CN103642827B - RNA interference vector suitable for herbicide selection marker Bar gene - Google Patents
RNA interference vector suitable for herbicide selection marker Bar gene Download PDFInfo
- Publication number
- CN103642827B CN103642827B CN201310484523.3A CN201310484523A CN103642827B CN 103642827 B CN103642827 B CN 103642827B CN 201310484523 A CN201310484523 A CN 201310484523A CN 103642827 B CN103642827 B CN 103642827B
- Authority
- CN
- China
- Prior art keywords
- carrier
- gene
- sequence
- dna fragmentation
- interference
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to an RNA interference vector suitable for a herbicide selection marker Bar gene. The RNA interference vector includes a paddy rice GAS1 gene LOC-Os01g68860 intron, upstream multi-cloning sites and downstream multi-cloning sites, wherein the upstream multi-cloning sites and the downstream multi-cloning sites are respectively located at two sides of the paddy rice GAS1 gene intron; a nucleotide sequence of the paddy rice GAS1 gene LOC-Os01g68860 intron comprises 9621st-10099th nucleotides from the 5' terminal of a sequence 1 in a sequence table. Compared with an annular-structure RNA interference vector adopting a GUS gene as shRNA, the annular-structure RNA interference vector applying the gene intron as the shRNA has higher interference efficiency, at the same time, allows the experimental operation to become simple and easy to implement, so as to be beneficial for reducing errors and improving the work efficiency.
Description
Technical field
The present invention relates to a kind of rna interference vector of suitable herbicide selection marker Bar gene, belongs to Plant Biotechnology
Field.
Background technology
Conventional plant RNA interference carrier is except core parts, such as promoter, polyclone essential to conventional binary vector
Site, outside resistant maker gene, also comprising section of DNA sequence as shRNA(Short hairpin RNA, short hairpin RNA)'s
Circulus.Plant RNA i interference carriers are typically with the GUS of antibacterial(Turn beta-Glucuronidase)Genetic fragment or plant gene
Intron is used as circulus.Compared with the rna interference vector with gus gene as the circulus of shRNA, with band montage position
The gene intron of point has higher jamming effectiveness as the rna interference vector of the circulus of shRNA.
In engineered continuous evolution, with scientific and technical each branch continuous development and people to gene
Function understanding deepens continuously, and selectable marker gene is also at during constantly development is improved.Till now in gene work
The selectable marker gene widely applied in journey operation can substantially be divided into four classes:Be respectively antibiotics resistance gene, herbicide resist
Property gene, compound detoxifying gene and plant saccharide metabolic enzyme gene.They can rise on corresponding Selective agar medium
To the effect of label so that meet that the cell of our conditions can project displays.Wherein, Bar genes and careless fourth phosphine sieve
System is selected to be that at present most widely used classes of herbicides selected marker screens system.
Exogenous sequences are being cloned in the molecular biology manipulations of carrier, homologous recombination directed cloning and double digestion connect
It is two kinds of conventional cloning process.The latter is compared, the former advantage is need not to be cloned with digestion with restriction enzyme purpose
Fragment, overcomes the restriction of restriction enzyme site, while reducing operating procedure, contributes to reducing workload, improves work efficiency.
The content of the invention
It is an object of the invention to provide a kind of rna interference vector of suitable herbicide selection marker Bar gene, it is included
Design, clone's target gene interference fragment, screen the recombinant vector containing target gene interference fragment, detection transgenic interference plant etc.
The standardized method of sequence of operations;And in screening containing target gene interference fragment recombinant vector, detection transgenic interference plant
Etc. the PCR detection primers used in application process.When using the rna interference vector, experimental implementation becomes simple, has
Beneficial to error is reduced, work efficiency is improved.
The technical scheme is that what is be achieved in that:A kind of RNA interference of suitable herbicide selection marker Bar gene is carried
Body, nucleotides sequence is classified as the sequence 1 in sequence table, including the basic framework of pTF101.1 carriers, 35s promoteres and Oryza sativa L.
GAS1 gene LOC_Os01g68860 introns, the upstream multiple clone site positioned at the Oryza sativa L. GAS1 gene introns both sides and
Multicloning sites downstream;
The nucleotides sequence of the Oryza sativa L. GAS1 gene introns is classified as in sequence table sequence 1 from 5 ' end 9621-10098 positions
Nucleotide;
The upstream multiple clone site is BamHI, SmaI(XmaI)And MluI;
The multicloning sites downstream is HpaI, SpeI and SacI;
The promoter of the interference carrier is 35s promoteres.
The rna interference vector pLYZRNAi that the present invention is provided, is prepared as follows:
DNA fragmentation 1 and pTF101-35s carrier frameworks are co-cultured, the carrier for obtaining;
The DNA fragmentation 1 includes fragment a containing upstream multiple clone site, Oryza sativa L. GAS1 genes(LOC_
Os01g68860)Intron, the composition of fragment b containing multicloning sites downstream;
The Oryza sativa L. GAS1 genes(LOC_Os01g68860)The nucleotides sequence of intron is classified as sequence 1 from 5 ' in sequence table
End 9621-10098 positions;
The nucleotides sequence of fragment a is classified as in sequence table sequence 1 from 5 ' end 9591-9620 positions;
The nucleotides sequence of fragment b is classified as in sequence table sequence 1 from 5 ' end 10099-10129 positions,
The nucleotides sequence of the DNA fragmentation 1 is classified as sequence 2 in sequence table;
The upstream multiple clone site is BamHI, SmaI(XmaI)And MluI;
The multicloning sites downstream is HpaI, SpeI and SacI.
Second object of the present invention is to provide a kind of recombinant vector.
The recombinant vector that the present invention is provided, prepares according to following I or II method:
I comprises the steps:
1)DNA fragmentation 2 is inserted into the upstream multiple clone site of described interference carrier, is obtained containing the downstream polyclone
The intermediate carrier A in site;
2)By the inserting step 1 of DNA fragmentation 3)The multicloning sites downstream of the intermediate carrier A for obtaining, obtains restructuring and carries
Body;
II comprises the steps:
A, the multicloning sites downstream that DNA fragmentation 3 is inserted described interference carrier, obtain containing the upstream polyclone
The intermediate carrier B in site;
The upstream multiple clone site of B, the intermediate carrier B for obtaining inserting step A of DNA fragmentation 2, obtains restructuring and carries
Body;
The DNA fragmentation 2 includes target protein encoding gene segment and respectively positioned at target protein encoding gene both sides
It is described respectively positioned at target protein encoding gene segment both sides for insertion vector for 2 kinds of DNA moleculars of insertion vector
2 kinds of DNA moleculars include at least one restriction enzyme site and the interference carrier in the upstream multiple clone site or with it is described
Intermediate carrier B homologous nucleotide;
The DNA fragmentation 3 includes the reverse complemental fragment of target protein encoding gene and is located at the target protein respectively
2 kinds of DNA moleculars for insertion vector of the reverse complemental fragment both sides of encoding gene, it is described to be located at the target protein respectively
2 kinds of DNA moleculars for insertion vector of the reverse complemental fragment both sides of encoding gene include the multicloning sites downstream
In at least one restriction enzyme site and the interference carrier or the nucleotide homologous with the intermediate carrier A;
The nucleotides sequence of the DNA fragmentation 2 is classified as sequence 4 in sequence table;
The nucleotides sequence of the DNA fragmentation 3 is classified as sequence 5 in sequence table.
The DNA fragmentation 2 can also be inserted in interference carrier multicloning sites downstream, and the DNA fragmentation 3 can also be inserted in dry
Carrier upstream multiple clone site is disturbed, as long as sense fragment and antisense fragments is in opposite direction.
In the structure of above-mentioned recombinant vector, existing homologous recombination sequence has double digestion position again in DNA fragmentation 2 and DNA fragmentation 3
Point, you can at the multiple clone site by homologous recombination insertion vector, obtain recombinant vector;Again can be by double digestion and process
The carrier connection that same enzyme action is obtained, obtains recombinant vector.
Described interference carrier and/or the recombinant vector are in plant transgene breeding and/or identification gene function
Using.
During application of the recombinant vector in plant transgene breeding and/or gene functional research is to suppress purpose plant
Target gene expression, obtain transgenic plant;The plant height of the transgenic plant is less than the purpose plant;The suppression mesh
Plant in target gene expression method be by proceed to in the purpose plant recombinant expression carrier realize.
