CN103630519A - Method for detecting enzyme-prodrug reaction by applying pH-sensitive ratio fluorescent protein - Google Patents
Method for detecting enzyme-prodrug reaction by applying pH-sensitive ratio fluorescent protein Download PDFInfo
- Publication number
- CN103630519A CN103630519A CN201310642001.1A CN201310642001A CN103630519A CN 103630519 A CN103630519 A CN 103630519A CN 201310642001 A CN201310642001 A CN 201310642001A CN 103630519 A CN103630519 A CN 103630519A
- Authority
- CN
- China
- Prior art keywords
- phluorins
- ratio
- sensitivity
- reaction
- albumen
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)
Abstract
The invention provides a method for detecting enzyme-prodrug reaction by applying pH-sensitive ratio fluorescent protein. According to the invention, the pH-sensitive ratio fluorescent protein is utilized to reflect the pH variation in the reaction process of horseradish oxidase peroxide (HRP) and prodrug indole-3-acetic acid (IAA), and the result of pH variation can be obtained through detection of a fluorescence microplate reader simply, so that the purpose of monitoring the reaction in real time can be achieved.
Description
Technical field
The invention belongs to biological technical field; More specifically, the present invention relates to a kind of method of ratio fluorescent Protein Detection enzyme-prodrug reaction of the pH of application sensitivity.
Background technology
Under the condition of existing science and technology and medical level, the main method of human treatment's tumour is chemotherapy.Chemotherapy is to utilize antineoplastic treatment tumour, clinical practice starts from the forties in last century, development along with tumour cell dynamics and clinical pharmacology, and the appearance of various antineoplastics, add and adopt combined chemotherapy and ripe chemotherapy regimen, there is minority tumour to cure, as acute lymphoblastic leukemia, Hodgkin's disease etc.Nearly ten years, the class medicines such as the biological response modifier that begins one's study both at home and abroad and induction differentiation agent, coordinate with antineoplastic is organic, have improved curative effect and the toxicity that alleviates chemotherapeutics, have greatly accelerated the development that chemotherapy of tumors is learned.But there is following defect in this therapy: 1. tumor locus drug concentration is not enough; 2. system toxicity; 3. tumour cell is lacked higher than Normocellular susceptibility; 4. there is drug-resistant tumor cell.These defects make oncotherapy cannot thoroughly solve safety problem.
Antibdy directed enzyme-prodrug therapy (antibody-directed enzyme prodrug therapy, ADEPT) be Tumor-assaciated monoclonal antibody and the enzyme that activates prodrug to be connected to form to a kind of antibody-multienzyme complex of target tumor tissue, then give prodrug, with the enzyme that is positioned at tumor surface, prodrug is activated as drug toxicity, in tumour cell, produce cytotoxic effect.Enzyme-prodrug therapy has overcome the low concentration of tumor locus medicine and the shortcoming of system toxicity in tumor therapeutic procedure, and the high efficiency of enzyme is combined with the hypotoxicity of prodrug, has opened up the frontier of oncotherapy.Prodrug, in design process, is to add group on original tumour medicine architecture basics, and these groups can exist the variation of pH in course of reaction, therefore, need to carry out by effective approach the change procedure of Sensitive Detection pH.In prior art, generally detecting pH variation is application pH meter.But accurate pH meter detects when pH changes and has the phenomenon lagging behind, and has increased difficulty in real-time context of detection.
Summary of the invention
The object of the present invention is to provide a kind of method of ratio fluorescent Protein Detection enzyme-prodrug reaction of the pH of application sensitivity.
In a first aspect of the present invention, the method that in a kind of detection horseradish peroxidase oxidase (HRP)-indole-3-acetic acid (IAA) reaction, pH changes is provided, described method comprises:
(1), in horseradish peroxidase oxidase (HRP)-indole-3-acetic acid (IAA) reaction system, add the ratio fluorescent albumen pHluorins of pH sensitivity;
(2) according to the fluorescence intensity change of the ratio fluorescent albumen pHluorins of pH sensitivity, determine that the pH in course of reaction changes.
In another preference, described method is in-vitro method.
In another preference, the gene order of the ratio fluorescent albumen pHluorins of described pH sensitivity is as shown in SEQ ID NO:1.
In another preference, in step (2), utilize fluorescence microplate reader to measure in different time points, the ratio fluorescent albumen pHluorins of pH sensitivity is the fluorescence intensity level divided by excitation wavelength 483nm/ emission wavelength 507nm at the fluorescence intensity level of excitation wavelength 397nm/ emission wavelength 507nm, and the front and back of the ratio of acquisition change and represented that pH value changes.
In another preference, also comprise: the ratio of acquisition and typical curve are compared; Wherein, described typical curve, by the ratio fluorescent albumen pHluorins of pH sensitivity being placed in to the damping fluid of known pH value, is measured its fluorescence intensity level at excitation wavelength 397nm/ emission wavelength 507nm divided by the ratio of the fluorescence intensity level of excitation wavelength 483nm/ emission wavelength 507nm; This ratio and corresponding known pH value mapping are obtained.
In another preference, in described reaction system, the final concentration of the ratio fluorescent albumen pHluorins of pH sensitivity is 300 ± 200 μ g/ml; Be preferably 300 ± 100 μ g/ml; Be preferably 300 ± 50 μ g/ml; More preferably 300 ± 20 μ g/ml.
In another preference, the preparation method of the ratio fluorescent albumen pHluorins of described pH sensitivity comprises: the gene order shown in SEQ ID NO:1 is inserted in pET15b carrier, transform Escherichia coli, abduction delivering, broken thalline, purifying obtains the ratio fluorescent albumen pHluorins of pH sensitivity.
In another preference, in described reaction system, reaction medium is water (pure water) or damping fluid; Be preferably water (pure water).
In another aspect of this invention, provide the purposes of the ratio fluorescent albumen pHluorins of pH sensitivity, for detection of pH in horseradish peroxidase oxidase (HRP)-indole-3-acetic acid (IAA) reaction, change.
Other side of the present invention, due to disclosure herein, is apparent to those skilled in the art.
Accompanying drawing explanation
Fig. 1, by the imidazole concentration gradient elution mode purifying destination protein curve map of AKTA.Blue line: UV value; Green line: imidazole concentration i.v.; A peak: the supernatant stream peak of prick post; B peak: destination protein eluting peak.From Fig. 1, show that destination protein pHluorins is that 120mM left and right can be by wash-out at imidazole concentration.
