-10098 positions Nucleotide；

The upstream multiple clone site is BamHI, SmaI（XmaI）And MluI；

The multicloning sites downstream is HpaI, SpeI and SacI；

The promoter of the interference carrier is 35s promoteres.

The rna interference vector pLYZRNAi that the present invention is provided, is prepared as follows：

DNA fragmentation 1 and pTF101-35s carrier frameworks are co-cultured, the carrier for obtaining；

The DNA fragmentation 1 includes fragment a containing upstream multiple clone site, Oryza sativa L. GAS1 genes（LOC_ Os01g68860）Intron, the composition of fragment b containing multicloning sites downstream；

The Oryza sativa L. GAS1 genes（LOC_Os01g68860）The nucleotides sequence of intron is classified as sequence 1 from 5 ' in sequence table End 9621-10098 positions；

The nucleotides sequence of fragment a is classified as in sequence table sequence 1 from 5 ' end 9591-9620 positions；

The nucleotides sequence of fragment b is classified as in sequence table sequence 1 from 5 ' end 10099-10129 positions,

The nucleotides sequence of the DNA fragmentation 1 is classified as sequence 2 in sequence table；

The upstream multiple clone site is BamHI, SmaI（XmaI）And MluI；

The multicloning sites downstream is HpaI, SpeI and SacI.

Second object of the present invention is to provide a kind of recombinant vector.

The recombinant vector that the present invention is provided, prepares according to following I or II method：

I comprises the steps：

1）DNA fragmentation 2 is inserted into the upstream multiple clone site of described interference carrier, is obtained containing the downstream polyclone The intermediate carrier A in site；

2）By the inserting step 1 of DNA fragmentation 3）The multicloning sites downstream of the intermediate carrier A for obtaining, obtains restructuring and carries Body；

II comprises the steps：

A, the multicloning sites downstream that DNA fragmentation 3 is inserted described interference carrier, obtain containing the upstream polyclone The intermediate carrier B in site；

The upstream multiple clone site of B, the intermediate carrier B for obtaining inserting step A of DNA fragmentation 2, obtains restructuring and carries Body；

The DNA fragmentation 2 includes target protein encoding gene segment and respectively positioned at target protein encoding gene both sides It is described respectively positioned at target protein encoding gene segment both sides for insertion vector for 2 kinds of DNA moleculars of insertion vector 2 kinds of DNA moleculars include at least one restriction enzyme site and the interference carrier in the upstream multiple clone site or with it is described Intermediate carrier B homologous nucleotide；

The DNA fragmentation 3 includes the reverse complemental fragment of target protein encoding gene and is located at the target protein respectively 2 kinds of DNA moleculars for insertion vector of the reverse complemental fragment both sides of encoding gene, it is described to be located at the target protein respectively 2 kinds of DNA moleculars for insertion vector of the reverse complemental fragment both sides of encoding gene include the multicloning sites downstream In at least one restriction enzyme site and the interference carrier or the nucleotide homologous with the intermediate carrier A；

The nucleotides sequence of the DNA fragmentation 2 is classified as sequence 4 in sequence table；

The nucleotides sequence of the DNA fragmentation 3 is classified as sequence 5 in sequence table.

The DNA fragmentation 2 can also be inserted in interference carrier multicloning sites downstream, and the DNA fragmentation 3 can also be inserted in dry Carrier upstream multiple clone site is disturbed, as long as sense fragment and antisense fragments is in opposite direction.

In the structure of above-mentioned recombinant vector, existing homologous recombination sequence has double digestion position again in DNA fragmentation 2 and DNA fragmentation 3 Point, you can at the multiple clone site by homologous recombination insertion vector, obtain recombinant vector；Again can be by double digestion and process The carrier connection that same enzyme action is obtained, obtains recombinant vector.

Described interference carrier and/or the recombinant vector are in plant transgene breeding and/or identification gene function Using.

During application of the recombinant vector in plant transgene breeding and/or gene functional research is to suppress purpose plant Target gene expression, obtain transgenic plant；The plant height of the transgenic plant is less than the purpose plant；The suppression mesh Plant in target gene expression method be by proceed to in the purpose plant recombinant expression carrier realize.

The nucleotides sequence of the target gene is classified as sequence 3 in sequence table；

The purpose plant is monocotyledon or dicotyledon, and the dicotyledon is preferably Semen sojae atricolor.

It is demonstrated experimentally that the present invention uses it to structure is directed to regulation protein and oil in soybean oil route of synthesis metabolism Fat content ratio key gene phosphoric acid enol pyruvic acid carboxylase (Phosphoenolpyruvate carboxylase, PEPc）Rna interference vector, then in soybean transformation receptor kind Williams82.Rna interference vector expresses shape in receptor Into shRNA siRNA is cut into by Dicer enzymes（Small interfering RNA, disturb tiny RNA）；SiRNA can specificity Suppress the expression of target gene, so that oil content increases in soybean kernel, and then the purpose of GmPEPc gene functions.

Compared with existing plant RNA interference carrier, good effect of the present invention is：

1st, using 35s strong promoters.The expression of shRNA can be significantly improved using the rna interference vector, so as to improve target The jamming effectiveness of gene, strengthens interference effect, and the carrier is particularly well-suited to the dicotyledons such as arabidopsiss, Semen sojae atricolor.

2nd, using Oryza sativa L. GAS1 genes intron as shRNA circulus.During intron montage, ShRNA target genes justice and being mutually paired for antisense sequences are strengthened, and be increased shRNA and are cut into siRNA by Dicer enzymes Probability, so as to improve the jamming effectiveness of target gene, strengthen interference effect.

3rd, respectively with the addition of digestion with restriction enzyme at the left and right sides multiple clone site of carrier GAS1 gene introns Site, facilitates the clone of target gene interference fragment.

4th, when target gene interference fragment PCR primer is designed, homologous recombination sequence and double digestion are introduced simultaneously in primer Site.The visual concrete condition of subsequent experimental not only operates spirit from homologous recombination directed cloning or double digestion connection cloning process It is living, and overcome the restriction of restriction enzyme site with homologous recombination directional cloning method.

5th, the present invention includes design, clone's target gene interference fragment, screens the recombinant vector containing target gene interference fragment, The standardized method of the sequence of operations such as detection transgenic interference plant；And carry containing the restructuring of target gene interference fragment in screening PCR detection primers used in the application processes such as body, detection transgenic interference plant.It is real when using the rna interference vector Testing operation becomes simple, advantageously reduces error, improves work efficiency.

Description of the drawings

Fig. 1 is the structure flow chart of pLYZRNAi carriers.

Fig. 2 is the structural representation of pLYZRNAi carriers.

Fig. 3 identifies electrophoretogram for the enzyme action of pLYZRNAi recombinant vectors.

Fig. 4 is the structure flow chart of pLYZRNAi-GmPEPc carriers.

Fig. 5 is pLYZRNAi-GmPEPc carrier structure schematic diagrams.

Fig. 6 identifies electrophoretogram for the enzyme action of pLYZRNAi-GmPEPc recombinant vectors.

PCR shown in Fig. 7 identifies pLYZRNAi-sense-GmPEPc recombinant vectors.