The nucleotides sequence of the target gene is classified as sequence 3 in sequence table;
The purpose plant is monocotyledon or dicotyledon, and the dicotyledon is preferably Semen sojae atricolor.
It is demonstrated experimentally that the present invention uses it to structure is directed to regulation protein and oil in soybean oil route of synthesis metabolism
Fat content ratio key gene phosphoric acid enol pyruvic acid carboxylase (Phosphoenolpyruvate carboxylase,
PEPc)Rna interference vector, then in soybean transformation receptor kind Williams82.Rna interference vector expresses shape in receptor
Into shRNA siRNA is cut into by Dicer enzymes(Small interfering RNA, disturb tiny RNA);SiRNA can specificity
Suppress the expression of target gene, so that oil content increases in soybean kernel, and then the purpose of GmPEPc gene functions.
Compared with existing plant RNA interference carrier, good effect of the present invention is:
1st, using 35s strong promoters.The expression of shRNA can be significantly improved using the rna interference vector, so as to improve target
The jamming effectiveness of gene, strengthens interference effect, and the carrier is particularly well-suited to the dicotyledons such as arabidopsiss, Semen sojae atricolor.
2nd, using Oryza sativa L. GAS1 genes intron as shRNA circulus.During intron montage,
ShRNA target genes justice and being mutually paired for antisense sequences are strengthened, and be increased shRNA and are cut into siRNA by Dicer enzymes
Probability, so as to improve the jamming effectiveness of target gene, strengthen interference effect.
3rd, respectively with the addition of digestion with restriction enzyme at the left and right sides multiple clone site of carrier GAS1 gene introns
Site, facilitates the clone of target gene interference fragment.
4th, when target gene interference fragment PCR primer is designed, homologous recombination sequence and double digestion are introduced simultaneously in primer
Site.The visual concrete condition of subsequent experimental not only operates spirit from homologous recombination directed cloning or double digestion connection cloning process
It is living, and overcome the restriction of restriction enzyme site with homologous recombination directional cloning method.
5th, the present invention includes design, clone's target gene interference fragment, screens the recombinant vector containing target gene interference fragment,
The standardized method of the sequence of operations such as detection transgenic interference plant;And carry containing the restructuring of target gene interference fragment in screening
PCR detection primers used in the application processes such as body, detection transgenic interference plant.It is real when using the rna interference vector
Testing operation becomes simple, advantageously reduces error, improves work efficiency.
Description of the drawings
Fig. 1 is the structure flow chart of pLYZRNAi carriers.
Fig. 2 is the structural representation of pLYZRNAi carriers.
Fig. 3 identifies electrophoretogram for the enzyme action of pLYZRNAi recombinant vectors.
Fig. 4 is the structure flow chart of pLYZRNAi-GmPEPc carriers.
Fig. 5 is pLYZRNAi-GmPEPc carrier structure schematic diagrams.
Fig. 6 identifies electrophoretogram for the enzyme action of pLYZRNAi-GmPEPc recombinant vectors.
PCR shown in Fig. 7 identifies pLYZRNAi-sense-GmPEPc recombinant vectors.
PCR shown in Fig. 8 identifies pLYZRNAi-GmPEPc recombinant vectors.
Fig. 9 is Genetic Transformation of Soybean flow chart.
Figure 10 is that PCR detects T1 for transgenic progeny material.
Specific embodiment
With reference to the accompanying drawings and examples the invention will be further described:Experimental technique used in embodiment is such as
Without specified otherwise, conventional method is;And material used, reagent etc. in embodiment, if no special instructions, can be from business
Approach is obtained.
The structure of embodiment 1, rna interference vector pLYZRNAi
Rna interference vector pLYZRNAi is with the method for homologous recombination directed cloning, by the intron of Oryza sativa L. GAS1 genes
Forward direction is cloned in the plant expressing vector pTF101-35s with Bar labellings(Fig. 1 is experiment flow figure), rna interference vector
The structural representation of pLYZRNAi is as shown in Fig. 2 concrete grammar is as follows:
1st, Oryza sativa L. GAS1 genes LOC_Os01g68860 includes the acquisition of sub-piece
Synthesize the intron sequences of Oryza sativa L. GAS1 genes using synthetic gene technology, and in two sections of sequence plus used
Multiple clone site a and b, be sequence 2;Then BamI and SacI enzymes design amplification intron is selected according to pTF101-35s carriers
Primer sequence it is as follows(BamI and SacI restriction enzyme sites both sides is homologous on letter representation pTF101-35s carriers with underscore
Recombination sequence.):
GAS1 intron-F:5'-TAGAAACAGAGGATCCGGATCCAACAGCCCCGGGAA-3';
GAS1 intron-R:5'- GATCGGGGAAATTCGAGCTCGAGCTCTCTAGAACTAGTATCGATG-3'。
PCR amplification programs:94 ℃ 2 min;98 DEG C of 10 sec, 60 DEG C of 5 sec, 72 DEG C of 1.5 min again, 30
Circulation;Last 72 DEG C of 7 min.
DNA with above-mentioned synthetic as template, using above-mentioned PCR amplification programs, with GAS1 intron-F and GAS1
Intron-R as primer enter performing PCR amplification, electrophoresis result referring to Fig. 3 in the 5th swimming lane, be the purpose band piece of amplification gene
Section.
The upstream multiple clone site is(BamI, SmaI and MluI);
The multicloning sites downstream is(SacI, SpeI and HpaI).
Reclaim PCR primer standby.
2nd, the preparation of BamI and SacI enzyme action pTF101-35S linear carriers
Using BamI the and SacI restricted enzyme of Co., Ltd in NEB, enzyme action pTF101-35S carriers(Electrophoresis is examined
Survey 2 swimming lanes such as Fig. 3)(Paz, M., Martinez, J. C., Kalvig, A., Fonger, T., Wang, K.
(2010) Agrobacterium-mediated transformation of soybean and recovery of
The transgenic soybean plants. public can obtain from Jilin Academy of Agricultural Science agro-ecology institute.), reclaim
It is standby through the pTF101-35S linear carriers of enzyme action.3 swimming lanes of electrophoresis detection such as Fig. 3.
3rd, the acquisition of pLYZRNAi recombinant vectors
1)The homologous recombination directed cloning of GAS1 gene introns
Step 1 is obtained using the CloneEZ homologous recombination directed cloning test kits of Co., Ltd in GenScript
The linear carrier of the recovery that the PCR primer of recovery is obtained with step 2 carries out homologous recombination reaction, and reaction system is as shown in table 1:
The homologous recombination reaction system of table 1
The operating procedure of homologous recombination directed cloning is as follows:
(1)Each reactive component in above-mentioned reaction system is prepared in 1.5 ml centrifuge tubes, it is slight to mix, by sample 22
The min of recombining reaction 30 in DEG C water-bath;
(2)After reaction terminates, sample is placed on and be incubated on ice 5 min.
(3)By step(2)The product for obtaining proceeds to TransT1-1 competent cells(Purchased from the full formula gold biotechnology in Beijing
Company limited)In, obtain transformant.
2)Identification pLYZRNAi recombinant vectors, electrophoresis result is shown in Fig. 3
Above-mentioned transformant is selected, is inoculated in the LB fluid mediums containing spectinomycin, incubated overnight;Take incubated overnight
Bacterium solution, using GAS1 intron-F and GAS1intron-R primers, carries out pcr amplification reaction as PCR reaction template.
As a result as shown in figure 3, PCR and enzyme action detect pTF101-35S carriers and GAS1 gene intron PCR augmentation detections,
1:Trans 15K DNA marker;2:The pTF101-35s zero load body constitution of the pTF101-35S without GAS1 gene introns
Grain;3:PTF101-35S recombinant vectors containing GAS1 gene introns(pLYZRNAi)Plasmid;4:BamI and SacI enzyme action
PLYZRNAi results;5:The PCR primer of GAS1 genes;6:DL2000 DNA marker.
The plasmid is sent to into sequencing, sequencing primer is Left MCS-F and Right MCS-R(Primer sequence and carrier
Fragment on pTF101-35S matches), primer sequence is as follows:
Left MCS-F:5'-CGCACAATCCCACTATCCTT-3';
Right MCS-R:5'-AAGACCGGCAACAGGATTC-3'.