Fig. 2, albumen pHluorins purifying rear electrophoresis figure, swimming lane 0 is that (molecular size range is followed successively by 97.2kDa to albumen Marker from top to bottom, 66.4kDa, 44.3kDa, 29.0kDa, 20.1kDa), swimming lane 1 is whole cell sample before IPTG induction, and swimming lane 2 is whole cell samples after IPTG induction, swimming lane 3 is the samples after ultrasonic, swimming lane 4 is ultrasonic rear centrifugal deposit sample, and swimming lane 5 is ultrasonic rear centrifugal supernatant samples, and swimming lane 6-8 is the sample of the different imidazole concentration wash-outs of AKTA purifying.According to purifying figure, from swimming lane 6-8 can find out AKTA purifying, albumen only has a band, has obtained purer albumen, and molecular weight of albumen size is greatly about 29.0kDa, conforms to the destination protein size of prediction.
Fig. 3, by accurate pH meter, detect HRP reacts front and back pH value variation diagram with IAA, black lines ◆ be final concentration be 100 μ M IAA and final concentration be 1.2 μ g/ml HRP (being stored in phosphate buffer) in 5min pH value be changed to 4.85-5.60, the black lines ■ of contrast be final concentration be 100 μ M IAA and phosphate buffer (0 μ g/ml HRP) in 5min pH value be changed to 4.42-4.50.According to data, show that the pH value that HRP reacts with IAA changes obviously, control group changes not quite.
Fig. 4, by accurate pH meter, detect IAA, pHluorins potpourri react front and back pH value variation diagram with HRP, black lines ◆ be final concentration be 100 μ M IAA, 300 μ g/ml pHluorins and final concentration be 1.2 μ g/ml HRP (being stored in phosphate buffer) in 5min pH value be changed to 7.47-7.03, the black lines ■ of contrast be final concentration be 100 μ M IAA, 300 μ g/ml pHluorins and phosphate buffer (0 μ g/ml HRP) in 5min pH value be changed to 7.42-7.41.According to data, show that the pH value that HRP reacts with IAA changes obviously, control group changes not quite.
Fig. 5, with fluorescence microplate reader, detect the scan variations figure of the emission wavelength of the pHluorins of variable concentrations under pH7.4 phosphate buffer.Final concentration is respectively 100 μ g/ml, 300 μ g/ml, and the albumen pHluorins of 500 μ g/ml, in pH7.4 phosphate buffer, when excitation wavelength is 397nm, scans from 475nm to 575nm emission wavelength.Under the condition of three different final concentrations of albumen, when excitation wavelength is 397nm, emission wavelength is 507nm.
Fig. 6, with fluorescence microplate reader, detect the scintigram of pHluorins excitation wavelength under pH7.4 phosphate buffer.Final concentration be the albumen pHluorins of 300 μ g/ml in pH7.4 phosphate buffer, when emission wavelength is 507nm, excitation wavelength is scanned up to 487nm from 385nm.Result demonstration, when emission wavelength is 507nm, excitation wavelength has two excitation peaks, is respectively 397nm and 483nm.
The fluorescence intensity ratio figure of Fig. 7, the 397nm/483nm of albumen pHluorins in the phosphate buffer of different pH values, fluorescence microplate reader detects albumen pHluorins at pH4.5, pH5.0, pH5.5, pH6.0, pH6.5, pH7.0, pH7.5, the ratio of 397nm/483nm in pH8.0 phosphate buffer.The computing method of this ratio are that excitation wavelength is 397nm, and fluorescence intensity level when emission wavelength is 507nm is 483nm divided by excitation wavelength, fluorescence intensity level when emission wavelength is 507nm.Its result demonstration, along with the increase of pH value, the ratio of the 397nm/483nm of albumen increases gradually.
Fig. 8, albumen pHluorins detect the rate of change figure that HRP reacts with IAA, in 10min, utilize final concentration be 300 μ g/ml pHluorins to detect final concentrations be 100 μ M IAA with final concentration is the ratio variation of the 397nm/483nm that reacts of 1.2 μ g/mlHRP (being stored in phosphate buffer), see Fig. 8 (a); In 10min, utilize final concentration be 300 μ g/ml pHluorins detect final concentrations be 100 μ M IAA and phosphate buffer the ratio variation of 397nm/483nm, see Fig. 8 (b).The computing method of this ratio are that excitation wavelength be the fluorescence intensity level of 397nm/ emission wavelength while being 507nm is the fluorescence intensity level of 483nm/ emission wavelength while being 507nm divided by excitation wavelength.
Embodiment
The inventor is devoted to the research of enzyme-prodrug reaction, the mensuration changing for the pH in enzyme-prodrug course of reaction, the inventor is through extensive and deep research, disclosed a kind of formerly assay method of technology that is different from, the ratio fluorescent albumen pHluorins (being called for short pHluorins) of application pH sensitivity realizes accurate detection, reaches the object of Real-Time Monitoring reaction.
According to the literature, the mechanism that HRP reacts with IAA is as follows:
Above-mentioned reaction process has been set forth the mechanism of HRP-IAA reaction, and wherein 1 is prodrug IAA, under the catalysis of HRP, progressively carries out the approach such as decarboxylation, oxidation, produces object product 10, is 3-methylene-2-hydroxyindole.
Horseradish peroxidase oxidase (HRP)-indole-3-acetic acid (IAA) reaction is complicated enzyme-prodrug course of reaction, be difficult to find and can measure in real time, exactly the method for its pH value, and pH measures the problem lagging behind that exists.And, because this reactive system exists hydrionic variation, transfer, and the impact that is also subject to the factors such as rate of diffusion, reaction rate in course of reaction, be difficult to find to join the material of realizing real-time detection in system.In addition,, because enzyme-prodrug reaction system is a chemical reaction system, it is also difficult how finding the detection material that can it not formed to impact, do not participate in its reaction.
Ratio fluorescent albumen pHluorins of the present invention, there is a bimodal excitation spectrum in it, is respectively 397nm and 483nm, and an emission peak 507nm.Along with pH value declines, under 397nm shooting conditions, its emissive porwer declines, and under 483nm shooting conditions, its emissive porwer increases.So under different pH, the ratio generation marked change of 397nm/483nm.By fluorescence microplate reader, detect under different condition ratio fluorescent albumen pHluorins under 397nm and 483nm excite, the ratio of emitting fluorescence intensity, can understand the process of reaction.