PCR shown in Fig. 8 identifies pLYZRNAi-GmPEPc recombinant vectors.

Fig. 9 is Genetic Transformation of Soybean flow chart.

Figure 10 is that PCR detects T1 for transgenic progeny material.

Specific embodiment

With reference to the accompanying drawings and examples the invention will be further described：Experimental technique used in embodiment is such as Without specified otherwise, conventional method is；And material used, reagent etc. in embodiment, if no special instructions, can be from business Approach is obtained.

The structure of embodiment 1, rna interference vector pLYZRNAi

Rna interference vector pLYZRNAi is with the method for homologous recombination directed cloning, by the intron of Oryza sativa L. GAS1 genes Forward direction is cloned in the plant expressing vector pTF101-35s with Bar labellings（Fig. 1 is experiment flow figure）, rna interference vector The structural representation of pLYZRNAi is as shown in Fig. 2 concrete grammar is as follows：

1st, Oryza sativa L. GAS1 genes LOC_Os01g68860 includes the acquisition of sub-piece

Synthesize the intron sequences of Oryza sativa L. GAS1 genes using synthetic gene technology, and in two sections of sequence plus used Multiple clone site a and b, be sequence 2；Then BamI and SacI enzymes design amplification intron is selected according to pTF101-35s carriers Primer sequence it is as follows（BamI and SacI restriction enzyme sites both sides is homologous on letter representation pTF101-35s carriers with underscore Recombination sequence.）：

GAS1 intron-F：5'-TAGAAACAGAGGATCCGGATCCAACAGCCCCGGGAA-3'；

GAS1 intron-R：5'- GATCGGGGAAATTCGAGCTCGAGCTCTCTAGAACTAGTATCGATG-3'。

PCR amplification programs：94 ℃ 2 min；98 DEG C of 10 sec, 60 DEG C of 5 sec, 72 DEG C of 1.5 min again, 30 Circulation；Last 72 DEG C of 7 min.

DNA with above-mentioned synthetic as template, using above-mentioned PCR amplification programs, with GAS1 intron-F and GAS1 Intron-R as primer enter performing PCR amplification, electrophoresis result referring to Fig. 3 in the 5th swimming lane, be the purpose band piece of amplification gene Section.

The upstream multiple clone site is（BamI, SmaI and MluI）；

The multicloning sites downstream is（SacI, SpeI and HpaI）.

Reclaim PCR primer standby.

2nd, the preparation of BamI and SacI enzyme action pTF101-35S linear carriers

Using BamI the and SacI restricted enzyme of Co., Ltd in NEB, enzyme action pTF101-35S carriers（Electrophoresis is examined Survey 2 swimming lanes such as Fig. 3）（Paz, M., Martinez, J. C., Kalvig, A., Fonger, T., Wang, K. (2010) Agrobacterium-mediated transformation of soybean and recovery of The transgenic soybean plants. public can obtain from Jilin Academy of Agricultural Science agro-ecology institute.）, reclaim It is standby through the pTF101-35S linear carriers of enzyme action.3 swimming lanes of electrophoresis detection such as Fig. 3.

3rd, the acquisition of pLYZRNAi recombinant vectors

1）The homologous recombination directed cloning of GAS1 gene introns

Step 1 is obtained using the CloneEZ homologous recombination directed cloning test kits of Co., Ltd in GenScript The linear carrier of the recovery that the PCR primer of recovery is obtained with step 2 carries out homologous recombination reaction, and reaction system is as shown in table 1：

The homologous recombination reaction system of table 1

The operating procedure of homologous recombination directed cloning is as follows：

（1）Each reactive component in above-mentioned reaction system is prepared in 1.5 ml centrifuge tubes, it is slight to mix, by sample 22 The min of recombining reaction 30 in DEG C water-bath；

（2）After reaction terminates, sample is placed on and be incubated on ice 5 min.

（3）By step（2）The product for obtaining proceeds to TransT1-1 competent cells（Purchased from the full formula gold biotechnology in Beijing Company limited）In, obtain transformant.

2）Identification pLYZRNAi recombinant vectors, electrophoresis result is shown in Fig. 3

Above-mentioned transformant is selected, is inoculated in the LB fluid mediums containing spectinomycin, incubated overnight；Take incubated overnight Bacterium solution, using GAS1 intron-F and GAS1intron-R primers, carries out pcr amplification reaction as PCR reaction template.

As a result as shown in figure 3, PCR and enzyme action detect pTF101-35S carriers and GAS1 gene intron PCR augmentation detections, 1：Trans 15K DNA marker；2：The pTF101-35s zero load body constitution of the pTF101-35S without GAS1 gene introns Grain；3：PTF101-35S recombinant vectors containing GAS1 gene introns（pLYZRNAi）Plasmid；4：BamI and SacI enzyme action PLYZRNAi results；5：The PCR primer of GAS1 genes；6：DL2000 DNA marker.

The plasmid is sent to into sequencing, sequencing primer is Left MCS-F and Right MCS-R（Primer sequence and carrier Fragment on pTF101-35S matches）, primer sequence is as follows：

Left MCS-F：5'-CGCACAATCCCACTATCCTT-3'；

Right MCS-R：5'-AAGACCGGCAACAGGATTC-3'.

Sequencing result shows that the plasmid is by the sequence 2 in sequence table（Include containing GAS1 gene LOC_Os01g68860 Sub-piece）It is cloned into the recombinant vector obtained at BamI the and SacI restriction enzyme sites of pTF101-35S carriers, and by GAS1 genes LOC_Os01g68860 includes sub-piece and is cloned into behind the 35s promoteres of pTF101-35S carriers, and the plasmid is named as PLYZRNAi, as rna interference vector, sequence 1.The structural representation of the carrier as shown in Fig. 2 as seen from the figure, the carrier With upstream multiple clone site and multicloning sites downstream.

The application of embodiment 2, rna interference vector pLYZRNAi

First, the structure of GmPEPc gene RNAs interference carrier pLYZRNAi-GmPEPc, builds flow process referring to Fig. 4, and structure is shown Intention is shown in Fig. 5, and PCR and enzyme action qualification result are shown in Fig. 6.

1st, the acquisition of GmPEPc genes interference fragment

Phosphoric acid enol pyruvic acid carboxylase PEPc participates in protein, the regulation and control of fat content ratio, suppression in plant seed The expression of PEPc processed is the effective way for improving grain oil content.

1）Design of primers

1）Primer used by amplification GmPEPc gene justice interference fragments

In the upstream multiple clone site of the letter representation pLYZRNAi carriers with underscore, select BamI and SmaI restricted Inscribe cleavage sites（Can be cloned on carrier by Homo~logous exchange or double digestion connection）, left oblique line represent BamI and SmaI limit Property inscribe enzyme action processed, primer sequence is as follows：

GmPEPc-RNAi-sense-F：5'-TAGAAACAGAGGATC/CGCTGGAGATTCCATTGTGGT-3'（This draws Thing contains BamHI restriction enzyme sites）；

GmPEPc-RNAi-sense-R：5'-GCGTGCTGTTCCCGG/GCCTTCCATGTTTTTGAAGCAA-3'（This draws Thing contains SamI restriction enzyme sites）.