Sequencing result shows that the plasmid is by the sequence 2 in sequence table(Include containing GAS1 gene LOC_Os01g68860
Sub-piece)It is cloned into the recombinant vector obtained at BamI the and SacI restriction enzyme sites of pTF101-35S carriers, and by GAS1 genes
LOC_Os01g68860 includes sub-piece and is cloned into behind the 35s promoteres of pTF101-35S carriers, and the plasmid is named as
PLYZRNAi, as rna interference vector, sequence 1.The structural representation of the carrier as shown in Fig. 2 as seen from the figure, the carrier
With upstream multiple clone site and multicloning sites downstream.
The application of embodiment 2, rna interference vector pLYZRNAi
First, the structure of GmPEPc gene RNAs interference carrier pLYZRNAi-GmPEPc, builds flow process referring to Fig. 4, and structure is shown
Intention is shown in Fig. 5, and PCR and enzyme action qualification result are shown in Fig. 6.
1st, the acquisition of GmPEPc genes interference fragment
Phosphoric acid enol pyruvic acid carboxylase PEPc participates in protein, the regulation and control of fat content ratio, suppression in plant seed
The expression of PEPc processed is the effective way for improving grain oil content.
1)Design of primers
1)Primer used by amplification GmPEPc gene justice interference fragments
In the upstream multiple clone site of the letter representation pLYZRNAi carriers with underscore, select BamI and SmaI restricted
Inscribe cleavage sites(Can be cloned on carrier by Homo~logous exchange or double digestion connection), left oblique line represent BamI and SmaI limit
Property inscribe enzyme action processed, primer sequence is as follows:
GmPEPc-RNAi-sense-F:5'-TAGAAACAGAGGATC/CGCTGGAGATTCCATTGTGGT-3'(This draws
Thing contains BamHI restriction enzyme sites);
GmPEPc-RNAi-sense-R:5'-GCGTGCTGTTCCCGG/GCCTTCCATGTTTTTGAAGCAA-3'(This draws
Thing contains SamI restriction enzyme sites).
The PCR primer that existing homologous recombination sequence has restriction enzyme site, the later stage again in primer above can both pass through homologous heavy
Group is connected with carrier, also can be connected with carrier by double digestion connection.
(2)Primer used by amplification GmPEPc gene antisense interference fragments
On the multicloning sites downstream of the letter representation pLYZRNAi carriers with underscore, SpeI and SacI restriction enzyme sites two
The homologous recombination sequence of side(Can be by homologous same group directed cloning on carrier), left oblique line represent SpeI and SacI it is restricted in
Enzyme cutting cleavage site(Can be cloned on carrier by double digestion connection), primer sequence is as follows:
GmPEPc-RNAi-antisense-F:
5'-TAACATCGATACTAGT/GCTGGAGATTCCATTGTGGT-3'(This primer contains SpeI restriction enzyme sites);
GmPEPc-RNAi-antisense-R:
5'-GATCGGGGAAATTCG/AGCTCCCTTCCATGTTTTTGAAGCAA-3'(This primer contains SacI enzyme action position
Point).
The PCR primer that existing homologous recombination sequence has restriction enzyme site, the later stage again in primer above can both pass through homologous heavy
Group is connected with carrier, also can be connected with carrier by double digestion connection.
2)The extraction of the seedling RNA of soybean varieties Williams 82 and the preparation of cDNA
Using RNA prep pure plant total RNA extraction reagent boxes(Purchased from Tiangeng biochemical technology(Beijing)Company limited),
30 days seedling RNA of Semen sojae atricolor Williams 82 are extracted, reverse transcription obtains cDNA.
3)PCR expands GmPEPc gene interference fragments
With cDNA as template, enter performing PCR with GmPEPc-RNAi-sense-F and GmPEPc-RNAi-sense-R primers and expand
Increase, obtain PCR primer 1.With cDNA as template, with GmPEPc-RNAi-antisense-F and GmPEPc-RNAi-
Antisense-R primers enter performing PCR amplification, obtain PCR primer 2.
PCR primer 1 and 2 is separately recovered, and sends to sequencing, as a result show PCR primer 1 with shown in sequence 4 in sequence table
Nucleotide(A part in the sequence i.e. sequence 3, adds the carrier pLYZRNAi upstreams polyclone position needed for cloned sequence
The homologous recombination sequence of BamHI, SmaI restriction enzyme site both sides of point);Sequence 4 from 5 ' end 17-316 positions nucleotide be sequence
The sequence from 5 ' end 701-1414 positions nucleotide of row 3.), the as justice GmPEPc gene interference fragments of PCR primer 1;
PCR primer 2 has nucleotide shown in sequence 5 in sequence table(The sequence is the part in sequence 3, and added by sequence two ends
Cloned sequence needed for carrier pLYZRNAi multicloning sites downstreams SpeI and SacI double enzyme sites both sides it is homologous heavy
Group sequence), it is the reverse complemental fragment of sequence 4.Sequence 5 it is last from 5 ' for sequence 3 from 5 ' end 19-732 positions nucleotide
The reverse complemental fragment of 701-1414 positions nucleotide is held, therefore PCR primer 2 is antisense GmPEPc gene interference fragments.
The acquisition of the pLYZRNAi-sense-GmPEPc recombinant vectors the 2nd, with GmPEPc genes justice interference fragment
1)The homologous recombination directed cloning of GmPEPc genes justice interference fragment
The pLYZRNAi carriers obtained with BamHI and SmaI enzyme action example 1, obtain linear pLYZRNAi, reclaim stand-by.
Using double methods for cutting doubly-linked or homologous recombination directed cloning(Concrete steps and reaction system are shown in the 3 of embodiment 1),
First the PCR primer 1 and linear pLYZRNAi of recovery are carried out into homologous recombination reaction, then homologous recombination product is proceeded to into TransT1-
1 competent cell, obtains transformant.
2)Identification pLYZRNAi-sense-GmPEPc recombinant vectors
Select 1)The transformant of middle gained, is inoculated in the LB fluid mediums containing spectinomycin, incubated overnight;Take overnight
The bacterium solution of culture, using Left MCS-F and Left MCS-R primers, carries out pcr amplification reaction as PCR reaction template.As a result
As shown in fig. 7, PCR identification pLYZRNAi-sense-GmPEPc recombinant vectors.As can be seen that obtain 520bp DNA bands i.e.
For positive colony, primer sequence is as follows:
Left MCS-F:5'-CGCACAATCCCACTATCCTT-3';
Left MCS-R:5'-AGGCGGTACAATGATCAACC-3'.
The plasmid of positive colony is extracted, is through the detection of BamHI and SamI enzyme action in 4 swimming lanes in electrophoresis detection such as Fig. 6
PLYZRNAi-sense GmPEPc carriers.6 swimming lanes are the PCR primer of sense GmPEPc.
The plasmid is sent to into sequencing, sequencing primer is Left MCS-F and Left MCS-R, and sequencing result shows, the plasmid
It is by the sequence 3 in sequence table(GmPEPc genes justice interference fragment)It is cloned into the upstream multiple clone site of pLYZRNAi carriers
The recombinant vector obtained at BamHI and SamI, by plasmid pLYZRNAi-sense-GmPEPc carriers are named as
3rd, the acquisition with GmPEPc genes justice and the pLYZRNAi-GmPEPc recombinant vectors of antisense interference fragment
1)The homologous recombination directed cloning of GmPEPc gene antisense interference fragments
With SpeI and SacI enzyme action steps 2,2)In the pLYZRNAi-sense-GmPEPc that obtains, reclaim linear
pLYZRNAi-sense-GmPEPc.It is SpeI and SacI enzyme action pLYZRNAi-sense shown in 5 swimming lanes of the electrophoresis in Fig. 6
The enzyme action testing result of GmPEPc carriers.
Using the method for homologous recombination directed cloning(Concrete steps and reaction system are shown in the 3 of embodiment 1), first by recovery
PCR primer 2 and linear pLYZRNAi-sense-GmPEPc carry out homologous recombination reaction, then homologous recombination product is proceeded to
TransT1-1 competent cells, obtain transformant.