The fluorescin of pH sensitivity is a kind of bioprotein, and this is conducive to detect in real time in vivo.Compared to little fluorescence probe, fluorescence probe is high to metal ion-sensitive degree, selectivity good, but its application has limitation: 1. its poorly water-soluble and toxic and side effect, be restricted its application in the fields such as life science, medical science; 2. many probes are responsive to multiple environment factor, as all responsive to polarity, pH in probe, are unfavorable for the light signal of gained to distinguish and resolve, and accuracy is obtained more difficult.And the ratio fluorescent albumen of pH sensitivity is a kind of bioluminescent protein, non-toxic to living cells, selectivity is strong, detection and convenient, and this is just for certain basis has been established in detection in body.The advantage of enzyme-prodrug reaction is extremely obvious, is with a wide range of applications in vivo; There is the variation of pH in HRP-IAA course of reaction, present technique, using the variation of pH as a kind of supplementary means, is carried out the reaction of Real-Time Monitoring enzyme-prodrug by this phenomenon.
The inventor applies the prokaryotic expression carrier that modern genetic engineering means build ratio fluorescent albumen, and by the abduction delivering of plasmid recon, process optimization and purifying, to expect the obtaining ratio fluorescent albumen that pH susceptibility is good, for subsequent detection is supplied raw materials.
Described pHluorins albumen can be also artificial preparation, such as carrying out according to conventional genetic engineering recombinant technique Restruction pHluorins albumen.Preferably, the present invention can adopt the pHluorins albumen of restructuring.PHluorins albumen of the present invention comprises pHluorins albumen or its bioactive fragment of total length.The amino acid sequence of the pHluorins albumen that passes through replacement, disappearance or the interpolation of one or more amino acid residues and form is also included within the present invention.PHluorins albumen or its bioactive fragment comprise the alternative sequence of a part of conserved amino acid, and the described sequence through amino acid substitution does not affect its activity or retained the activity of its part.Suitably replacing amino acid is technology well known in the art, and described technology can be implemented and guarantee not change the biologically active of gained molecule at an easy rate.These technology are recognized those skilled in the art, in general, at the inessential area change single amino acids of a peptide species, substantially can not change biologically active.See Watson etc., Molecular Biology of The Gene, the 4th edition, 1987, The Benjamin/Cummings Pub.Co.P224.The bioactive fragment of any pHluorins albumen can be applied in the present invention.Here, the implication of the bioactive fragment of pHluorins albumen refers to as a peptide species, and it still can keep all or part of function of the pHluorins albumen of total length.The present invention also can adopt pHluorins albumen modified or improvement, such as, can adopt the pHluorins albumen of being modified or improveing in order to promote the effect of its half life period, validity, metabolism and/or albumen.That is to say, any bioactive version that does not affect pHluorins albumen all can be used in the present invention.
As optimal way of the present invention, the gene order of the ratio fluorescent albumen pHluorins of described pH sensitivity is as shown in SEQ ID NO:1.
In an embodiment of the present invention, the inventor has carried out the Expression and purification of pHluorins; For obtaining the ratio fluorescent albumen pHluorins of desirable pH sensitivity, adopt the complete genome sequence of artificial synthetic pHluorins, by being connected with pET15b expression vector, build the prokaryotic expression system of pHluorins.After IPTG abduction delivering, by albumen with His label utilize nickel post to reach the object of purifying.The imidazoles solution of preparation low concentration and high concentration, is used AKTA albumen to be carried out to the linear elution of different imidazole concentrations, finally collects purer destination protein.
Further, the inventor measures horseradish peroxidase oxidase (HRP) reacts front and back pH variation with indole-3-acetic acid (IAA); By Accurate pH, detect 1.2 μ g/ml HRP in 5min and react the variation of pH with 100 μ M IAA, find pH marked change, change more obvious.Visible, there is the variation of pH value in this enzyme-prodrug reaction system.
Afterwards, the fluorescence intensity ratio that the inventor detects pHluorins in the HRP-IAA reaction system that comprises pHluorins by fluorescence microplate reader changes; Fluorescence microplate reader detects 100 μ M IAA in 10min by 300 μ g/ml pHluorins and reacts with 1.2 μ g/ml HRP, and the ratio of the 397nm/483nm of pHluorins changes more obvious.Therefore, the inventor has optimized excitation wavelength and the emission wavelength of pHluorins, can make the testing result of method of the present invention more accurate.
The invention has the advantages that: enzyme-prodrug therapy is due to the high efficiency of enzyme and the hypotoxicity of prodrug, there is significant advantage in field in treatment cancer, by the ratio fluorescent albumen of pH sensitivity, can detect the successive reaction of enzyme and prodrug, thereby can reach the object of Real-Time Monitoring reaction.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment are only not used in and limit the scope of the invention for the present invention is described.The experimental technique of unreceipted actual conditions in the following example, writes molecular cloning experiment guide, the third edition, Science Press, the condition described in 2002, or the condition of advising according to manufacturer conventionally as J. Pehanorm Brooker etc. according to normal condition.
The structure of embodiment 1, pHluorins prokaryotic expression system and abduction delivering
The complete genome sequence (SEQ ID NO:1) that adopts artificial synthetic pHluorins, is inserted in the XhoI/BamHI site of pET15b expression vector, obtains recombinant expression carrier pXDC3.Described recombinant expression carrier is transformed to e. coli bl21 (DE3), build the prokaryotic expression system of pHluorins.
Wherein, the complete genome sequence of pHluorins following (SEQ ID NO:1):
ATGAGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCTCTTATGGTGTTCAATGCTTTTCAAGATACCCAGATCATATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGATGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACGAGCACTTGGTGTACATCATGGCAGACAAACAAAAGAATGGTACCAAAGCTATCTTTCAAGTTCACCACAACATTGAAGATGGAGGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGCACACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAA
The Escherichia coli that contain carrier pXDC3 are evenly coated on the LB solid medium flat board containing ammonia benzyl resistance, flat board is upside down in 37 ℃ of incubators and is cultivated about 12h.
From the flat board transforming, select single bacterium colony, be inoculated in the 5mL LB fluid nutrient medium test tube containing ammonia benzyl resistance, then test tube is placed on to 37 ℃, in the constant-temperature table of 180rpm, shake overnight incubation.