The PCR primer that existing homologous recombination sequence has restriction enzyme site, the later stage again in primer above can both pass through homologous heavy Group is connected with carrier, also can be connected with carrier by double digestion connection.

（2）Primer used by amplification GmPEPc gene antisense interference fragments

On the multicloning sites downstream of the letter representation pLYZRNAi carriers with underscore, SpeI and SacI restriction enzyme sites two The homologous recombination sequence of side（Can be by homologous same group directed cloning on carrier）, left oblique line represent SpeI and SacI it is restricted in Enzyme cutting cleavage site（Can be cloned on carrier by double digestion connection）, primer sequence is as follows：

GmPEPc-RNAi-antisense-F：

5'-TAACATCGATACTAGT/GCTGGAGATTCCATTGTGGT-3'（This primer contains SpeI restriction enzyme sites）；

GmPEPc-RNAi-antisense-R：

5'-GATCGGGGAAATTCG/AGCTCCCTTCCATGTTTTTGAAGCAA-3'（This primer contains SacI enzyme action position Point）.

The PCR primer that existing homologous recombination sequence has restriction enzyme site, the later stage again in primer above can both pass through homologous heavy Group is connected with carrier, also can be connected with carrier by double digestion connection.

2）The extraction of the seedling RNA of soybean varieties Williams 82 and the preparation of cDNA

Using RNA prep pure plant total RNA extraction reagent boxes（Purchased from Tiangeng biochemical technology（Beijing）Company limited）, 30 days seedling RNA of Semen sojae atricolor Williams 82 are extracted, reverse transcription obtains cDNA.

3）PCR expands GmPEPc gene interference fragments

With cDNA as template, enter performing PCR with GmPEPc-RNAi-sense-F and GmPEPc-RNAi-sense-R primers and expand Increase, obtain PCR primer 1.With cDNA as template, with GmPEPc-RNAi-antisense-F and GmPEPc-RNAi- Antisense-R primers enter performing PCR amplification, obtain PCR primer 2.

PCR primer 1 and 2 is separately recovered, and sends to sequencing, as a result show PCR primer 1 with shown in sequence 4 in sequence table Nucleotide（A part in the sequence i.e. sequence 3, adds the carrier pLYZRNAi upstreams polyclone position needed for cloned sequence The homologous recombination sequence of BamHI, SmaI restriction enzyme site both sides of point）；Sequence 4 from 5 ' end 17-316 positions nucleotide be sequence The sequence from 5 ' end 701-1414 positions nucleotide of row 3.）, the as justice GmPEPc gene interference fragments of PCR primer 1； PCR primer 2 has nucleotide shown in sequence 5 in sequence table（The sequence is the part in sequence 3, and added by sequence two ends Cloned sequence needed for carrier pLYZRNAi multicloning sites downstreams SpeI and SacI double enzyme sites both sides it is homologous heavy Group sequence）, it is the reverse complemental fragment of sequence 4.Sequence 5 it is last from 5 ' for sequence 3 from 5 ' end 19-732 positions nucleotide The reverse complemental fragment of 701-1414 positions nucleotide is held, therefore PCR primer 2 is antisense GmPEPc gene interference fragments.

The acquisition of the pLYZRNAi-sense-GmPEPc recombinant vectors the 2nd, with GmPEPc genes justice interference fragment

1）The homologous recombination directed cloning of GmPEPc genes justice interference fragment

The pLYZRNAi carriers obtained with BamHI and SmaI enzyme action example 1, obtain linear pLYZRNAi, reclaim stand-by.

Using double methods for cutting doubly-linked or homologous recombination directed cloning（Concrete steps and reaction system are shown in the 3 of embodiment 1）, First the PCR primer 1 and linear pLYZRNAi of recovery are carried out into homologous recombination reaction, then homologous recombination product is proceeded to into TransT1- 1 competent cell, obtains transformant.

2）Identification pLYZRNAi-sense-GmPEPc recombinant vectors

Select 1）The transformant of middle gained, is inoculated in the LB fluid mediums containing spectinomycin, incubated overnight；Take overnight The bacterium solution of culture, using Left MCS-F and Left MCS-R primers, carries out pcr amplification reaction as PCR reaction template.As a result As shown in fig. 7, PCR identification pLYZRNAi-sense-GmPEPc recombinant vectors.As can be seen that obtain 520bp DNA bands i.e. For positive colony, primer sequence is as follows：

Left MCS-F：5'-CGCACAATCCCACTATCCTT-3'；

Left MCS-R：5'-AGGCGGTACAATGATCAACC-3'.

The plasmid of positive colony is extracted, is through the detection of BamHI and SamI enzyme action in 4 swimming lanes in electrophoresis detection such as Fig. 6 PLYZRNAi-sense GmPEPc carriers.6 swimming lanes are the PCR primer of sense GmPEPc.

The plasmid is sent to into sequencing, sequencing primer is Left MCS-F and Left MCS-R, and sequencing result shows, the plasmid It is by the sequence 3 in sequence table（GmPEPc genes justice interference fragment）It is cloned into the upstream multiple clone site of pLYZRNAi carriers The recombinant vector obtained at BamHI and SamI, by plasmid pLYZRNAi-sense-GmPEPc carriers are named as

3rd, the acquisition with GmPEPc genes justice and the pLYZRNAi-GmPEPc recombinant vectors of antisense interference fragment

1）The homologous recombination directed cloning of GmPEPc gene antisense interference fragments

With SpeI and SacI enzyme action steps 2,2）In the pLYZRNAi-sense-GmPEPc that obtains, reclaim linear pLYZRNAi-sense-GmPEPc.It is SpeI and SacI enzyme action pLYZRNAi-sense shown in 5 swimming lanes of the electrophoresis in Fig. 6 The enzyme action testing result of GmPEPc carriers.

Using the method for homologous recombination directed cloning（Concrete steps and reaction system are shown in the 3 of embodiment 1）, first by recovery PCR primer 2 and linear pLYZRNAi-sense-GmPEPc carry out homologous recombination reaction, then homologous recombination product is proceeded to TransT1-1 competent cells, obtain transformant.

2）Identification pLYZRNAi-GmPEPc recombinant vectors

Select 1）The transformant of middle gained, is inoculated in the LB fluid mediums containing spectinomycin, incubated overnight；Take overnight The bacterium solution of culture, using Right MCS-F and Right MCS-R primers, carries out pcr amplification reaction as PCR reaction template.Knot Fruit is as shown in figure 8, PCR identification pLYZRNAi-GmPEPc recombinant vectors.As can be seen that obtaining being for 425bp DNA bands Positive colony.Primer sequence is as follows：

Right MCS-F：5'-TATGACACGGCTGTTTCGAG-3'；

Right MCS-R：5'-GAATCCTGTTGCCGGTCTT-3'.