2)Identification pLYZRNAi-GmPEPc recombinant vectors
Select 1)The transformant of middle gained, is inoculated in the LB fluid mediums containing spectinomycin, incubated overnight;Take overnight
The bacterium solution of culture, using Right MCS-F and Right MCS-R primers, carries out pcr amplification reaction as PCR reaction template.Knot
Fruit is as shown in figure 8, PCR identification pLYZRNAi-GmPEPc recombinant vectors.As can be seen that obtaining being for 425bp DNA bands
Positive colony.Primer sequence is as follows:
Right MCS-F:5'-TATGACACGGCTGTTTCGAG-3';
Right MCS-R:5'-GAATCCTGTTGCCGGTCTT-3'.
The plasmid is sent to into sequencing, with Left MCS-F, Left MCS-R, Right MCS-F and Right MCS-R conducts
Sequencing primer.Sequencing result shows that the plasmid is by the sequence 4 in sequence table(GmPEPc gene antisense interference fragments)It is cloned into
The recombinant vector obtained at pLYZRNAi-sense-GmPEPc carrier Ss peI and SacI restriction enzyme sites;Alternatively the plasmid is
By the sequence 3 in sequence table(GmPEPc genes justice interference fragment)In being cloned into the upstream multiple clone site of pLYZRNAi carriers
BamHI and SamI at, and by the sequence 4 in sequence table(GmPEPc gene antisense interference fragments)It is cloned into pLYZRNAi carriers
Multicloning sites downstream in SpeI and SacI restriction enzyme sites at the recombinant vector that obtains.The plasmid is named as
pLYZRNAi-GmPEPc.The structural representation of pLYZRNAi-GmPEPc is as shown in figure 4, structure flow process is as shown in Figure 3.
The basic skills of above-mentioned homologous recombination directed cloning can also be adopted, first enters GmPEPc gene antisense interference fragments
Row homologous recombination directed cloning obtains intermediate carrier, then GmPEPc genes justice interference fragment is inserted into above-mentioned intermediate carrier, obtains
To pLYZRNAi-GmPEPc recombinant vectors.Through sequencing identification, vector construction is correct.The method that enzyme action connection can also be used
Build pLYZRNAi-GmPEPc recombinant vectors:
It is specific as follows:First by SpeI the and SacI enzyme action of PCR primer 1, the digestion products for obtaining with through same enzyme action
PLYZRNAi carriers connect, and obtain intermediate carrier;Again by the BamH I and SmaI enzyme action of PCR primer 2, the digestion products for obtaining with
Connect through the intermediate carrier of same enzyme action, obtain pLYZRNAi-GmPEPc recombinant vectors.Through sequencing identification, vector construction
Correctly.
2nd, the genetic transformation of rna interference vector pLYZRNAi-GmPEPc
PLYZRNAi-GmPEPc carriers are proceeded in EHA101 Agrobacteriums, transformant is obtained.Transformant extraction plasmid is sent
Sequencing is gone, as a result shows that plasmid is pLYZRNAi-GmPEPc, therefore the transformant containing pLYZRNAi-GmPEPc is named as
EHA101/pLYZRNAi-GmPEPc。
EHA101/pLYZRNAi-GmPEPc is proceeded to into Semen sojae atricolor receptor kind using soybean cotyledon node genetic transformation
In Williams82(Fig. 9, the conversion process of soybean cotyledon node genetic transformation.)In, comprise the following steps that:
(1)Single bacterium colony is taken from flat board, 10mlYEB fluid mediums is accessed and is added in 50mg/L Kan, 26 DEG C, 160r/min
Bacterium solution is diluted 2 times, as the engineering bacterium solution of Agrobacterium by shaken cultivation to logarithmic (log) phase, OD600=0.6 with MSO fluid mediums.
(2)Transgenic method adopts agriculture bacillus mediated soybean cotyledon node conversion method.After soybean seed sterilization, in addition
1d is sprouted in MSB5 culture medium, kind of a skin is removed, seed is cut into into 2 half along plumular axis, each half all carries a piece of cotyledon and 3~5
Mm hypocotyls.Explant is immersed in 30 minutes in ready engineering bacterium solution, the explant invaded after bacterium is further taken out and is inserted filter paper
On, unnecessary bacterium solution is sopped up, go to co-cultivation base and cultivate, proceed to bud inducement cultivation base after 5 days again, bud elongation training is proceeded to after 28 days
Foster base, treats that resistant budses are extended to 3~4cm per two weeks subcultures once, resistant budses is cut and is put into induction life in root media
Root, induces and transplanted after root, and being put into greenhouse makes it blossom and bear fruit.
(3)Empty carrier pLYZRNAi is proceeded in Semen sojae atricolor receptor kind Williams82, as reality using same method
Control in testing.
3rd, GmPEPc genes T1 generations interference soybean genotype and phenotypic evaluation
1st, genotype identification
The DNA that T1 disturbs plant for GmPEPc genes is extracted, positive fragment is with Left MCS-F and Left MCS-R to draw
Thing, enters performing PCR detection, and obtain 520bp DNA bands is positive colony.Reversely fragment is with Right MCS-F and Right
MCS-R is primer, and the T1 that is for obtaining 425bp DNA bands disturbs Oryza sativa L. for GmPEPc genes(Figure 10).9 plants of PCR are obtained
The T1 for being accredited as the positive disturbs Semen sojae atricolor for GmPEPc genes.
2nd, phenotypic evaluation
We, for transgenic positive material, carry out the measure of oil content to this 9 plants positive T1, adopt and proceed to empty carrier
Semen sojae atricolor receptor kind Williams82 of pLYZRNAi is compareed.
Result of the test shows have the oil content in 8 familys to compare in 9 transgenic lines for turning GmPEPc gene T2 generations
According to increase, wherein there is oil content in 3 transgenic lines seeds to improve more than 10(Table 2)
The T2 of table 2 is for oil content content in transgenic progeny seed
Kind(plant line) | Oil content content % oil | Compared with CK ± % |
CK (Williams 82) | 20.6 ± 0.5 | 0 |
1 | 21.1 ± 1.8 | +4.6 |
2 | 22.7 ± 1.3 | +10.12 |
3 | 24.3 ± 0.9 | +17.96 |
4 | 22.6 ± 0.9 | +9.7 |
5 | 23.4 ± 1.5 | +13.6 |
6 | 21.7 ± 0.8 | +5.3 |
7 | 21.3 ± 0.9 | +3.4 |
8 | 21.8 ± 2.2 | +5.82 |
9 | 18.8 ± 1.7 | -8.7 |
These results suggest that, the plant RNA interference carrier that the present invention is provided expresses the shRNA quilts of formation in receptor
Dicer enzymes cut into siRNA;SiRNA can specifically suppress the expression of target gene GmPEPc, so as to reach control soybean seed
The content of oil content is planted, the purpose of GmPEPc gene functions is studied.
The invention discloses a kind of rna interference vector and its application.In plant transgene breeding and gene functional research side
Face has important using value, and the present invention provides new technological means for plant transgene breeding and gene functional research.