The bacterium liquid of getting 1mL incubated overnight is transferred in the 100mL LB fluid nutrient medium triangular flask containing ammonia benzyl resistance, then triangular flask is placed on to 37 ℃, and in the constant-temperature table of 180rpm, concussion is cultivated 2h to bacterium liquid OD
600value is in 0.6 left and right.Get bacterium 100 μ l and give over to protein electrophoresis.
Add derivant IPTG to final concentration 1mM, 30 ℃ of induction 5h, get bacterium 100 μ l and give over to protein electrophoresis; After abduction delivering finishes, 4 ℃, the centrifugal 20min of 4000 * g receives bacterium, and precipitation adds the protein lysate of 20mL, mixes, and-20 ℃ of refrigerator-freezers are preserved.
1, ultrasonication
Take out the albumen of-20 ℃ of preservations, melt.Then ultrasonication thalline in ice bath, Ultrasonic Cell Disruptor setting: power 100W, ultrasonic 3s, 5s intermittently, ultrasonic 200 times; By the suspension after ultrasonic, sample 100 μ l and give over to protein electrophoresis again, 4 ℃, the centrifugal 20min of 12,000rpm, separates supernatant and sediment, gets supernatant 100 μ l and precipitation (adding lysate dissolves) 100 μ l and gives over to protein electrophoresis, and 4 ℃ of preservations etc. are to be purified.
2, purifying
Open AKTA primer protein purification system and connect with computer;
The cleaning procedure that calling system is default, cleans whole system with ultrapure water;
After cleaning procedure operation, load onto His Trap HP (1mL) prepacked column, again with cleaning procedure, clean whole system;
Again with protein purification level pad operation cleaning procedure once;
Then by A damping fluid (20mM sodium phosphate buffer, 0.5M sodium chloride, 20mM imidazoles) passage connection protein purification level pad bottle, by B damping fluid (20mM sodium phosphate buffer, 0.5M sodium chloride, 0.5M imidazoles) passage connection protein purification elution buffer bottle;
Then in loading ring, inject the supernatant of preserving after 5mL aforementioned " ultrasonication ";
The His post purifying template program that calling system is default, it is 5mL that applied sample amount is set, and brings into operation;
Each collection tube is sampled to 4 ℃ and preserve the analysis of wait protein electrophoresis, according to the protein sample of elution curve label collection ,-20 ℃ of refrigerator-freezers are preserved, and purifying is shown in Fig. 1;
After purifying template program operation, call cleaning procedure, with ultrapure water, clean whole system, the ethanol that then changes 20% (v/v) cleans whole system again one time;
After cleaning procedure operation, His Trap HP (1mL) prepacked column is taken off to 4 ℃ of preservations of sealing.
New bag filter is cut into about 15cm length, is placed in the solution of 10mM sodium bicarbonate and 1mM ethylenediamine tetraacetic acid (pH8.0) and boils 10min;
With distilled water, rinse bag filter for several times, standby, unnecessary bag filter is immersed in the ethanol of 20% (v/v), 4 ℃ of preservations;
Pack the albumen after purifying into bag filter, two ends clamp;
By bag filter put into 500mL 1 * albumen dislysate (dipotassium hydrogen phosphate, potassium dihydrogen phosphate, pH7.4) in 4 ℃ of dialysed overnight, during change dislysate for several times;
After having dialysed, be in charge of-80 ℃ of preservations.
Separation gel and the concentrated glue of preparation protein electrophoresis;
Clean glass plate, and install, confirm without leaking;
Add rapidly the separation gel solution that about 4.5mL prepares (ultrapure water, 30% acrylamide mixed liquor, 1.5M pH8.8Tris, 10%SDS, 10% ammonium persulfate, TEMED) in the space of two glass plates, and adds water and did not have edge on glass plate;
After gelling to be separated is solid, outwell the water on upper strata, then add concentrated sol solution (ultrapure water, 30% acrylamide mixed liquor, 1.5M pH6.8Tris, 10%SDS, 10% ammonium persulfate, TEMED), to not having edge on glass plate, inserts rapidly comb;
Each sample get 20 μ l and 5 * protein electrophoresis sample-loading buffer (Tris, glycocoll SDS) mix, and heat 5min in boiling water bath, afterwards 12, the centrifugal 10min of 000rpm;
After glue polymerization to be concentrated, take out lightly comb, by experimental design order application of sample;
Glass plate is placed in protein electrophoresis groove, pours 250mL1 * protein electrophoresis damping fluid into;
Switch on power, the incipient stage arranges voltage 90V, etc. bromophenol blue enter separation gel after voltage be set to 120V, until bromophenol blue arrives glass plate bottom;
Dismounting glass plate, takes out separation gel, with dyeing more than 3h on protein staining liquid (methyl alcohol, water, glacial acetic acid, coomassie brilliant blue R250) earthquake shaking table;
Reclaim dyeing liquor, with after clear water rinsing 2 times, add the 3h left and right of decolouring on protein decolouring liquid (methyl alcohol, water, glacial acetic acid) earthquake shaking table, after decolouring completely, glue is placed in gel imaging instrument, open the visible light preservation of taking pictures, see Fig. 2.
Get the centrifuge tube of some 1.5mL, a certain amount of BSA protein titer (5mg/ml), with 1 * PBS dilution, be final concentration 200 μ g/ml, pipe number 0 adds the PBS of 300 μ l, the BSA (final concentration is 0 μ g/ml) that adds the dilution of 0 μ l, pipe number 1 adds the PBS of 285 μ l, the BSA (final concentration is 10 μ g/ml) that adds the dilution of 15 μ l, pipe numbers 2 adds the PBS of 270 μ l, the BSA (final concentration is 20 μ g/ml) that adds the dilution of 30 μ l, pipe numbers 3 adds the PBS of 240 μ l, the BSA (final concentration is 40 μ g/ml) that adds the dilution of 60 μ l, pipe numbers 4 adds the PBS of 210 μ l, the BSA (final concentration is 60 μ g/ml) that adds the dilution of 90 μ l, pipe numbers 5 adds the PBS of 180 μ l, the BSA (final concentration is 80 μ g/ml) that adds the dilution of 120 μ l, pipe numbers 6 adds the PBS of 150 μ l, the BSA (final concentration is 100 μ g/ml) that adds the dilution of 150 μ l, pipe numbers 7 adds the PBS of 75 μ l, the BSA (final concentration is 150 μ g/ml) that adds the dilution of 225 μ l, application of sample is as shown in table 1.