The plasmid is sent to into sequencing, with Left MCS-F, Left MCS-R, Right MCS-F and Right MCS-R conducts Sequencing primer.Sequencing result shows that the plasmid is by the sequence 4 in sequence table（GmPEPc gene antisense interference fragments）It is cloned into The recombinant vector obtained at pLYZRNAi-sense-GmPEPc carrier Ss peI and SacI restriction enzyme sites；Alternatively the plasmid is By the sequence 3 in sequence table（GmPEPc genes justice interference fragment）In being cloned into the upstream multiple clone site of pLYZRNAi carriers BamHI and SamI at, and by the sequence 4 in sequence table（GmPEPc gene antisense interference fragments）It is cloned into pLYZRNAi carriers Multicloning sites downstream in SpeI and SacI restriction enzyme sites at the recombinant vector that obtains.The plasmid is named as pLYZRNAi-GmPEPc.The structural representation of pLYZRNAi-GmPEPc is as shown in figure 4, structure flow process is as shown in Figure 3.

The basic skills of above-mentioned homologous recombination directed cloning can also be adopted, first enters GmPEPc gene antisense interference fragments Row homologous recombination directed cloning obtains intermediate carrier, then GmPEPc genes justice interference fragment is inserted into above-mentioned intermediate carrier, obtains To pLYZRNAi-GmPEPc recombinant vectors.Through sequencing identification, vector construction is correct.The method that enzyme action connection can also be used Build pLYZRNAi-GmPEPc recombinant vectors：

It is specific as follows：First by SpeI the and SacI enzyme action of PCR primer 1, the digestion products for obtaining with through same enzyme action PLYZRNAi carriers connect, and obtain intermediate carrier；Again by the BamH I and SmaI enzyme action of PCR primer 2, the digestion products for obtaining with Connect through the intermediate carrier of same enzyme action, obtain pLYZRNAi-GmPEPc recombinant vectors.Through sequencing identification, vector construction Correctly.

2nd, the genetic transformation of rna interference vector pLYZRNAi-GmPEPc

PLYZRNAi-GmPEPc carriers are proceeded in EHA101 Agrobacteriums, transformant is obtained.Transformant extraction plasmid is sent Sequencing is gone, as a result shows that plasmid is pLYZRNAi-GmPEPc, therefore the transformant containing pLYZRNAi-GmPEPc is named as EHA101/pLYZRNAi-GmPEPc。

EHA101/pLYZRNAi-GmPEPc is proceeded to into Semen sojae atricolor receptor kind using soybean cotyledon node genetic transformation In Williams82（Fig. 9, the conversion process of soybean cotyledon node genetic transformation.）In, comprise the following steps that：

（1）Single bacterium colony is taken from flat board, 10mlYEB fluid mediums is accessed and is added in 50mg/L Kan, 26 DEG C, 160r/min Bacterium solution is diluted 2 times, as the engineering bacterium solution of Agrobacterium by shaken cultivation to logarithmic (log) phase, OD600=0.6 with MSO fluid mediums.

（2）Transgenic method adopts agriculture bacillus mediated soybean cotyledon node conversion method.After soybean seed sterilization, in addition 1d is sprouted in MSB5 culture medium, kind of a skin is removed, seed is cut into into 2 half along plumular axis, each half all carries a piece of cotyledon and 3~5 Mm hypocotyls.Explant is immersed in 30 minutes in ready engineering bacterium solution, the explant invaded after bacterium is further taken out and is inserted filter paper On, unnecessary bacterium solution is sopped up, go to co-cultivation base and cultivate, proceed to bud inducement cultivation base after 5 days again, bud elongation training is proceeded to after 28 days Foster base, treats that resistant budses are extended to 3~4cm per two weeks subcultures once, resistant budses is cut and is put into induction life in root media Root, induces and transplanted after root, and being put into greenhouse makes it blossom and bear fruit.

（3）Empty carrier pLYZRNAi is proceeded in Semen sojae atricolor receptor kind Williams82, as reality using same method Control in testing.

3rd, GmPEPc genes T1 generations interference soybean genotype and phenotypic evaluation

1st, genotype identification

The DNA that T1 disturbs plant for GmPEPc genes is extracted, positive fragment is with Left MCS-F and Left MCS-R to draw Thing, enters performing PCR detection, and obtain 520bp DNA bands is positive colony.Reversely fragment is with Right MCS-F and Right MCS-R is primer, and the T1 that is for obtaining 425bp DNA bands disturbs Oryza sativa L. for GmPEPc genes（Figure 10）.9 plants of PCR are obtained The T1 for being accredited as the positive disturbs Semen sojae atricolor for GmPEPc genes.

2nd, phenotypic evaluation

We, for transgenic positive material, carry out the measure of oil content to this 9 plants positive T1, adopt and proceed to empty carrier Semen sojae atricolor receptor kind Williams82 of pLYZRNAi is compareed.

Result of the test shows have the oil content in 8 familys to compare in 9 transgenic lines for turning GmPEPc gene T2 generations According to increase, wherein there is oil content in 3 transgenic lines seeds to improve more than 10（Table 2）

The T2 of table 2 is for oil content content in transgenic progeny seed

Kind（plant line）	Oil content content % oil	Compared with CK ± %
			CK （Williams 82）	20.6 ± 0.5	0
1	21.1 ± 1.8	+4.6
			2	22.7 ± 1.3	+10.12
3	24.3 ± 0.9	+17.96
			4	22.6 ± 0.9	+9.7
5	23.4 ± 1.5	+13.6
			6	21.7 ± 0.8	+5.3
7	21.3 ± 0.9	+3.4
			8	21.8 ± 2.2	+5.82
9	18.8 ± 1.7	-8.7

These results suggest that, the plant RNA interference carrier that the present invention is provided expresses the shRNA quilts of formation in receptor Dicer enzymes cut into siRNA；SiRNA can specifically suppress the expression of target gene GmPEPc, so as to reach control soybean seed The content of oil content is planted, the purpose of GmPEPc gene functions is studied.

The invention discloses a kind of rna interference vector and its application.In plant transgene breeding and gene functional research side Face has important using value, and the present invention provides new technological means for plant transgene breeding and gene functional research.