<110>Jilin Academy of Agricultural Science
<120>
<140>
<160> 1
<210> 1
<211> 10819 bp
<212> DNA
<213> pLYZRNAi
<400> 1
agtactttaaagtactttaaagtactttaaagtactttgatccaacccctccgctgctat 61
agtgcagtcggcttctgacgttcagtgcagccgtcttctgaaaacgacatgtcgcacaag 121
tcctaagttacgcgacaggctgccgccctgcccttttcctggcgttttcttgtcgcgtgt 181
tttagtcgcataaagtagaatacttgcgactagaaccggagacattacgccatgaacaag 241
agcgccgccgctggcctgctgggctatgcccgcgtcagcaccgacgaccaggacttgacc 301
aaccaacgggccgaactgcacgcggccggctgcaccaagctgttttccgagaagatcacc 361
ggcaccaggcgcgaccgcccggagctggccaggatgcttgaccacctacgccctggcgac 421
gttgtgacagtgaccaggctagaccgcctggcccgcagcacccgcgacctactggacatt 481
gccgagcgcatccaggaggccggcgcgggcctgcgtagcctggcagagccgtgggccgac 541
accaccacgccggccggccgcatggtgttgaccgtgttcgccggcattgccgagttcgag 601
cgttccctaatcatcgaccgcacccggagcgggcgcgaggccgccaaggcccgaggcgtg 661
aagtttggcccccgccctaccctcaccccggcacagatcgcgcacgcccgcgagctgatc 721
gaccaggaaggccgcaccgtgaaagaggcggctgcactgcttggcgtgcatcgctcgacc 781
ctgtaccgcgcacttgagcgcagcgaggaagtgacgcccaccgaggccaggcggcgcggt 841
gccttccgtgaggacgcattgaccgaggccgacgccctggcggccgccgagaatgaacgc 901
caagaggaacaagcatgaaaccgcaccaggacggccaggacgaaccgtttttcattaccg 961
aagagatcgaggcggagatgatcgcggccgggtacgtgttcgagccgcccgcgcacgtct 1021
caaccgtgcggctgcatgaaatcctggccggtttgtctgatgccaagctggcggcctggc 1081
cggccagcttggccgctgaagaaaccgagcgccgccgtctaaaaaggtgatgtgtatttg 1141
agtaaaacagcttgcgtcatgcggtcgctgcgtatatgatgcgatgagtaaataaacaaa 1201
tacgcaaggggaacgcatgaaggttatcgctgtacttaaccagaaaggcgggtcaggcaa 1261
gacgaccatcgcaacccatctagcccgcgccctgcaactcgccggggccgatgttctgtt 1321
agtcgattccgatccccagggcagtgcccgcgattgggcggccgtgcgggaagatcaacc 1381
gctaaccgttgtcggcatcgaccgcccgacgattgaccgcgacgtgaaggccatcggccg 1441
gcgcgacttcgtagtgatcgacggagcgccccaggcggcggacttggctgtgtccgcgat 1501
caaggcagccgacttcgtgctgattccggtgcagccaagcccttacgacatatgggccac 1561
cgccgacctggtggagctggttaagcagcgcattgaggtcacggatggaaggctacaagc 1621
ggcctttgtcgtgtcgcgggcgatcaaaggcacgcgcatcggcggtgaggttgccgaggc 1681
gctggccgggtacgagctgcccattcttgagtcccgtatcacgcagcgcgtgagctaccc 1741
aggcactgccgccgccggcacaaccgttcttgaatcagaacccgagggcgacgctgcccg 1801
cgaggtccaggcgctggccgctgaaattaaatcaaaactcatttgagttaatgaggtaaa 1861
gagaaaatgagcaaaagcacaaacacgctaagtgccggccgtccgagcgcacgcagcagc 1921
aaggctgcaacgttggccagcctggcagacacgccagccatgaagcgggtcaactttcag 1981
ttgccggcggaggatcacaccaagctgaagatgtacgcggtacgccaaggcaagaccatt 2041
accgagctgctatctgaatacatcgcgcagctaccagagtaaatgagcaaatgaataaat 2101
gagtagatgaattttagcggctaaaggaggcggcatggaaaatcaagaacaaccaggcac 2161
cgacgccgtggaatgccccatgtgtggaggaacgggcggttggccaggcgtaagcggctg 2221
ggttgtctgccggccctgcaatggcactggaacccccaagcccgaggaatcggcgtgagc 2281
ggtcgcaaaccatccggcccggtacaaatcggcgcggcgctgggtgatgacctggtggag 2341
aagttgaaggccgcgcaggccgcccagcggcaacgcatcgaggcagaagcacgccccggt 2401
gaatcgtggcaagcggccgctgatcgaatccgcaaagaatcccggcaaccgccggcagcc 2461
ggtgcgccgtcgattaggaagccgcccaagggcgacgagcaaccagattttttcgttccg 2521
atgctctatgacgtgggcacccgcgatagtcgcagcatcatggacgtggccgttttccgt 2581
ctgtcgaagcgtgaccgacgagctggcgaggtgatccgctacgagcttccagacgggcac 2641
gtagaggtttccgcagggccggccggcatggccagtgtgtgggattacgacctggtactg 2701
atggcggtttcccatctaaccgaatccatgaaccgataccgggaagggaagggagacaag 2761
cccggccgcgtgttccgtccacacgttgcggacgtactcaagttctgccggcgagccgat 2821
ggcggaaagcagaaagacgacctggtagaaacctgcattcggttaaacaccacgcacgtt 2881
gccatgcagcgtacgaagaaggccaagaacggccgcctggtgacggtatccgagggtgaa 2941
gccttgattagccgctacaagatcgtaaagagcgaaaccgggcggccggagtacatcgag 3001
atcgagctagctgattggatgtaccgcgagatcacagaaggcaagaacccggacgtgctg 3061
acggttcaccccgattactttttgatcgatcccggcatcggccgttttctctaccgcctg 3121
gcacgccgcgccgcaggcaaggcagaagccagatggttgttcaagacgatctacgaacgc 3181
agtggcagcgccggagagttcaagaagttctgtttcaccgtgcgcaagctgatcgggtca 3241
aatgacctgccggagtacgatttgaaggaggaggcggggcaggctggcccgatcctagtc 3301
atgcgctaccgcaacctgatcgagggcgaagcatccgccggttcctaatgtacggagcag 3361
atgctagggcaaattgccctagcaggggaaaaaggtcgaaaaggtctctttcctgtggat 3421
agcacgtacattgggaacccaaagccgtacattgggaaccggaacccgtacattgggaac 3481
ccaaagccgtacattgggaaccggtcacacatgtaagtgactgatataaaagagaaaaaa 3541
ggcgatttttccgcctaaaactctttaaaacttattaaaactcttaaaacccgcctggcc 3601
tgtgcataactgtctggccagcgcacagccgaagagctgcaaaaagcgcctacccttcgg 3661
tcgctgcgctccctacgccccgccgcttcgcgtcggcctatcgcggccgctggccgctca 3721
aaaatggctggcctacggccaggcaatctaccagggcgcggacaagccgcgccgtcgcca 3781
ctcgaccgccggcgcccacatcaaggcaccctgcctcgcgcgtttcggtgatgacggtga 3841
aaacctctgacacatgcagctcccggagacggtcacagcttgtctgtaagcggatgccgg 3901
gagcagacaagcccgtcagggcgcgtcagcgggtgttggcgggtgtcggggcgcagccat 3961
gacccagtcacgtagcgatagcggagtgtatactggcttaactatgcggcatcagagcag 4021
attgtactgagagtgcaccatatgcggtgtgaaataccgcacagatgcgtaaggagaaaa 4081
taccgcatcaggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcgg 4141
ctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggg 4201
gataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaag 4261
gccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcga 4321
cgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccct 4381
ggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcc 4441
tttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcg 4501
gtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgc 4561
tgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgcca 4621
ctggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagag 4681
ttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgct 4741
ctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaacc 4801
accgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaagga 4861
tctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactca 4921
cgttaagggattttggtcatgcatgatatatctcccaatttgtgtagggcttattatgca 4981
cgcttaaaaataataaaagcagacttgacctgatagtttggctgtgagcaattatgtgct 5041
tagtgcatctaacgcttgagttaagccgcgccgcgaagcggcgtcggcttgaacgaattt 5101
ctagctagacattatttgccgactaccttggtgatctcgcctttcacgtagtggacaaat 5161
tcttccaactgatctgcgcgcgaggccaagcgatcttcttcttgtccaagataagcctgt 5221
ctagcttcaagtatgacgggctgatactgggccggcaggcgctccattgcccagtcggca 5281
gcgacatccttcggcgcgattttgccggttactgcgctgtaccaaatgcgggacaacgta 5341
agcactacatttcgctcatcgccagcccagtcgggcggcgagttccatagcgttaaggtt 5401
tcatttagcgcctcaaatagatcctgttcaggaaccggatcaaagagttcctccgccgct 5461
ggacctaccaaggcaacgctatgttctcttgcttttgtcagcaagatagccagatcaatg 5521
tcgatcgtggctggctcgaagatacctgcaagaatgtcattgcgctgccattctccaaat 5581