Table 1
| |
0 | 1 | 2 | 3 | 4 | 5 | 6 | 7 |
| PBS(μl) | 300 | 285 | 270 | 240 | 210 | 180 | 150 | 75 |
| BSA(μl) | 0 | 15 | 30 | 60 | 90 | 120 | 150 | 225 |
| BSA final concentration (μ g/ml) | 0 | 10 | 20 | 40 | 60 | 80 | 100 | 150 |
Get some 1.5mL centrifuge tubes, add respectively the protein solution 100 μ l of each concentration in above-mentioned middle 0-7 pipe;
In each pipe, add again 1mLBradford reagent, mix rapidly;
After mixing, the standing 5min of room temperature, during put upside down and mix 1-2 time;
After 5min, No. 0 pipe of take is blank, surveys the A of each pipe on spectrophotometer
595value;
Repeating step also calculates respectively A in two centrifuge tubes that each group # is identical
595mean value;
A with 0-7 pipe
595mean value is ordinate, and corresponding protein concentration is horizontal ordinate, drawing standard curve.
Obtain formula: Y=0.004X, R
2=0.993.
By pHluorins for sample 1 * lysis buffer (50mM sodium dihydrogen phosphate, 300mM sodium chloride, 10mM imidazoles) dilute 10 times;
Get 2 1.5mL centrifuge tubes, add respectively sample after the dilution of 100 μ l and the lysate of 100 μ l;
In each pipe, add again 1mL Bradford reagent, mix rapidly;
After mixing, the standing 5min of room temperature, during put upside down and mix 1-2 time;
After 5min, take PBS pipe as blank, on spectrophotometer, survey the A595 value of each pipe.
Diluent A per sample
595be worth, on typical curve, determine the protein concentration of this sample diluting liquid;
According to the protein concentration of formula calculation sample below;
Protein concentration * Sample Dilution multiple of sample protein matter concentration (μ g/ml)=sample diluting liquid;
According to ultraviolet spectrophotometer, showing that sample absorbance is 0.456, due to 20 times of Sample Dilutions, is (0.456/0.004) * 20=2.28mg/ml according to the protein concentration that calculates pHluorins.
The pH of embodiment 6, detection HRP-IAA reaction changes
Preparation 1M IAA, is dissolved in 1.8g IAA in the ethanol of 10mL (IAA solubleness in water is low, and in ethanol, dissolubility is better).
Preparation 10mM IAA, is dissolved in 0.018g IAA in 10mL ultrapure water;
Take out frozen in the 120 μ g/ml HRP (dissolve in pH6.0 kaliumphosphate buffer, preserve) of-20 ℃.
Open on computers the software of accurate pH meter, preferably reaction conditions is groped in the pH variation of reacting with IAA according to (1)-(5) HRP:
(1) get the small beaker of 10mL, the ultrapure water that adds 7.4mL, the 1M IAA of 2.5mL (final concentration is 250mM), the 120 μ g/ml HRP of 100 μ l (final concentration is 1.2 μ g/ml), accurate pH meter is added to beaker, can read on computers the variation of pH in 5min, pH rises to 3.49 from 3.36;
(2) get the small beaker of 10mL, the ultrapure water that adds 9.6mL, the 1M IAA of 300 μ l (final concentration is 30mM), the 120 μ g/ml HRP of 100 μ l (final concentration is 1.2 μ g/ml), accurate pH meter is added to beaker, can read on computers the variation of pH in 5min, pH rises to 3.58 from 3.40;
(3) get the small beaker of 10mL, the ultrapure water that adds 9.75mL, the 1M IAA of 150 μ l (final concentration is 15mM), the 120 μ g/ml HRP of 100 μ l (final concentration is 1.2 μ g/ml), accurate pH meter is added to beaker, can read on computers the variation of pH in 5min, pH rises to 3.63 from 3.43;
(4) get the small beaker of 10mL, the ultrapure water that adds 9.875mL, the 1M IAA of 25 μ l (final concentration is 2.5mM), the 120 μ g/ml HRP of 100 μ l (final concentration is 1.2 μ g/ml), accurate pH meter is added to beaker, can read on computers the variation of pH in 5min, pH rises to 5.85 from 5.68;
(5) get the small beaker of 5mL, the ultrapure water that adds 4.9mL, the 10mM IAA of 50 μ l (final concentration is 100 μ M), the 120 μ g/ml HRP of 50 μ l (final concentration is 1.2 μ g/ml), accurate pH meter is added in beaker, can read on computers the variation of pH in 5min, pH rises to 5.75 from 4.78;
(6) get the small beaker of 5mL, add the ultrapure water of 4.9mL, the 10mM IAA of 50 μ l (final concentration is 100 μ M), the kaliumphosphate buffer of 50 μ l, accurate pH meter is added in beaker, can read on computers the variation of pH in 5min, pH rises to 4.46 from 4.42.
The demonstration of application pH meter measurement result, the pH value that in method (5), HRP reacts with IAA changes more obvious, sees Fig. 3.According to this figure, can find out that the pH that HRP reacts with IAA rises to 5.75, obvious change (◆) of generation from 4.78; Method (6) changes comparatively not obvious (■).
This control experiment explanation, because the existence of HRP changes the pH of reaction, because HRP enzyme is kept in phosphate buffer, to mix as a control group with IAA with isocyatic phosphate buffer, pH is without significant change in discovery.
Preparation 10mM IAA, is dissolved in 0.018g IAA in 10mL ultrapure water;
Take out frozen in the 120 μ g/ml HRP (dissolve in pH6.0 kaliumphosphate buffer, preserve) of-20 ℃;
Take out frozen in the 2mg/ml pHluorins of-20 ℃;
Open on computers the software of accurate pH meter, measure pHluorins and exist the pH of lower HRP-IAA reaction to change:
(1) get the small beaker of 5mL, the ultrapure water that adds 4.15mL, the IAA of 50 μ l10mM, the pHluorins of 75 μ l2mg/ml, the HRP (being stored in kaliumphosphate buffer) of 50 μ l120 μ g/ml, accurate pH meter is added in beaker, can read on computers the variation of pH in 5min, pH drops to 7.03 from 7.47.
(2) control group adds the ultrapure water of 4.15mL, the IAA of 50 μ l10mM, the pHluorins of 750 μ l2mg/ml, 50 μ l kaliumphosphate buffers, add accurate pH meter in beaker, can read on computers the variation of pH in 5min, pH drops to 7.41, basic not variation from 7.42.