<110>Jilin Academy of Agricultural Science

<120>

<140>

<160> 1

<210> 1

<211> 10819 bp

<212> DNA

<213> pLYZRNAi

<400> 1

agtactttaaagtactttaaagtactttaaagtactttgatccaacccctccgctgctat 61

agtgcagtcggcttctgacgttcagtgcagccgtcttctgaaaacgacatgtcgcacaag 121

tcctaagttacgcgacaggctgccgccctgcccttttcctggcgttttcttgtcgcgtgt 181

tttagtcgcataaagtagaatacttgcgactagaaccggagacattacgccatgaacaag 241

agcgccgccgctggcctgctgggctatgcccgcgtcagcaccgacgaccaggacttgacc 301

aaccaacgggccgaactgcacgcggccggctgcaccaagctgttttccgagaagatcacc 361

ggcaccaggcgcgaccgcccggagctggccaggatgcttgaccacctacgccctggcgac 421

gttgtgacagtgaccaggctagaccgcctggcccgcagcacccgcgacctactggacatt 481

gccgagcgcatccaggaggccggcgcgggcctgcgtagcctggcagagccgtgggccgac 541

accaccacgccggccggccgcatggtgttgaccgtgttcgccggcattgccgagttcgag 601

cgttccctaatcatcgaccgcacccggagcgggcgcgaggccgccaaggcccgaggcgtg 661

aagtttggcccccgccctaccctcaccccggcacagatcgcgcacgcccgcgagctgatc 721

gaccaggaaggccgcaccgtgaaagaggcggctgcactgcttggcgtgcatcgctcgacc 781

ctgtaccgcgcacttgagcgcagcgaggaagtgacgcccaccgaggccaggcggcgcggt 841

gccttccgtgaggacgcattgaccgaggccgacgccctggcggccgccgagaatgaacgc 901

caagaggaacaagcatgaaaccgcaccaggacggccaggacgaaccgtttttcattaccg 961

aagagatcgaggcggagatgatcgcggccgggtacgtgttcgagccgcccgcgcacgtct 1021

caaccgtgcggctgcatgaaatcctggccggtttgtctgatgccaagctggcggcctggc 1081

cggccagcttggccgctgaagaaaccgagcgccgccgtctaaaaaggtgatgtgtatttg 1141

agtaaaacagcttgcgtcatgcggtcgctgcgtatatgatgcgatgagtaaataaacaaa 1201

tacgcaaggggaacgcatgaaggttatcgctgtacttaaccagaaaggcgggtcaggcaa 1261

gacgaccatcgcaacccatctagcccgcgccctgcaactcgccggggccgatgttctgtt 1321

agtcgattccgatccccagggcagtgcccgcgattgggcggccgtgcgggaagatcaacc 1381

gctaaccgttgtcggcatcgaccgcccgacgattgaccgcgacgtgaaggccatcggccg 1441

gcgcgacttcgtagtgatcgacggagcgccccaggcggcggacttggctgtgtccgcgat 1501

caaggcagccgacttcgtgctgattccggtgcagccaagcccttacgacatatgggccac 1561

cgccgacctggtggagctggttaagcagcgcattgaggtcacggatggaaggctacaagc 1621

ggcctttgtcgtgtcgcgggcgatcaaaggcacgcgcatcggcggtgaggttgccgaggc 1681

gctggccgggtacgagctgcccattcttgagtcccgtatcacgcagcgcgtgagctaccc 1741

aggcactgccgccgccggcacaaccgttcttgaatcagaacccgagggcgacgctgcccg 1801

cgaggtccaggcgctggccgctgaaattaaatcaaaactcatttgagttaatgaggtaaa 1861

gagaaaatgagcaaaagcacaaacacgctaagtgccggccgtccgagcgcacgcagcagc 1921

aaggctgcaacgttggccagcctggcagacacgccagccatgaagcgggtcaactttcag 1981

ttgccggcggaggatcacaccaagctgaagatgtacgcggtacgccaaggcaagaccatt 2041

accgagctgctatctgaatacatcgcgcagctaccagagtaaatgagcaaatgaataaat 2101

gagtagatgaattttagcggctaaaggaggcggcatggaaaatcaagaacaaccaggcac 2161

cgacgccgtggaatgccccatgtgtggaggaacgggcggttggccaggcgtaagcggctg 2221

ggttgtctgccggccctgcaatggcactggaacccccaagcccgaggaatcggcgtgagc 2281

ggtcgcaaaccatccggcccggtacaaatcggcgcggcgctgggtgatgacctggtggag 2341

aagttgaaggccgcgcaggccgcccagcggcaacgcatcgaggcagaagcacgccccggt 2401

gaatcgtggcaagcggccgctgatcgaatccgcaaagaatcccggcaaccgccggcagcc 2461

ggtgcgccgtcgattaggaagccgcccaagggcgacgagcaaccagattttttcgttccg 2521

atgctctatgacgtgggcacccgcgatagtcgcagcatcatggacgtggccgttttccgt 2581

ctgtcgaagcgtgaccgacgagctggcgaggtgatccgctacgagcttccagacgggcac 2641

gtagaggtttccgcagggccggccggcatggccagtgtgtgggattacgacctggtactg 2701

atggcggtttcccatctaaccgaatccatgaaccgataccgggaagggaagggagacaag 2761

cccggccgcgtgttccgtccacacgttgcggacgtactcaagttctgccggcgagccgat 2821

ggcggaaagcagaaagacgacctggtagaaacctgcattcggttaaacaccacgcacgtt 2881

gccatgcagcgtacgaagaaggccaagaacggccgcctggtgacggtatccgagggtgaa 2941

gccttgattagccgctacaagatcgtaaagagcgaaaccgggcggccggagtacatcgag 3001

atcgagctagctgattggatgtaccgcgagatcacagaaggcaagaacccggacgtgctg 3061

acggttcaccccgattactttttgatcgatcccggcatcggccgttttctctaccgcctg 3121

gcacgccgcgccgcaggcaaggcagaagccagatggttgttcaagacgatctacgaacgc 3181

agtggcagcgccggagagttcaagaagttctgtttcaccgtgcgcaagctgatcgggtca 3241

aatgacctgccggagtacgatttgaaggaggaggcggggcaggctggcccgatcctagtc 3301

atgcgctaccgcaacctgatcgagggcgaagcatccgccggttcctaatgtacggagcag 3361

atgctagggcaaattgccctagcaggggaaaaaggtcgaaaaggtctctttcctgtggat 3421

agcacgtacattgggaacccaaagccgtacattgggaaccggaacccgtacattgggaac 3481

ccaaagccgtacattgggaaccggtcacacatgtaagtgactgatataaaagagaaaaaa 3541

ggcgatttttccgcctaaaactctttaaaacttattaaaactcttaaaacccgcctggcc 3601

tgtgcataactgtctggccagcgcacagccgaagagctgcaaaaagcgcctacccttcgg 3661

tcgctgcgctccctacgccccgccgcttcgcgtcggcctatcgcggccgctggccgctca 3721

aaaatggctggcctacggccaggcaatctaccagggcgcggacaagccgcgccgtcgcca 3781

ctcgaccgccggcgcccacatcaaggcaccctgcctcgcgcgtttcggtgatgacggtga 3841

aaacctctgacacatgcagctcccggagacggtcacagcttgtctgtaagcggatgccgg 3901

gagcagacaagcccgtcagggcgcgtcagcgggtgttggcgggtgtcggggcgcagccat 3961

gacccagtcacgtagcgatagcggagtgtatactggcttaactatgcggcatcagagcag 4021

attgtactgagagtgcaccatatgcggtgtgaaataccgcacagatgcgtaaggagaaaa 4081

taccgcatcaggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcgg 4141

ctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggg 4201

gataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaag 4261

gccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcga 4321

cgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccct 4381

ggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcc 4441

tttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcg 4501

gtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgc 4561

tgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgcca 4621

ctggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagag 4681

ttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgct 4741

ctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaacc 4801

accgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaagga 4861

tctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactca 4921

cgttaagggattttggtcatgcatgatatatctcccaatttgtgtagggcttattatgca 4981

cgcttaaaaataataaaagcagacttgacctgatagtttggctgtgagcaattatgtgct 5041

tagtgcatctaacgcttgagttaagccgcgccgcgaagcggcgtcggcttgaacgaattt 5101

ctagctagacattatttgccgactaccttggtgatctcgcctttcacgtagtggacaaat 5161

tcttccaactgatctgcgcgcgaggccaagcgatcttcttcttgtccaagataagcctgt 5221

ctagcttcaagtatgacgggctgatactgggccggcaggcgctccattgcccagtcggca 5281

gcgacatccttcggcgcgattttgccggttactgcgctgtaccaaatgcgggacaacgta 5341

agcactacatttcgctcatcgccagcccagtcgggcggcgagttccatagcgttaaggtt 5401

tcatttagcgcctcaaatagatcctgttcaggaaccggatcaaagagttcctccgccgct 5461

ggacctaccaaggcaacgctatgttctcttgcttttgtcagcaagatagccagatcaatg 5521

tcgatcgtggctggctcgaagatacctgcaagaatgtcattgcgctgccattctccaaat 5581

tgcagttcgcgcttagctggataacgccacggaatgatgtcgtcgtgcacaacaatggtg 5641

acttctacagcgcggagaatctcgctctctccaggggaagccgaagtttccaaaaggtcg 5701

ttgatcaaagctcgccgcgttgtttcatcaagccttacggtcaccgtaaccagcaaatca 5761

atatcactgtgtggcttcaggccgccatccactgcggagccgtacaaatgtacggccagc 5821

aacgtcggttcgagatggcgctcgatgacgccaactacctctgatagttgagtcgatact 5881

tcggcgatcaccgcttcccccatgatgtttaactttgttttagggcgactgccctgctgc 5941

gtaacatcgttgctgctccataacatcaaacatcgacccacggcgtaacgcgcttgctgc 6001

ttggatgcccgaggcatagactgtaccccaaaaaaacagtcataacaagccatgaaaacc 6061

gccactgcgccgttaccaccgctgcgttcggtcaaggttctggaccagttgcgtgacggc 6121

agttacgctacttgcattacagcttacgaaccgaacgaggcttatgtccactgggttcgt 6181

gcccgaattgatcacaggcagcaacgctctgtcatcgttacaatcaacatgctaccctcc 6241

gcgagatcatccgtgtttcaaacccggcagcttagttgccgttcttccgaatagcatcgg 6301

taacatgagcaaagtctgccgccttacaacggctctcccgctgacgccgtcccggactga 6361

tgggctgcctgtatcgagtggtgattttgtgccgagctgccggtcggggagctgttggct 6421

ggctggtggcaggatatattgtggtgtaaacaaattgacgcttagacaacttaataacac 6481

attgcggacgtttttaatgtactgaattaacgccgaattgctctagcattcgccattcag 6541

gctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggc 6601

gaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacg 6661

acgttgtaaaacgacggccagtgccaagctaattcgcttcaagacgtgctcaaatcacta 6721

tttccacacccctatatttctattgcactcccttttaactgttttttattacaaaaatgc 6781

cctggaaaatgcactccctttttgtgtttgtttttttgtgaaacgatgttgtcaggtaat 6841

ttatttgtcagtctactatggtggcccattatattaatagcaactgtcggtccaatagac 6901

gacgtcgattttctgcatttgtttaaccacgtggattttatgacattttatattagttaa 6961

tttgtaaaacctacccaattaaagacctcatatgttctaaagactaatacttaatgataa 7021

caattttcttttagtgaagaaagggataattagtaaatatggaacaagggcagaagattt 7081

attaaagccgcggtaagagacaacaagtaggtacgtggagtgtcttaggtgacttaccca 7141

cataacataaagtgacattaacaaacatagctaatgctcctatttgaatagtgcatatca 7201

gcataccttattacatatagataggagcaaactctagctagattgttgagcagatctcgg 7261

tgacgggcaggaccggacggggcggtaccggcaggctgaagtccagctgccagaaaccca 7321

cgtcatgccagttcccgtgcttgaagccggccgcccgcagcatgccgcggggggcatatc 7381

cgagcgcctcgtgcatgcgcacgctcgggtcgttgggcagcccgatgacagcgaccacgc 7441

tcttgaagccctgtgcctccagggacttcagcaggtgggtgtagagcgtggagcccagtc 7501

ccgtccgctggtggcggggggagacgtacacggtcgactcggccgtccagtcgtaggcgt 7561

tgcgtgccttccaggggcccgcgtaggcgatgccggcgacctcgccgtccacctcggcga 7621

cgagccagggatagcgctcccgcagacggacgaggtcgtccgtccactcctgcggttcct 7681

gcggctcggtacggaagttgaccgtgcttgtctcgatgtagtggttgacgatggtgcaga 7741

ccgccggcatgtccgcctcggtggcacggcggatgtcggccgggcgtcgttctgggctca 7801

tggtagatcccccgttcgtaaatggtgaaaattttcagaaaattgcttttgctttaaaag 7861

aaatgatttaaattgctgcaatagaagtagaatgcttgattgcttgagattcgtttgttt 7921

tgtatatgttgtgttgagaattaattctcgaggtcctctccaaatgaaatgaacttcctt 7981

atatagaggaagggtcttgcgaaggatagtgggattgtgcgtcatcccttacgtcagtgg 8041

agatatcacatcaatccacttgctttgaagacgtggttggaacgtcttctttttccacga 8101

tgctcctcgtgggtgggggtccatctttgggaccactgtcggtagaggcatcttgaacga 8161

tagcctttcctttatcgcaatgatggcatttgtaggagccaccttccttttccactatct 8221

tcacaataaagtgacagatagctgggcaatggaatccgaggaggtttccggatattaccc 8281

tttgttgaaaagtctcaattgccctttggtcttctgagactgtatctttgatatttttgg 8341

agtagacaagtgtgtcgtgctccaccatgttatcacatcaatccacttgctttgaagacg 8401

tggttggaacgtcttctttttccacgatgctcctcgtgggtgggggtccatctttgggac 8461

cactgtcggcagaggcatcttcaacgatggcctttcctttatcgcaatgatggcatttgt 8521

aggagccaccttccttttccactatcttcacaataaagtgacagatagctgggcaatgga 8581

atccgaggaggtttccggatattaccctttgttgaaaagtctcaattgccctttggtctt 8641

ctgagactgtatctttgatatttttggagtagacaagtgtgtcgtgctccaccatgttga 8701

cctgcaggcatgcaagcttgcatgcctgcaggtccccAGATTAGCCTTTTCAATTTCAGA 8761

AAGAATGCTAACCCACAGATGGTTAGAGAGGCTTACGCAGCAGGTCTCATCAAGACGATC 8821

TACCCGAGCAATAATCTCCAGGAAATCAAATACCTTCCCAAGAAGGTTAAAGATGCAGTC 8881

AAAAGATTCAGGACTAACTGCATCAAGAACACAGAGAAAGATATATTTCTCAAGATCAGA 8941

AGTACTATTCCAGTATGGACGATTCAAGGCTTGCTTCACAAACCAAGGCAAGTAATAGAG 9001

ATTGGAGTCTCTAAAAAGGTAGTTCCCACTGAATCAAAGGCCATGGAGTCAAAGATTCAA 9061

ATAGAGGACCTAACAGAACTCGCCGTAAAGACTGGCGAACAGTTCATACAGAGTCTCTTA 9121

CGACTCAATGACAAGAAGAAAATCTTCGTCAACATGGTGGAGCACGACACACTTGTCTAC 9181

TCCAAAAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCAATTGAGACTTTTCAACAA 9241

AGGGTAATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTTATTGTG 9301

AAGATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCC 9361

ATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGC 9421

ATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATC 9481

TCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATA 9541

TAAGGAAGTTCATTTCATTTGGAGAGAACACGGGGGACTCTAGAAACAGAGGATCCAACA 9601

GCCCCGGGAACAGCACGCGTGGTAAGTTACTACAAACCTTTTTGTATTTATGTTCCAGTG 9661

ACAATTATTTGTGTTCTCATGTTCCACGTATCACTTTAATGTTCATGGTTGATCATTGTA 9721

CCGCCTCATCTCTTTTAGAGGATCAAGAGTATATGCCTGTCTTAACTTTTTCTTTCTCTG 9781

GTCCAGTCTTTCCGCTGATATTAAGATGAATTTTACAACAAAAAATGTGCTGCCTGTGTA 9841

TGAAGGTTCAGAGGCATAGTTCATAATTTTACCCTGTTCTCAATTAGGAAATGTATTTTG 9901

CAAGGTCATAAAGTCTTGACATTGATGATCAAATATTTTCTAGAGCTAAAATTTCATAAT 9961

CAAATATGACAGTTCCACGGCAGTAGATAAAGAGTACCCACTGTATATATTAGTATGAAG 10021

ATTAACACTTGAAAAAACCTTTGATTGTTCCTATAACACCTAATGATTGACTATGACACG 10081

GCTGTTTCGAGATTTTCAGGTTAACATCGATACTAGTTCTAGAGAGCTCGAATTTCCCCG 10141

ATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGCGA 10201

TGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCA 10261

TGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACATTTAATACG 10321

CGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTA 10381

TGTTactagatcgggaattcgtaatcatgtcatagctgtttcctgtgtgaaattgttatc 10441

cgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcct 10501

aatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaa 10561

acctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgta 10621

ttggagcttgagcttggatcagattgtcgtttcccgccttcagtttaaactatcagtgtt 10681

tgacaggatatattggcgggtaaacctaagagaaaagagcgtttattagaataatcggat 10741

atttaaaagggcgtgaaaaggtttatccgttcgtccatttgtatgtgcatgccaaccaca 10801

gggttcccctcgggatcaa

<110>Jilin Academy of Agricultural Science

<120>

<140>

<160> 2

<210> 2

<211> 575 bp

<212> DNA

<213>Oryza sativa L.（Oryza sativa）

<400> 1

TAGAAACAGA GGATCCGGAT CCAACAGCCC CGGGAACAGC ACGCGTGGTA AGTTACTACA 61

AACCTTTTTG TATTTATGTT CCAGTGACAA TTATTTGTGT TCTCATGTTC CACGTATCAC 121

TTTAATGTTC ATGGTTGATC ATTGTACCGC CTCATCTCTT TTAGAGGATC AAGAGTATAT 181

GCCTGTCTTA ACTTTTTCTT TCTCTGGTCC AGTCTTTCCG CTGATATTAA GATGAATTTT 241

ACAACAAAAA ATGTGCTGCC TGTGTATGAA GGTTCAGAGG CATAGTTCAT AATTTTACCC 301

TGTTCTCAAT TAGGAAATGT ATTTTGCAAG GTCATAAAGT CTTGACATTG ATGATCAAAT 361

ATTTTCTAGA GCTAAAATTT CATAATCAAA TATGACAGTT CCACGGCAGT AGATAAAGAG 421

TACCCACTGT ATATATTAGT ATGAAGATTA ACACTTGAAA AAACCTTTGA TTGTTCCTAT 481

AACACCTAAT GATTGACTAT GACACGGCTG TTTCGAGATT TTCAGGTTAA CATCGATACT 541

AGTTCTAGAG AGCTCGAGCT CGAATTTCCC CGATC

<110>Jilin Academy of Agricultural Science

<120>

<140>

<160> 3

<210> 3

<211> 3211 bp

<212> DNA

<213>Semen sojae atricolor（Soybean）

<400> 1

cttctctctc tctctgtcat tggtttttct ctggttgaca tcatcgtcat ctactacttc 61

ttcctcttat ccaattggcc cccaacactg gttttggggt actttgaaaa gttgcaatgg 121

cgaacaggaa cttggaaaag atggcatcga ttgatgctca gcttcggctg ttggttccgg 181

ccaaagtgag tgaggatgac aaactggttg agtatgatgc tttgcttttg gatcggttcc 241

ttgatattct tcaggattta catggggagg atctgaaaga aacggttcaa gaggtgtatg 301

agctttctgc tgagtatgaa ggtaagcatg acccaaagaa actagaggaa cttggaaatc 361

tgataactag tttggatgct ggagattcca ttgtggttgc caagtccttt tcccacatgc 421

ttaacttggc caacttagcc gaagaggtcc aaattgccca cagtcgaagg aacaagttga 481

agaaaggtga ttttgctgat gaaaacaatg ccaccactga atcagacatt gaagaaactc 541

taaagaaact tgtggtggat atgaagaagt ctcctcagga agtttttgat gcacttaaaa 601

accagactgt tgatctggtt cttactgctc atcctactca atctgtccgt aggtctttgc 661

ttcaaaaaca tggaaggata agaaataatt taactcagtt gtatgccaaa gacatcactc 721

ctgatgataa gcaggaactt gacgaggctc tacagaggga gatccaagct gcattccgta 781

ctgatgaaat caggaggacc cctccaaccc cacaagatga gatgagagca gggatgagct 841

acttccatga aacaatttgg aagggtgtac ccacatttct acgtcgtgtt gatacagctt 901

tgaagaatat agggatcaac gaacgtgtcc cttataatgc tcctctcatt caattttctt 961

cttggatggg tggagatcgt gatggcaatc caagagtaac tcctgaagtg accagagatg 1021

tttgcttatt ggctagaatg atggctgcta acttgtacta ctcccagata gaggatctta 1081

tgtttgagct gtcaatgtgg cgctgcaatg acgagctacg tgtccgtgca gatgaactta 1141

acaggtcttc caagaaaaat tcagtcgcaa aacactacat agaattttgg aaagccattc 1201

ctccaaatga accatatcgt gtgctactgg gtgaagtaag gaataggctt taccagactc 1261

gtgaacgctc acgccatttg ctagctcacg gatactctga cattccagag gaagagactt 1321

ttaccaatgt tgaggagttc ttggaacccc ttgaactctg ttacagatca ctctgtgctt 1381

gtggcgatcg tgcaattgcc gatggaagcc ttctagattt cttgagacaa gtctctactt 1441

tcggactctc cctagtgagg cttgacataa ggcaagagtc agaccgccac acagacgtct 1501

tagacgccat caccaaacat ttagaaatag gctcatacca ggaatggtcg gaggaaaaac 1561

ggcagcaatg gcttttatct gagttgagtg gcaaacggcc cctattcggc cctgatcttc 1621

cccaaaccga agaaatcaga gacgtgttgg agacattcca tgtcatagca gagcttccac 1681

tagacaactt tggagcatac atcatctcaa tggcaactgc accttctgat gtgcttgcag 1741

ttgagcttct gcagcgcgaa tgccatgtca agcatccact aagagttgtg ccattgtttg 1801

agaagctagc tgatctagaa gcagcaccgg ccgcgttggc gcgattgttc tctgtagact 1861

ggtacagaaa caggatcaat gggaagcagg aagtgatgat aggctattct gattctggca 1921

aagatgctgg aaggttttca gctgcatggc agctgtataa ggctcaggag gagcttataa 1981

tggtggctaa gcagtatggt gtgaagctga caatgttcca tggtcgtgga gggacagttg 2041

gaagaggagg tggtccaact caccttgcta ttctgtctca gcctcctgaa accattcatg 2101

gatcgctgcg cgtgactgtc caaggtgaag ttattgagca atcgtttgga gagcagcact 2161

tgtgcttcag aacgcttcaa aggttcactg cagctactct agaacatgga atgcaccctc 2221

caatttctcc taaaccggaa tggagggctt tgatggatga gatggctgtc attgccactg 2281

aggagtaccg gtccattgtg ttcaaagaac cacgatttgt tgagtatttc cgcctggcca 2341

cacctgagtt ggagtacggg aggatgaaca ttggaagtcg accagcaaag aggaggccaa 2401

gtggaggtat tgagacactc cgtgccatac cttggatctt tgcctggaca caaacaaggt 2461

tccatcttcc agtgtggcta ggctttggtg cagcattcaa acatgttatt gagaaggatg 2521

ttaggaatat tcatgtgctg caggagatgt acaatcaatg gcctttcttt agggtcacta 2581

ttgatttagt ggaaatggtg tttgccaaag gagacccagg gatagctgct ctttatgata 2641

ggctccttgt ttcagaggat ctgtggtcat ttggggagca gttgaggacc atgtacgaag 2701

aaaccaagga actcctcctt caggtggctg gccataggga tcttcttgaa ggagatccat 2761

acttgaagca aagactgcgc ttgcgtgatt cttatattac taccctaaac gtgtgccaag 2821

cctacacgtt gaaacgtatc cgtgatccaa actataatgt gaagctgcgc cctcacatct 2881

ccaaagagtc tatagagata agtaaacctg ctgatgaact tataacactt aacccaacaa 2941

gtgaatatgc acctggtttg gaagacaccc tcattctcac catgaagggt attgctgctg 3001

gcttgcaaaa cactggctaa atctgagttt ttgtcttctc tttggttcca cttttatttt 3061

ctgtttcctt tatcagaaat aacgagttta gctgcatgca ccaaagggtg tttttccctc 3121

ccctgtaccc atgtttccat tataagatat tacagagaga tagctgccgc aaaatgagac 3181

aatgcaagta tgcaactgat tcttatgttc c

<110>Jilin Academy of Agricultural Science

<120>

<140>

<160> 4

<210> 4

<211> 332 bp

<212> DNA

<213>Semen sojae atricolor（Soybean）

<400> 1

TAGAAACAGA GGATCCGCTG GAGATTCCAT TGTGGTTGCC AAGTCCTTTT CCCACATGCT 61

TAACTTGGCC AACTTAGCCG AAGAGGTCCA AATTGCCCAC AGTCGAAGGA ACAAGTTGAA 121

GAAAGGTGAT TTTGCTGATG AAAACAATGC CACCACTGAA TCAGACATTG AAGAAACTCT 181

AAAGAAACTT GTGGTGGATA TGAAGAAGTC TCCTCAGGAA GTTTTTGATG CACTTAAAAA 241

CCAGACTGTT GATCTGGTTC TTACTGCTCA TCCTACTCAA TCTGTCCGTA GGTCTTTGCT 301

TCAAAAACAT GGAAGGCCCG GGAACAGCAC GC

<110>Jilin Academy of Agricultural Science

<120>

<140>

<160> 5

<210> 5

<211> 336 bp

<212> DNA

<213>Semen sojae atricolor（Soybean）

<400> 1

TAACATCGAT ACTAGTGCTG GAGATTCCAT TGTGGTTGCC AAGTCCTTTT CCCACATGCT 61

TAACTTGGCC AACTTAGCCG AAGAGGTCCA AATTGCCCAC AGTCGAAGGA ACAAGTTGAA 121

GAAAGGTGAT TTTGCTGATG AAAACAATGC CACCACTGAA TCAGACATTG AAGAAACTCT 181

AAAGAAACTT GTGGTGGATA TGAAGAAGTC TCCTCAGGAA GTTTTTGATG CACTTAAAAA 241

CCAGACTGTT GATCTGGTTC TTACTGCTCA TCCTACTCAA TCTGTCCGTA GGTCTTTGCT 301

TCAAAAACAT GGAAGGGAGC TCGAATTTCC CCGATC

Claims (2)

1. a kind of carrier of suitable herbicide selection marker Bar gene, it is characterised in that the carrier includes interference carrier, DNA Fragment 2 and DNA fragmentation 3, the interference carrier is comprising Oryza sativa L. GAS1 gene LOC_Os01g68860 introns, positioned at the water The multiple clone site and the multiple clone site in downstream of the upstream of rice GAS1 gene LOC_Os01g68860 introns both sides, it is described interior Be 9621-10099 positions nucleotide in sequence 1 containing son, the multiple clone site of upstream be BamHI, SmaI, XmaI, MluI, the multiple clone site in downstream is HpaI, SpeI and SacI；The carrier of the suitable herbicide selection marker Bar gene is pressed Prepare according to following I or II method：

I is comprised the following steps：

1）DNA fragmentation 2 is inserted into the upstream multiple clone site of described interference carrier, is obtained containing in multicloning sites downstream Between carrier A；

2）By the inserting step 1 of DNA fragmentation 3）The multicloning sites downstream of the intermediate carrier A for obtaining, obtains being adapted to herbicide screening The carrier of labelling Bar genes；

II comprises the following steps：

A, the multicloning sites downstream that DNA fragmentation 3 is inserted described interference carrier, obtain containing in the multiple clone site of upstream Between carrier B；

The upstream multiple clone site of B, the intermediate carrier B for obtaining inserting step A of DNA fragmentation 2, obtains being adapted to herbicide screening mark The carrier of note Bar genes；

The nucleotides sequence of described DNA fragmentation 2 is classified as sequence 4 in sequence table；

The nucleotides sequence of described DNA fragmentation 3 is classified as sequence 5 in sequence table.

2. the carrier of suitable herbicide selection marker Bar gene according to claim 1, it is characterised in that described is adapted to In the structure of the carrier of herbicide selection marker Bar gene, DNA fragmentation 2 and DNA fragmentation 3 are carried by homologous recombination insertion interference Obtain being adapted to the carrier of herbicide selection marker Bar gene at the multiple clone site of body, or DNA fragmentation 2 and DNA fragmentation 3 pass through Double digestion is connected the carrier for obtaining being adapted to herbicide selection marker Bar gene with the interference carrier processed through same enzyme action.