tgcagttcgcgcttagctggataacgccacggaatgatgtcgtcgtgcacaacaatggtg 5641
acttctacagcgcggagaatctcgctctctccaggggaagccgaagtttccaaaaggtcg 5701
ttgatcaaagctcgccgcgttgtttcatcaagccttacggtcaccgtaaccagcaaatca 5761
atatcactgtgtggcttcaggccgccatccactgcggagccgtacaaatgtacggccagc 5821
aacgtcggttcgagatggcgctcgatgacgccaactacctctgatagttgagtcgatact 5881
tcggcgatcaccgcttcccccatgatgtttaactttgttttagggcgactgccctgctgc 5941
gtaacatcgttgctgctccataacatcaaacatcgacccacggcgtaacgcgcttgctgc 6001
ttggatgcccgaggcatagactgtaccccaaaaaaacagtcataacaagccatgaaaacc 6061
gccactgcgccgttaccaccgctgcgttcggtcaaggttctggaccagttgcgtgacggc 6121
agttacgctacttgcattacagcttacgaaccgaacgaggcttatgtccactgggttcgt 6181
gcccgaattgatcacaggcagcaacgctctgtcatcgttacaatcaacatgctaccctcc 6241
gcgagatcatccgtgtttcaaacccggcagcttagttgccgttcttccgaatagcatcgg 6301
taacatgagcaaagtctgccgccttacaacggctctcccgctgacgccgtcccggactga 6361
tgggctgcctgtatcgagtggtgattttgtgccgagctgccggtcggggagctgttggct 6421
ggctggtggcaggatatattgtggtgtaaacaaattgacgcttagacaacttaataacac 6481
attgcggacgtttttaatgtactgaattaacgccgaattgctctagcattcgccattcag 6541
gctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggc 6601
gaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacg 6661
acgttgtaaaacgacggccagtgccaagctaattcgcttcaagacgtgctcaaatcacta 6721
tttccacacccctatatttctattgcactcccttttaactgttttttattacaaaaatgc 6781
cctggaaaatgcactccctttttgtgtttgtttttttgtgaaacgatgttgtcaggtaat 6841
ttatttgtcagtctactatggtggcccattatattaatagcaactgtcggtccaatagac 6901
gacgtcgattttctgcatttgtttaaccacgtggattttatgacattttatattagttaa 6961
tttgtaaaacctacccaattaaagacctcatatgttctaaagactaatacttaatgataa 7021
caattttcttttagtgaagaaagggataattagtaaatatggaacaagggcagaagattt 7081
attaaagccgcggtaagagacaacaagtaggtacgtggagtgtcttaggtgacttaccca 7141
cataacataaagtgacattaacaaacatagctaatgctcctatttgaatagtgcatatca 7201
gcataccttattacatatagataggagcaaactctagctagattgttgagcagatctcgg 7261
tgacgggcaggaccggacggggcggtaccggcaggctgaagtccagctgccagaaaccca 7321
cgtcatgccagttcccgtgcttgaagccggccgcccgcagcatgccgcggggggcatatc 7381
cgagcgcctcgtgcatgcgcacgctcgggtcgttgggcagcccgatgacagcgaccacgc 7441
tcttgaagccctgtgcctccagggacttcagcaggtgggtgtagagcgtggagcccagtc 7501
ccgtccgctggtggcggggggagacgtacacggtcgactcggccgtccagtcgtaggcgt 7561
tgcgtgccttccaggggcccgcgtaggcgatgccggcgacctcgccgtccacctcggcga 7621
cgagccagggatagcgctcccgcagacggacgaggtcgtccgtccactcctgcggttcct 7681
gcggctcggtacggaagttgaccgtgcttgtctcgatgtagtggttgacgatggtgcaga 7741
ccgccggcatgtccgcctcggtggcacggcggatgtcggccgggcgtcgttctgggctca 7801
tggtagatcccccgttcgtaaatggtgaaaattttcagaaaattgcttttgctttaaaag 7861
aaatgatttaaattgctgcaatagaagtagaatgcttgattgcttgagattcgtttgttt 7921
tgtatatgttgtgttgagaattaattctcgaggtcctctccaaatgaaatgaacttcctt 7981
atatagaggaagggtcttgcgaaggatagtgggattgtgcgtcatcccttacgtcagtgg 8041
agatatcacatcaatccacttgctttgaagacgtggttggaacgtcttctttttccacga 8101
tgctcctcgtgggtgggggtccatctttgggaccactgtcggtagaggcatcttgaacga 8161
tagcctttcctttatcgcaatgatggcatttgtaggagccaccttccttttccactatct 8221
tcacaataaagtgacagatagctgggcaatggaatccgaggaggtttccggatattaccc 8281
tttgttgaaaagtctcaattgccctttggtcttctgagactgtatctttgatatttttgg 8341
agtagacaagtgtgtcgtgctccaccatgttatcacatcaatccacttgctttgaagacg 8401
tggttggaacgtcttctttttccacgatgctcctcgtgggtgggggtccatctttgggac 8461
cactgtcggcagaggcatcttcaacgatggcctttcctttatcgcaatgatggcatttgt 8521
aggagccaccttccttttccactatcttcacaataaagtgacagatagctgggcaatgga 8581
atccgaggaggtttccggatattaccctttgttgaaaagtctcaattgccctttggtctt 8641
ctgagactgtatctttgatatttttggagtagacaagtgtgtcgtgctccaccatgttga 8701
cctgcaggcatgcaagcttgcatgcctgcaggtccccAGATTAGCCTTTTCAATTTCAGA 8761
AAGAATGCTAACCCACAGATGGTTAGAGAGGCTTACGCAGCAGGTCTCATCAAGACGATC 8821
TACCCGAGCAATAATCTCCAGGAAATCAAATACCTTCCCAAGAAGGTTAAAGATGCAGTC 8881
AAAAGATTCAGGACTAACTGCATCAAGAACACAGAGAAAGATATATTTCTCAAGATCAGA 8941
AGTACTATTCCAGTATGGACGATTCAAGGCTTGCTTCACAAACCAAGGCAAGTAATAGAG 9001
ATTGGAGTCTCTAAAAAGGTAGTTCCCACTGAATCAAAGGCCATGGAGTCAAAGATTCAA 9061
ATAGAGGACCTAACAGAACTCGCCGTAAAGACTGGCGAACAGTTCATACAGAGTCTCTTA 9121
CGACTCAATGACAAGAAGAAAATCTTCGTCAACATGGTGGAGCACGACACACTTGTCTAC 9181
TCCAAAAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCAATTGAGACTTTTCAACAA 9241
AGGGTAATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTTATTGTG 9301
AAGATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCC 9361
ATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGC 9421
ATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATC 9481
TCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATA 9541
TAAGGAAGTTCATTTCATTTGGAGAGAACACGGGGGACTCTAGAAACAGAGGATCCAACA 9601
GCCCCGGGAACAGCACGCGTGGTAAGTTACTACAAACCTTTTTGTATTTATGTTCCAGTG 9661
ACAATTATTTGTGTTCTCATGTTCCACGTATCACTTTAATGTTCATGGTTGATCATTGTA 9721
CCGCCTCATCTCTTTTAGAGGATCAAGAGTATATGCCTGTCTTAACTTTTTCTTTCTCTG 9781
GTCCAGTCTTTCCGCTGATATTAAGATGAATTTTACAACAAAAAATGTGCTGCCTGTGTA 9841
TGAAGGTTCAGAGGCATAGTTCATAATTTTACCCTGTTCTCAATTAGGAAATGTATTTTG 9901
CAAGGTCATAAAGTCTTGACATTGATGATCAAATATTTTCTAGAGCTAAAATTTCATAAT 9961
CAAATATGACAGTTCCACGGCAGTAGATAAAGAGTACCCACTGTATATATTAGTATGAAG 10021
ATTAACACTTGAAAAAACCTTTGATTGTTCCTATAACACCTAATGATTGACTATGACACG 10081
GCTGTTTCGAGATTTTCAGGTTAACATCGATACTAGTTCTAGAGAGCTCGAATTTCCCCG 10141
ATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGCGA 10201
TGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCA 10261
TGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACATTTAATACG 10321
CGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTA 10381
TGTTactagatcgggaattcgtaatcatgtcatagctgtttcctgtgtgaaattgttatc 10441
cgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcct 10501
aatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaa 10561
acctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgta 10621
ttggagcttgagcttggatcagattgtcgtttcccgccttcagtttaaactatcagtgtt 10681
tgacaggatatattggcgggtaaacctaagagaaaagagcgtttattagaataatcggat 10741
atttaaaagggcgtgaaaaggtttatccgttcgtccatttgtatgtgcatgccaaccaca 10801
gggttcccctcgggatcaa
<110>Jilin Academy of Agricultural Science
<120>
<140>
<160> 2
<210> 2
<211> 575 bp
<212> DNA
<213>Oryza sativa L.(Oryza sativa)
<400> 1
TAGAAACAGA GGATCCGGAT CCAACAGCCC CGGGAACAGC ACGCGTGGTA AGTTACTACA 61
AACCTTTTTG TATTTATGTT CCAGTGACAA TTATTTGTGT TCTCATGTTC CACGTATCAC 121
TTTAATGTTC ATGGTTGATC ATTGTACCGC CTCATCTCTT TTAGAGGATC AAGAGTATAT 181
GCCTGTCTTA ACTTTTTCTT TCTCTGGTCC AGTCTTTCCG CTGATATTAA GATGAATTTT 241
ACAACAAAAA ATGTGCTGCC TGTGTATGAA GGTTCAGAGG CATAGTTCAT AATTTTACCC 301