Application pH meter measurement result shows, sees Fig. 4, can find out that experimental group (1) pHluorins exists pH that lower HRP react with IAA to drop to 7.03 from 7.47, and generation is variation (◆) relatively significantly; Control group (2) does not significantly change (■).
Open microplate reader power supply, wait for preheating.Open computer Fluorescence, Endpoint, excitation wavelength is 397nm, emission wavelength is scanned up to 575nm from 475nm.
Select complete 96 black orifice plates, add:
The 2.28mg/ml pHluorins of (1) 4 μ l (final concentration is 100 μ g/ml), the pH7.4 phosphate buffer of 96 μ l;
The 2.28mg/ml pHluorins of (2) 12 μ l (final concentration is 300 μ g/ml), the pH7.4 phosphate buffer of 88 μ l;
The 2.28mg/ml pHluorins of (3) 20 μ l (final concentration is 500 μ g/ml), the pH7.4 phosphate buffer of 80 μ l;
Setting excitation wavelength is 397nm, and emission wavelength is scanned from 475nm to 575nm, according to the detection data mapping of microplate reader, sees Fig. 5.According to this figure, can find out that the concentration of pHluorins is 100 μ g/ml, 300 μ g/ml, during 500 μ g/ml, its emission wavelength is 507nm.Be that the concentration of albumen pHluorins is on the not impact of its emission wavelength.
Open microplate reader power supply, wait for preheating; Open computer Gene5 software, select Fluorescence, Endpoint, emission wavelength is 507nm, and excitation wavelength is scanned up to 487nm from 395nm.
Select complete 96 black orifice plates, add: the 2.28mg/ml pHluorins of 12 μ l (final concentration is 300 μ g/ml), the pH7.4 phosphate buffer of 88 μ l.
According to the detection data mapping of microplate reader, see Fig. 6.Visible its excitation wavelength is 397nm and 483nm.
Open microplate reader power supply, wait for preheating; Open computer Gene5 software, select Fluorescence, Endpoint, excitation wavelength 397nm and 483nm, emission wavelength is 507nm.
Select complete 96 black orifice plates, add the pH4.5 of 88 μ l, pH5.0, pH5.5, pH6.0, pH6.5, pH7.0, pH7.5, pH8.0 phosphate buffer, the pHluorins of 12 μ l2.28mg/ml (300 μ g/ml), putting into microplate reader detects, fluorescence intensity according to the fluorescence intensity level of excitation wavelength 397nm-emission wavelength 507nm divided by excitation wavelength 483nm-emission wavelength 507nm, its ratio mapping, is shown in Fig. 7.The raw data that fluorescence microplate reader detects is in Table 2.According to this figure, can find out that the ratio of its 397nm/483nm increases thereupon, visible along with the increase of the pH value of damping fluid, fluorescin pHluorins is responsive to the variation of pH, and along with the increase of phosphate buffer pH value, its ratio increases thereupon.
Table 2
Open microplate reader power supply, wait for preheating; Open computer Gene5 software, select Fluorescence, Endpoint, excitation wavelength 397nm and 483nm, emission wavelength is 507nm, time 10min, every 10s reading.
Select complete 96 black orifice plates, do 3 groups of parallel laboratory tests, the cumulative volume of controlling every hole is 100 μ L, every hole adds the ultrapure water of 68 μ l, the 2.28mg/ml pHluorins of 12 μ l (final concentration 300 μ g/ml), the 12 μ g/ml HRP (being dissolved in kaliumphosphate buffer) of the 1mM IAA10 μ l of 10 μ l, after adding, at once put in microplate reader and detect, fluorescence intensity according to the fluorescence intensity level of excitation wavelength 397nm/ emission wavelength 507nm divided by excitation wavelength 483nm/ emission wavelength 507nm, its ratio raw data is in Table 3, mapping, is shown in Fig. 8 (a).According to this figure, can find out that the ratio of 397nm/483nm has occurred compared with significant change along with HRP reacts with IAA.
Control group: the ultrapure water of 68 μ l, the 2.28mg/ml pHluorins of 12 μ l (300 μ g/ml), the 1mM IAA of 10 μ l, the kaliumphosphate buffer of 10 μ l, at once puts in microplate reader and detects after adding.Fluorescence intensity level according to the fluorescence intensity level of excitation wavelength 397nm-emission wavelength 507nm divided by excitation wavelength 483nm-emission wavelength 507nm, its ratio mapping, is shown in Fig. 8 (b).According to this figure, can find out control group, the ratio of 397nm/483nm changes less.
Table 3 (experimental group)
| Time (s) | 397nm-507nm | 483nm- |
| 10 | 23763 | 17911 |
| 20 | 23693 | 17837 |
| 30 | 23447 | 17947 |
| 40 | 23563 | 17930 |
| 50 | 23926 | 17893 |
| 60 | 23832 | 17971 |
| 70 | 23698 | 17945 |
| 80 | 23847 | 18116 |
| 90 | 23739 | 18159 |
| 100 | 23713 | 18128 |
| 110 | 23548 | 18338 |
| 120 | 23653 | 18379 |
| 130 | 23690 | 18412 |
| 140 | 23547 | 18498 |
| 150 | 23404 | 18476 |
| 160 | 23438 | 18457 |
| 170 | 23298 | 18502 |
| 180 | 23384 | 18570 |
| 190 | 23383 | 18529 |
| 200 | 23416 | 18697 |
| 210 | 23176 | 18686 |
| 220 | 23170 | 18749 |
| 230 | 23270 | 18704 |
| 240 | 23028 | 18836 |
| 250 | 23260 | 18831 |
| 260 | 23090 | 18879 |
| 270 | 22915 | 18883 |
| 280 | 22949 | 18917 |
| 290 | 22912 | 18954 |
| 300 | 23026 | 18933 |
| 310 | 22775 | 18910 |
| 320 | 22808 | 18932 |
| 330 | 22719 | 19031 |
| 340 | 22818 | 18991 |
| 350 | 22910 | 18818 |
| 360 | 22672 | 19034 |
| 370 | 22702 | 19019 |
| 380 | 22566 | 19041 |
| 390 | 22654 | 19110 |
| 400 | 22635 | 18999 |
| 410 | 22597 | 19092 |
| 420 | 22516 | 19125 |
| 430 | 22482 | 19066 |
| 440 | 22600 | 19022 |
| 450 | 22549 | 19084 |
| 460 | 22435 | 19187 |
| 483 | 22437 | 19166 |
| 480 | 22343 | 19150 |
| 490 | 22343 | 19182 |
| 500 | 22284 | 19185 |
| 510 | 22232 | 19140 |
| 520 | 22190 | 19143 |
| 530 | 22239 | 19258 |
| 540 | 22218 | 19143 |
| 550 | 22228 | 19249 |
| 560 | 22277 | 19210 |
| 570 | 22217 | 19168 |
| 580 | 22249 | 19189 |
| 590 | 22117 | 19199 |
| 600 | 22195 | 19222 |
Table 3 (control group)
| Time (s) | 397nm-507nm | 483nm- |
| 10 | 19003 | 10086 |
| 20 | 18713 | 9892 |
| 30 | 18491 | 9783 |
| 40 | 18363 | 9767 |
| 50 | 18256 | 9685 |
| 60 | 18210 | 9589 |
| 70 | 18065 | 9602 |
| 80 | 18013 | 9564 |
| 90 | 17921 | 9563 |
| 100 | 17825 | 9540 |
| 110 | 17753 | 9501 |
| 120 | 17686 | 9458 |
| 130 | 17669 | 9475 |
| 140 | 17584 | 9428 |
| 150 | 17607 | 9458 |
| 160 | 17543 | 9387 |
| 170 | 17429 | 9422 |
| 180 | 17504 | 9403 |
| 190 | 17387 | 9331 |
| 200 | 17331 | 9345 |
| 210 | 17306 | 9362 |
| 220 | 17269 | 9342 |
| 230 | 17260 | 9344 |
| 240 | 17131 | 9388 |
| 250 | 17111 | 9281 |
| 260 | 17114 | 9303 |
| 270 | 17105 | 9311 |
| 280 | 17050 | 9296 |
| 290 | 17034 | 9280 |
| 300 | 17007 | 9234 |
| 310 | 16973 | 9264 |
| 320 | 16922 | 9247 |
| 330 | 16908 | 9225 |
| 340 | 16843 | 9221 |
| 350 | 16846 | 9267 |
| 360 | 16778 | 9178 |
| 370 | 16749 | 9162 |
| 380 | 16716 | 9166 |
| 390 | 16715 | 9160 |
| 400 | 16657 | 9186 |
| 410 | 16630 | 9170 |
| 420 | 16621 | 9182 |
| 430 | 16612 | 9163 |
| 440 | 16571 | 9139 |
| 450 | 16515 | 9151 |
| 460 | 16503 | 9137 |
| 470 | 16484 | 9083 |
| 480 | 16481 | 9095 |
| 490 | 16469 | 9066 |
| 500 | 16405 | 9062 |
| 510 | 16427 | 9048 |
| 520 | 16401 | 9094 |
| 530 | 16359 | 9088 |
| 540 | 16310 | 9072 |
| 550 | 16292 | 9061 |
| 560 | 16260 | 9057 |
| 570 | 16218 | 9021 |
| 580 | 16242 | 9012 |
| 590 | 16219 | 9069 |
| 600 | 16149 | 9002 |
According to different pH values shown in Fig. 7 result corresponding the ratio of the different 397nm/483nm of pHluorins, the ratio of the 397nm/483nm of the pHluorins of HRP-IAA course of reaction changes the variation according to the ratio of the 397nm/483nm of pHluorins under condition of different pH, can show the variation of the pH value of HRP-IAA course of reaction.
Its result shows, the carrying out reacting with IAA along with HRP, the ratio of the 397nm/483nm of albumen pHluorins drops to 1.157 from 1.362, there is the variation from pH7.39 to pH6.95 in the pH value that is also HRP-IAA course of reaction, detects pHluorins exist the pH variation tendency of lower HRP-IAA reaction to conform to the accurate pH meter of embodiment 4 use.
All documents of mentioning in the present invention are all quoted as a reference in this application, just as each piece of document, are quoted as a reference separately.In addition should be understood that those skilled in the art can make various changes or modifications the present invention after having read above-mentioned instruction content of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.
Claims (9)
1. detect the method that in the reaction of horseradish peroxidase oxidase-indole-3-acetic acid, pH changes, it is characterized in that, described method comprises:
(1), in horseradish peroxidase oxidase-indole-3-acetic acid reaction system, add the ratio fluorescent albumen pHluorins of pH sensitivity;
(2) according to the fluorescence intensity change of the ratio fluorescent albumen pHluorins of pH sensitivity, determine that the pH in course of reaction changes.
2. the method for claim 1, is characterized in that, the gene order of the ratio fluorescent albumen pHluorins of described pH sensitivity is as shown in SEQ ID NO:1.
3. the method for claim 1, it is characterized in that, in step (2), utilize fluorescence microplate reader to measure in different time points, the ratio fluorescent albumen pHluorins of pH sensitivity is the fluorescence intensity level divided by excitation wavelength 483nm/ emission wavelength 507nm at the fluorescence intensity level of excitation wavelength 397nm/ emission wavelength 507nm, and the front and back of the ratio of acquisition change and represented that pH value changes.
4. method as claimed in claim 3, is characterized in that, also comprises: the ratio of acquisition and typical curve are compared; Wherein,
Described typical curve, by the ratio fluorescent albumen pHluorins of pH sensitivity being placed in to the damping fluid of known pH value, is measured its fluorescence intensity level at excitation wavelength 397nm/ emission wavelength 507nm divided by the ratio of the fluorescence intensity level of excitation wavelength 483nm/ emission wavelength 507nm; This ratio and corresponding known pH value mapping are obtained.
5. the method for claim 1, is characterized in that, in described reaction system, the final concentration of the ratio fluorescent albumen pHluorins of pH sensitivity is 300 ± 200 μ g/ml; Be preferably 300 ± 100 μ g/ml; Be preferably 300 ± 50 μ g/ml; More preferably 300 ± 20 μ g/ml.
6. the method for claim 1, it is characterized in that, the preparation method of the ratio fluorescent albumen pHluorins of described pH sensitivity comprises: the gene order shown in SEQ ID NO:1 is inserted in pET15b carrier, transform Escherichia coli, abduction delivering, broken thalline, purifying obtains the ratio fluorescent albumen pHluorins of pH sensitivity.