TGTTCTCAAT TAGGAAATGT ATTTTGCAAG GTCATAAAGT CTTGACATTG ATGATCAAAT 361
ATTTTCTAGA GCTAAAATTT CATAATCAAA TATGACAGTT CCACGGCAGT AGATAAAGAG 421
TACCCACTGT ATATATTAGT ATGAAGATTA ACACTTGAAA AAACCTTTGA TTGTTCCTAT 481
AACACCTAAT GATTGACTAT GACACGGCTG TTTCGAGATT TTCAGGTTAA CATCGATACT 541
AGTTCTAGAG AGCTCGAGCT CGAATTTCCC CGATC
<110>Jilin Academy of Agricultural Science
<120>
<140>
<160> 3
<210> 3
<211> 3211 bp
<212> DNA
<213>Semen sojae atricolor(Soybean)
<400> 1
cttctctctc tctctgtcat tggtttttct ctggttgaca tcatcgtcat ctactacttc 61
ttcctcttat ccaattggcc cccaacactg gttttggggt actttgaaaa gttgcaatgg 121
cgaacaggaa cttggaaaag atggcatcga ttgatgctca gcttcggctg ttggttccgg 181
ccaaagtgag tgaggatgac aaactggttg agtatgatgc tttgcttttg gatcggttcc 241
ttgatattct tcaggattta catggggagg atctgaaaga aacggttcaa gaggtgtatg 301
agctttctgc tgagtatgaa ggtaagcatg acccaaagaa actagaggaa cttggaaatc 361
tgataactag tttggatgct ggagattcca ttgtggttgc caagtccttt tcccacatgc 421
ttaacttggc caacttagcc gaagaggtcc aaattgccca cagtcgaagg aacaagttga 481
agaaaggtga ttttgctgat gaaaacaatg ccaccactga atcagacatt gaagaaactc 541
taaagaaact tgtggtggat atgaagaagt ctcctcagga agtttttgat gcacttaaaa 601
accagactgt tgatctggtt cttactgctc atcctactca atctgtccgt aggtctttgc 661
ttcaaaaaca tggaaggata agaaataatt taactcagtt gtatgccaaa gacatcactc 721
ctgatgataa gcaggaactt gacgaggctc tacagaggga gatccaagct gcattccgta 781
ctgatgaaat caggaggacc cctccaaccc cacaagatga gatgagagca gggatgagct 841
acttccatga aacaatttgg aagggtgtac ccacatttct acgtcgtgtt gatacagctt 901
tgaagaatat agggatcaac gaacgtgtcc cttataatgc tcctctcatt caattttctt 961
cttggatggg tggagatcgt gatggcaatc caagagtaac tcctgaagtg accagagatg 1021
tttgcttatt ggctagaatg atggctgcta acttgtacta ctcccagata gaggatctta 1081
tgtttgagct gtcaatgtgg cgctgcaatg acgagctacg tgtccgtgca gatgaactta 1141
acaggtcttc caagaaaaat tcagtcgcaa aacactacat agaattttgg aaagccattc 1201
ctccaaatga accatatcgt gtgctactgg gtgaagtaag gaataggctt taccagactc 1261
gtgaacgctc acgccatttg ctagctcacg gatactctga cattccagag gaagagactt 1321
ttaccaatgt tgaggagttc ttggaacccc ttgaactctg ttacagatca ctctgtgctt 1381
gtggcgatcg tgcaattgcc gatggaagcc ttctagattt cttgagacaa gtctctactt 1441
tcggactctc cctagtgagg cttgacataa ggcaagagtc agaccgccac acagacgtct 1501
tagacgccat caccaaacat ttagaaatag gctcatacca ggaatggtcg gaggaaaaac 1561
ggcagcaatg gcttttatct gagttgagtg gcaaacggcc cctattcggc cctgatcttc 1621
cccaaaccga agaaatcaga gacgtgttgg agacattcca tgtcatagca gagcttccac 1681
tagacaactt tggagcatac atcatctcaa tggcaactgc accttctgat gtgcttgcag 1741
ttgagcttct gcagcgcgaa tgccatgtca agcatccact aagagttgtg ccattgtttg 1801
agaagctagc tgatctagaa gcagcaccgg ccgcgttggc gcgattgttc tctgtagact 1861
ggtacagaaa caggatcaat gggaagcagg aagtgatgat aggctattct gattctggca 1921
aagatgctgg aaggttttca gctgcatggc agctgtataa ggctcaggag gagcttataa 1981
tggtggctaa gcagtatggt gtgaagctga caatgttcca tggtcgtgga gggacagttg 2041
gaagaggagg tggtccaact caccttgcta ttctgtctca gcctcctgaa accattcatg 2101
gatcgctgcg cgtgactgtc caaggtgaag ttattgagca atcgtttgga gagcagcact 2161
tgtgcttcag aacgcttcaa aggttcactg cagctactct agaacatgga atgcaccctc 2221
caatttctcc taaaccggaa tggagggctt tgatggatga gatggctgtc attgccactg 2281
aggagtaccg gtccattgtg ttcaaagaac cacgatttgt tgagtatttc cgcctggcca 2341
cacctgagtt ggagtacggg aggatgaaca ttggaagtcg accagcaaag aggaggccaa 2401
gtggaggtat tgagacactc cgtgccatac cttggatctt tgcctggaca caaacaaggt 2461
tccatcttcc agtgtggcta ggctttggtg cagcattcaa acatgttatt gagaaggatg 2521
ttaggaatat tcatgtgctg caggagatgt acaatcaatg gcctttcttt agggtcacta 2581
ttgatttagt ggaaatggtg tttgccaaag gagacccagg gatagctgct ctttatgata 2641
ggctccttgt ttcagaggat ctgtggtcat ttggggagca gttgaggacc atgtacgaag 2701
aaaccaagga actcctcctt caggtggctg gccataggga tcttcttgaa ggagatccat 2761
acttgaagca aagactgcgc ttgcgtgatt cttatattac taccctaaac gtgtgccaag 2821
cctacacgtt gaaacgtatc cgtgatccaa actataatgt gaagctgcgc cctcacatct 2881
ccaaagagtc tatagagata agtaaacctg ctgatgaact tataacactt aacccaacaa 2941
gtgaatatgc acctggtttg gaagacaccc tcattctcac catgaagggt attgctgctg 3001
gcttgcaaaa cactggctaa atctgagttt ttgtcttctc tttggttcca cttttatttt 3061
ctgtttcctt tatcagaaat aacgagttta gctgcatgca ccaaagggtg tttttccctc 3121
ccctgtaccc atgtttccat tataagatat tacagagaga tagctgccgc aaaatgagac 3181
aatgcaagta tgcaactgat tcttatgttc c
<110>Jilin Academy of Agricultural Science
<120>
<140>
<160> 4
<210> 4
<211> 332 bp
<212> DNA
<213>Semen sojae atricolor(Soybean)
<400> 1
TAGAAACAGA GGATCCGCTG GAGATTCCAT TGTGGTTGCC AAGTCCTTTT CCCACATGCT 61
TAACTTGGCC AACTTAGCCG AAGAGGTCCA AATTGCCCAC AGTCGAAGGA ACAAGTTGAA 121
GAAAGGTGAT TTTGCTGATG AAAACAATGC CACCACTGAA TCAGACATTG AAGAAACTCT 181
AAAGAAACTT GTGGTGGATA TGAAGAAGTC TCCTCAGGAA GTTTTTGATG CACTTAAAAA 241
CCAGACTGTT GATCTGGTTC TTACTGCTCA TCCTACTCAA TCTGTCCGTA GGTCTTTGCT 301
TCAAAAACAT GGAAGGCCCG GGAACAGCAC GC
<110>Jilin Academy of Agricultural Science
<120>
<140>
<160> 5
<210> 5
<211> 336 bp
<212> DNA
<213>Semen sojae atricolor(Soybean)
<400> 1
TAACATCGAT ACTAGTGCTG GAGATTCCAT TGTGGTTGCC AAGTCCTTTT CCCACATGCT 61
TAACTTGGCC AACTTAGCCG AAGAGGTCCA AATTGCCCAC AGTCGAAGGA ACAAGTTGAA 121
GAAAGGTGAT TTTGCTGATG AAAACAATGC CACCACTGAA TCAGACATTG AAGAAACTCT 181
AAAGAAACTT GTGGTGGATA TGAAGAAGTC TCCTCAGGAA GTTTTTGATG CACTTAAAAA 241
CCAGACTGTT GATCTGGTTC TTACTGCTCA TCCTACTCAA TCTGTCCGTA GGTCTTTGCT 301
TCAAAAACAT GGAAGGGAGC TCGAATTTCC CCGATC
Claims (2)
1. a kind of carrier of suitable herbicide selection marker Bar gene, it is characterised in that the carrier includes interference carrier, DNA
Fragment 2 and DNA fragmentation 3, the interference carrier is comprising Oryza sativa L. GAS1 gene LOC_Os01g68860 introns, positioned at the water
The multiple clone site and the multiple clone site in downstream of the upstream of rice GAS1 gene LOC_Os01g68860 introns both sides, it is described interior
Be 9621-10099 positions nucleotide in sequence 1 containing son, the multiple clone site of upstream be BamHI, SmaI, XmaI,
MluI, the multiple clone site in downstream is HpaI, SpeI and SacI;The carrier of the suitable herbicide selection marker Bar gene is pressed
Prepare according to following I or II method:
I is comprised the following steps:
1)DNA fragmentation 2 is inserted into the upstream multiple clone site of described interference carrier, is obtained containing in multicloning sites downstream