7. the method for claim 1, is characterized in that, in described reaction system, reaction medium is water or damping fluid.
8. method as claimed in claim 7, is characterized in that, described reaction medium is water.
The purposes of the ratio fluorescent albumen pHluorins of 9.pH sensitivity, is characterized in that, for detection of pH in the reaction of oxide oxidase-indole-3-acetic acid, changes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310642001.1A CN103630519A (en) | 2013-12-03 | 2013-12-03 | Method for detecting enzyme-prodrug reaction by applying pH-sensitive ratio fluorescent protein |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310642001.1A CN103630519A (en) | 2013-12-03 | 2013-12-03 | Method for detecting enzyme-prodrug reaction by applying pH-sensitive ratio fluorescent protein |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103630519A true CN103630519A (en) | 2014-03-12 |
Family
ID=50211794
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310642001.1A Pending CN103630519A (en) | 2013-12-03 | 2013-12-03 | Method for detecting enzyme-prodrug reaction by applying pH-sensitive ratio fluorescent protein |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103630519A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115308186A (en) * | 2022-10-12 | 2022-11-08 | 广州市乾相生物科技有限公司 | fluorescence-pH biosensor and preparation method and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101031289A (en) * | 2004-04-26 | 2007-09-05 | 范德比尔特大学 | Indoleacetic acid and indenacetic acid derivatives as therapeutic agents with reduced gastrointestinal toxicity |
| CN101242833A (en) * | 2005-09-01 | 2008-08-13 | 实验室富尼耶公司 | Pyrrolopyridine derivatives and use of same as PPAR receptor modulators |
-
2013
- 2013-12-03 CN CN201310642001.1A patent/CN103630519A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101031289A (en) * | 2004-04-26 | 2007-09-05 | 范德比尔特大学 | Indoleacetic acid and indenacetic acid derivatives as therapeutic agents with reduced gastrointestinal toxicity |
| CN101242833A (en) * | 2005-09-01 | 2008-08-13 | 实验室富尼耶公司 | Pyrrolopyridine derivatives and use of same as PPAR receptor modulators |
Non-Patent Citations (5)
| Title |
|---|
| LISA K. FOLKES ET AL: "Oxidative activation of indole-3-acetic acids to cytotoxic species—a potential new role for plant auxins in cancer therapy", 《BIOCHEMICAL PHARMACOLOGY》 * |
| MATTHEW J. MAHON: "pHluorin2: an enhanced, ratiometric, pH-sensitive green florescent protein", 《ADV BIOSCI BIOTECHNOL》 * |
| OLGA GRECO ET AL: "Development of a novel enzyme/prodrug combination for gene therapy of cancer: horseradish peroxidase/indole-3-acetic acid", 《CANCER GENE THERAPY》 * |
| 杨玲 等: "吲哚乙酸结合辣根过氧化物酶诱导K562细胞凋亡机制的探讨", 《中国实验血液学杂志》 * |
| 熊杰 等: "辣根过氧化物酶_吲哚乙酸系统作为基因导向性酶前体药物疗法的研究", 《武汉大学学报(医学版)》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115308186A (en) * | 2022-10-12 | 2022-11-08 | 广州市乾相生物科技有限公司 | fluorescence-pH biosensor and preparation method and application thereof |
| CN115308186B (en) * | 2022-10-12 | 2023-01-17 | 广州市乾相生物科技有限公司 | fluorescence-pH biosensor and preparation method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105136879B (en) | A kind of preparation method and application of Electrochemiluminescsensor sensor based on graphene quantum dot | |
| CN101143216A (en) | Escherichia coli TolC antibody targeting effect improving drug-resistant bacteria sensitivity to antibiotic technology | |
| CN112961217B (en) | Siglec-15-targeted phage polypeptide | |
| CN105838777A (en) | Method for monitoring secondary drug resistance of lung cancer patient to tyrosine kinase inhibitor through ddPCR technology | |
| CN102925554B (en) | For detecting the primer sets of mycobacterium tuberculosis and the resistance to pyrazinoic acid amide property of medicine thereof | |
| CN103757118B (en) | A kind of primer and application thereof detecting human heart microvascular lesions mark miRNA21 | |
| CN106754938B (en) | A kind of aptamer detecting people's clear cell carcinoma of kidney cell and its application in preparation detection preparation | |
| CN103630519A (en) | Method for detecting enzyme-prodrug reaction by applying pH-sensitive ratio fluorescent protein | |
| EP3196308B1 (en) | Reporter vector for evaluating characteristics of subject cell, assay kit, procedure and device | |
| CN111551732A (en) | Method for quantitatively detecting content of tumor-derived extracellular vesicle PD-L1 in body fluid, ELISA kit and using method | |
| Swanson et al. | Expression and purification of phage T7 ejection proteins for cryo-EM analysis | |
| CN106248971A (en) | For detecting the ELISA kit of HER2 content, using method and purposes in human serum | |
| CN108918891B (en) | Tuberculosis protein interacting with human protein NRF1 and application thereof | |
| CN105601749A (en) | Recombinant CssPLA2 protein and soluble expression in vitro and purifying preparation method thereof | |
| CN105044047A (en) | Kit for detecting recombinant protein expression and using method thereof | |
| CN111484560A (en) | Coronavirus model and application thereof | |
| CN108530521A (en) | Recombinate the preparation and application of hepatitis C antigen | |
| CN105838779A (en) | Method for monitoring and controlling drug resistance of gastrointestinal stromal tumor patient to imatinib/sunitinib through ddPCR technology | |
| CN104087557A (en) | Hybridoma cell strain, hybridoma cell strain-based anti-Nodal antibody, and application of anti-Nodal antibody in tumor cell detection | |
| CN103788181B (en) | Lung carcinoma cell specific adhesion small peptide and application thereof | |
| CN105838778A (en) | Method for monitoring and controlling drug resistance of colorectal cancer patient to panitumumab/cetuximab through ddPCR technology | |
| CN110196327A (en) | Kit based on genetic variation analysis detection rectum cancer cell drug susceptibility | |
| CN114259496B (en) | Application of G699-0288 in preparation of medicine for treating and/or preventing esophageal cancer | |
| CN102286449B (en) | Method for extracting and purifying plague bacillus profibrinolysin activating factor Pla | |
| CN107130013A (en) | A kind of engineering bacteriophage quick detection microorganism of aminopeptidase mark |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20140312 |
|
| RJ01 | Rejection of invention patent application after publication |