Between carrier A;
2)By the inserting step 1 of DNA fragmentation 3)The multicloning sites downstream of the intermediate carrier A for obtaining, obtains being adapted to herbicide screening
The carrier of labelling Bar genes;
II comprises the following steps:
A, the multicloning sites downstream that DNA fragmentation 3 is inserted described interference carrier, obtain containing in the multiple clone site of upstream
Between carrier B;
The upstream multiple clone site of B, the intermediate carrier B for obtaining inserting step A of DNA fragmentation 2, obtains being adapted to herbicide screening mark
The carrier of note Bar genes;
The nucleotides sequence of described DNA fragmentation 2 is classified as sequence 4 in sequence table;
The nucleotides sequence of described DNA fragmentation 3 is classified as sequence 5 in sequence table.
2. the carrier of suitable herbicide selection marker Bar gene according to claim 1, it is characterised in that described is adapted to
In the structure of the carrier of herbicide selection marker Bar gene, DNA fragmentation 2 and DNA fragmentation 3 are carried by homologous recombination insertion interference
Obtain being adapted to the carrier of herbicide selection marker Bar gene at the multiple clone site of body, or DNA fragmentation 2 and DNA fragmentation 3 pass through
Double digestion is connected the carrier for obtaining being adapted to herbicide selection marker Bar gene with the interference carrier processed through same enzyme action.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310484523.3A CN103642827B (en) | 2013-10-17 | 2013-10-17 | RNA interference vector suitable for herbicide selection marker Bar gene |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310484523.3A CN103642827B (en) | 2013-10-17 | 2013-10-17 | RNA interference vector suitable for herbicide selection marker Bar gene |
Publications (2)
Publication Number | Publication Date |
---|---|
CN103642827A CN103642827A (en) | 2014-03-19 |
CN103642827B true CN103642827B (en) | 2017-05-17 |
Family
ID=50248113
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201310484523.3A Active CN103642827B (en) | 2013-10-17 | 2013-10-17 | RNA interference vector suitable for herbicide selection marker Bar gene |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103642827B (en) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102191262A (en) * | 2011-03-08 | 2011-09-21 | 中国农业科学院作物科学研究所 | RNA (Ribonucleic Acid) interference vector and application thereof |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103146745B (en) * | 2013-03-13 | 2015-07-15 | 辽宁大学 | Plant RNA (Ribose Nucleic Acid) interference vector for inhibiting lignin from synthesizing, and construction method and application of plant RNA interference vector |
-
2013
- 2013-10-17 CN CN201310484523.3A patent/CN103642827B/en active Active
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102191262A (en) * | 2011-03-08 | 2011-09-21 | 中国农业科学院作物科学研究所 | RNA (Ribonucleic Acid) interference vector and application thereof |
Non-Patent Citations (2)
Title |
---|
Deep sequencing reveals the complex and coordinated transcriptional regulation of genes related to grain quality in rice cultivars.;RC Venu et al.;《BMC genomics》;20110414;第12卷(第190期);第1-13页 * |
应用基因沉默技术调节大豆脂肪酸代谢进而选育高油和高油酸大豆新材料;陈伟;《中国博士学位论文全文数据库农业科技辑》;20120615(第6期);摘要 * |
Also Published As
Publication number | Publication date |
---|---|
CN103642827A (en) | 2014-03-19 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Wang et al. | Multi-gene co-expression can improve comprehensive resistance to multiple abiotic stresses in Brassica napus L. | |
Nyaboga et al. | Factors influencing somatic embryogenesis, regeneration, and Agrobacterium-mediated transformation of cassava (Manihot esculenta Crantz) cultivar TME14 | |
CN102191262B (en) | RNA (Ribonucleic Acid) interference vector and application thereof | |
CN104292317B (en) | Drought resistant correlative protein of plant and coding gene and application thereof | |
CN105543270A (en) | Double resistance CRISPR/Cas9 carrier and application | |
CN108350465A (en) | Improve the method and composition of Plant Transformation | |
CN105087640B (en) | Adjust gene and its application of vegetable seeds development | |
CN101182523A (en) | Plants flower pesticide specificity promoter and uses thereof | |
Li et al. | A stable and efficient Agrobacterium tumefaciens-mediated genetic transformation of the medicinal plant Digitalis purpurea L. | |
CN104928318B (en) | Application of 1 genes of rice Os LEA5c in preventing from heavy metal rice varieties are cultivated | |
CN107418972A (en) | A kind of method for obtaining growth characteristics improvement rice varieties | |
CN104086637B (en) | Tobacco strigolactones transport protein NtPDR6 and interference expression vector and application thereof | |
Moghaieb et al. | An efficient and reproducible protocol for the production of salt tolerant transgenic wheat plants expressing the Arabidopsis AtNHX1 gene | |
CN103981216A (en) | Backbone plasmid vector and application thereof | |
CN106701778A (en) | Method for increasing grain number per ear and reducing plant height by use of rice SNB genes | |
CN104017061B (en) | Transcription factor ZmbZIP17 and encoding gene and its application in response adverse circumstance | |
CN107022563A (en) | Genetically modified plants | |
CN106399326A (en) | Soybean bHLH transcription factor gene GmFER and encoded protein and application thereof | |
CN102021179A (en) | Application of rice gene KT484 to improvement of stress tolerance performance of plants | |
CN105779492A (en) | Application of rice miR396c | |
CN103290014B (en) | Adversity inducible expression gene promoter and application thereof | |
CN107446928A (en) | One cauliflower allelotaxis regulates and controls miRNA sequence and its application | |
CN105647940A (en) | Method for improving rice yield through OsGRF6 gene, and applications thereof | |
CN105039345B (en) | The clone of miRNA for enhancing mulberry tree salt resistance ability a kind of and its application | |
CN104531708B (en) | Cotton fibre specific expression promoter TB17P1 and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |