CN103627710A - SPG11 gene mutant and applications thereof - Google Patents

Abstract

The invention relates a separated nucleic acid used for coding SPG11 mutant, a separated peptide, and a method, a system and a kit used for screening biological samples with susceptibility to autosomal recessive inherited hereditary spastic paraplegia. Compared with SEQ ID NO:1, the separated nucleic acid, which is used for coding SPG11 mutant, possesses at least one mutation selected from c.C6856T and c.2863delG. It is effective to detect that whether the biological samples is susceptible to autosomal recessive inherited hereditary spastic paraplegia via detection on that whether the biological samples contains the SPG11 gene mutant.

Description

SPG11 gene mutation body and application thereof

Technical field

The present invention relates to SPG11 gene mutation body and application thereof.Particularly, nucleic acid, isolated polypeptide, the screening that the present invention relates to separated coding SPG11 mutant easily suffer from the biological sample of autosomal recessive inheritance type hereditary spastic paraplegia method, screening easily suffer from autosomal recessive inheritance type hereditary spastic paraplegia biological sample system and for screening the test kit of the biological sample of easy trouble autosomal recessive inheritance type hereditary spastic paraplegia.

Background technology

Hereditary spastic paraplegia (hereditary spastic paraplegia, HSP) in 1876, by Seeligmuller, first being reported, is a kind of take the carrying out property hypermyotonia of two lower limb and syndrome with obvious genetic heterogeneity unable, scissors gait is feature.Pathological change is mainly axonal degeneration and the demyelination of the bilateral tractus corticospinalis in spinal cord, with chest marrow, attaches most importance to.It is stiff, unable that the onset initial stage often shows as two lower limb, walks and easily fall, and develops into gradually two lower limb Spastic Paraplegias, can not walk.The HSP patient's of different genetic typings clinical manifestation, state of an illness weight and course of disease length are different, and in same family, different patients' the state of an illness is also not quite similar.According to different clinical manifestations, HSP can be divided into simple form and complexity, and simple form shows as two lower limb spasm, instability of gait, the tendon hyperreflexia of progress gradually, can merge sphincter vesicae dysfunction and deep sensory and go down; Complexity patient is except above-mentioned performance, also with other performances, as dysnoesia, epilepsy, ichthyosis, peripheral neuropathy, cataract and ataxia etc.Sickness rate is 2,/10 ten thousand～10,/10 ten thousand.

HSP is single gene inheritance disease, according to the difference of mode of inheritance, HSP can be divided into autosomal dominant inheritance (autosomal dominant, AD), autosomal recessive inheritance (autosomal recessive, AR) and x linked recessive heredity (X-linked recessive, XR).Different genes type has clinical characters separately, the gene type of determining HSP patient contributes to clear and definite its clinical subtype, and for the patient who not yet falls ill in family provides gene diagnosis foundation, can be the next generation simultaneously antenatal diagnosis foundation is provided, to the offspring of child-bearing health.

In recent years, be constantly found to the HSP relevant gene locus that causes a disease, reported to the HSP relevant gene of falling ill and had 46,20 Disease-causing genes are cloned, wherein with AD for the most common.And SPG11 transgenation is modal type in AR-HSP, account for AR-HSP patient's 18.9%.Common with complexity.

Yet present stage still needs deeply to the research of autosomal recessive inheritance type hereditary spastic paraplegia (AR-HSP).

Summary of the invention

The present invention is intended at least solve one of technical problem existing in prior art.For this reason, one object of the present invention is to propose the new mutant on the autosomal recessive inheritance type hereditary spastic paraplegia Disease-causing gene of (being called for short " AR-HSP ").

The following work of the present invention based on contriver completes: the method that contriver verifies by the sudden change of high-throughput exon group order-checking associating candidate gene has been determined new mutant on the Disease-causing gene of autosomal recessive inheritance type hereditary spastic paraplegia (SPG11, c.C6856T and c.2863delG).

According to a first aspect of the invention, the present invention proposes a kind of nucleic acid (being SPG11 gene mutation body) of coding SPG11 mutant of separation.According to embodiments of the invention, this nucleic acid is compared with SEQ ID NO:1, has and is selected from c.C6856T and at least one sudden change c.2863delG.According to embodiments of the invention, contriver has determined SPG11 gene mutation body, the morbidity of this mutant and AR-HSP is closely related, whether thereby by detecting this mutant, in biological sample, exist, whether detection of biological sample easily suffers from autosomal recessive inheritance type hereditary spastic paraplegia effectively.

According to a second aspect of the invention, the present invention proposes a kind of isolated polypeptide.According to embodiments of the invention, this polypeptide is compared with SEQ ID NO:2, has at least one sudden change that is selected from p.Arg2286X and p.Glu955Lysfs*7.By whether expressing this polypeptide in detection of biological sample, whether detection of biological sample easily suffers from autosomal recessive inheritance type hereditary spastic paraplegia effectively.

According to a third aspect of the invention we, the present invention proposes a kind of method of screening the biological sample of easy trouble autosomal recessive inheritance type hereditary spastic paraplegia.According to embodiments of the invention, the method comprises the following steps: from extraction from biological material sample of nucleic acid; Determine the nucleotide sequence of described sample of nucleic acid; The nucleotide sequence of described sample of nucleic acid is compared with SEQ ID NO:1, has to be selected from c.C6856T and at least one sudden change is c.2863delG the indication that described biological sample is easily suffered from autosomal recessive inheritance type hereditary spastic paraplegia.By easily suffer from the method for the biological sample of autosomal recessive inheritance type hereditary spastic paraplegia (being AR-HSP) according to the screening of the embodiment of the present invention, can effectively screen the biological sample of easy trouble AR-HSP.

According to a forth aspect of the invention, the present invention proposes a kind of system of screening the biological sample of easy trouble autosomal recessive inheritance type hereditary spastic paraplegia.According to embodiments of the invention, this system comprises: nucleic acid-extracting apparatus, and described nucleic acid-extracting apparatus is used for from described extraction from biological material sample of nucleic acid; Nucleotide sequence determining device, described nucleotide sequence determining device is connected with described nucleic acid-extracting apparatus, for described sample of nucleic acid is analyzed, to determine the nucleotide sequence of described sample of nucleic acid; Judgment means, described judgment means is connected with described nucleotide sequence determining device, so that the nucleotide sequence based on described sample of nucleic acid is compared with SEQ ID NO:1, whether have and be selected from c.C6856T and at least one sudden change c.2863delG, judge whether described biological sample easily suffers from autosomal recessive inheritance type hereditary spastic paraplegia.Utilize this system, can effectively implement the method that the biological sample of autosomal recessive inheritance type hereditary spastic paraplegia is easily suffered from aforementioned screening, thereby can effectively screen the biological sample of easy trouble autosomal recessive inheritance type hereditary spastic paraplegia.

According to a fifth aspect of the invention, the present invention proposes a kind of for screening the test kit of the biological sample of easy trouble autosomal recessive inheritance type hereditary spastic paraplegia.According to embodiments of the invention, this test kit contains: be suitable for detecting the reagent of SPG11 gene mutation body, wherein compare with SEQ ID NO:1, described SPG11 gene mutation body has and is selected from c.C6856T and at least one sudden change c.2863delG.Utilize test kit according to an embodiment of the invention, can effectively screen the biological sample of easy trouble autosomal recessive inheritance type hereditary spastic paraplegia.

Additional aspect of the present invention and advantage in the following description part provide, and part will become obviously from the following description, or recognize by practice of the present invention.

Accompanying drawing explanation

Above-mentioned and/or additional aspect of the present invention and advantage accompanying drawing below combination obviously and is easily understood becoming the description of embodiment, wherein:

Fig. 1 has shown the system of biological sample and the schematic diagram of integral part thereof of easily suffering from AR-HSP according to the screening of the embodiment of the present invention, wherein, A is for easily suffering from the schematic diagram of system of the biological sample of AR-HSP according to the screening of the embodiment of the present invention, B is according to the schematic diagram of the nucleic acid-extracting apparatus of the embodiment of the present invention, and C is according to the schematic diagram of the nucleotide sequence determining device of the embodiment of the present invention;

Fig. 2 has shown according to the pedigree chart of the embodiment of the present invention AR-HSP family;

Fig. 3 has shown the Sanger sequence verification peak figure according to the SPG11 gene mutation site of the patient II2 of the embodiment of the present invention, and wherein, A is c.C6856T mutational site Sanger sequence verification peak figure, and B is mutational site Sanger sequence verification peak figure c.2863delG;

Fig. 4 has shown the Sanger sequence verification peak figure according to the SPG11 gene mutation site of normal people I3 in the family of the embodiment of the present invention, wherein, A is c.C6856T mutational site Sanger sequence verification peak figure, and B is mutational site Sanger sequence verification peak figure c.2863delG;

Fig. 5 has shown the Sanger sequence verification peak figure according to the SPG11 gene mutation site of normal people I2 in the family of the embodiment of the present invention, wherein, A is c.C6856T mutational site Sanger sequence verification peak figure, and B is mutational site Sanger sequence verification peak figure c.2863delG; And

Fig. 6 has shown the Sanger sequence verification peak figure according to the SPG11 gene mutation site of normal people I4 in the family of the embodiment of the present invention, wherein, A is c.C6856T mutational site Sanger sequence verification peak figure, and B is mutational site Sanger sequence verification peak figure c.2863delG.

Embodiment

Describe embodiments of the invention below in detail, the example of described embodiment is shown in the drawings, and wherein same or similar label represents same or similar element or has the element of identical or similar functions from start to finish.Below by the embodiment being described with reference to the drawings, be exemplary, only for explaining the present invention, and can not be interpreted as limitation of the present invention.

SPG11 gene mutation body

According to a first aspect of the invention, the present invention proposes a kind of nucleic acid of coding SPG11 mutant of separation.According to embodiments of the invention, to compare with SEQ ID NO:1, this nucleic acid has and is selected from c.C6856T and at least one sudden change c.2863delG.The phraseology used in this article " nucleic acid of coding SPG11 mutant ", refer to the nucleic acid substances corresponding with the gene of the SPG11 mutant of encoding, the type that is nucleic acid is not particularly limited, can be any encoding gene (being SPG11 gene mutation body) corresponding deoxyribonucleotide and/or polymkeric substance of ribonucleotide comprising with SPG11 mutant, include but not limited to DNA, RNA or cDNA.According to a concrete example of the present invention, the nucleic acid of foregoing coding SPG11 mutant is DNA.According to embodiments of the invention, contriver has determined the mutant of SPG11 gene, the morbidity of this mutant and autosomal recessive inheritance type hereditary spastic paraplegia is closely related, thereby whether exist in biological sample by detecting this mutant, whether detection of biological sample easily suffers from autosomal recessive inheritance type hereditary spastic paraplegia effectively, also can in organism, whether exist by detecting this mutant, can effectively predict whether organism easily suffers from autosomal recessive inheritance type hereditary spastic paraplegia.

The nucleic acid of these coding SPG11 mutant is that present inventor passes through the new mutant on the Disease-causing gene of the definite autosomal recessive inheritance type hereditary spastic paraplegia of method that the sudden change of high-throughput exon group order-checking associating candidate gene verifies.And, in the prior art and have no c.C6856T on SPGll gene and the sudden change report relevant to AR-HSP c.2863delG.

The cDNA of wild-type SPGll gene has nucleotide sequence as follows (7332nt):

ATGGCTGCAGAGGAAGGGGTCGCGAGTGCTGCTTCCGCCGGCGGTAGCTGGGGCACCGCGGCCATGGGGCGGGTTCTACCGATGCTGTTGGTGCCAGTCCCCGCCGAGGCGATGGGGCAGCTCGGCTCCCGGGCGCAGCTGCGCACACAGCCGGAGGCTCTGGGGAGCCTGACGGCTGCGGGCAGCCTCCAAGTGCTTTCTTTGACGCCTGGCAGCCGGGGCGGGGGTCGCTGCTGCCTGGAGGGCCCCTTCTGGCACTTTCTATGGGAGGATTCTCGTAACAGCAGCACACCAACTGAAAAGCCCAAACTGCTCGCTCTTGGTGAAAATTATGAACTGCTTATCTATGAATTTAATTTGAAAGATGGAAGATGTGATGCAACCATTTTGTATAGCTGTAGTAGGGAGGCATTGCAAAAGCTCATTGACGATCAAGATATCAGTATTTCCTTATTGTCTTTGAGAATCCTGTCATTTCACAATAACACATCATTACTGTTCATCAACAAATGTGTCATCCTACATATTATATTTCCTGAAAGAGATGCTGCAATTAGAGTACTCAACTGTTTCACACTTCCCTTGCCTGCACAGGCAGTGGACATGATTATTGACACGCAGCTCTGCAGAGGAATTCTTTTTGTTTTGAGTAGTTTAGGCTGGATCTACATTTTTGATGTTGTGGATGGTACATATGTAGCTCATGTGGATTTAGCACTTCACAAAGAAGACATGTGTAATGAGCAGCAACAGGAGCCAGCCAAGATTTCTTCATTTACTTCACTGAAAGTTTCTCAAGACCTCGATGTTGCAGTGATTGTCAGCTCCTCCAACTCCGCAGTTGCTCTTAACTTAAATTTGTATTTCAGGCAACACCCAGGACACCTACTGTGTGAAAGAATACTAGAAGATCTTCCTATTCAAGGACCTAAGGGCGTAGATGAAGATGATCCTGTTAACTCTGCCTACAACATGAAACTGGCCAAGTTTTCCTTCCAAATTGATAGGTCTTGGAAAGCCCAGCTATCATCATTGAATGAAACAATAAAGAACTCCAAACTGGAGGTTTCCTGTTGTGCTCCATGGTTCCAGGATATTTTGCATTTGGAGTCACCTGAATCTGGTAACCACAGTACAAGTGTGCAGAGCTGGGCCTTCATTCCACAGGACATAATGCATGGGCAATATAATGTTCTACAGAAAGATCATGCCAAGACCAGTGATCCAGGAAGATCATGGAAAATAATGCACATCAGTGAACAAGAGGAACCCATAGAGCTTAAATGTGTGTCTGTGACAGGATTCACTGCACTGTTTACTTGGGAAGTGGAAAGGATGGGCTATACCATTACCCTCTGGGATTTGGAGACCCAGGGCATGCAGTGTTTTTCCCTTGGCACAAAGTGTATTCCTGTAGACAGTAGTGGAGACCAGCAGCTGTGCTTTGTTTTGACAGAGAATGGACTCTCTCTGATTTTGTTTGGTTTGACTCAAGAAGAGTTTTTAAACAGACTCATGATCCATGGAAGTGCCAGCACTGTGGACACTCTTTGTCATCTCAATGGCTGGGGAAGGTGCTCAATTCCCATACATGCACTAGAGGCCGGGATAGAAAATCGTCAGCTGGACACAGTAAATTTCTTTTTGAAGAGCAAGGAAAATCTTTTTAATCCATCCTCAAAATCTTCTGTATCTGATCAGTTTGATCACTTGTCATCCCATTTATATTTAAGAAATGTGGAAGAGCTGATACCAGCATTGGATTTACTTTGCTCGGCAATTAGAGAAAGTTATTCTGAACCCCAAAGCAAACACTTTTCAGAACAATTGCTTAATCTTACACTGTCTTTCCTTAACAACCAAATAAAGGAGCTTTTCATTCACACTGAAGAACTAGATGAACATCTGCAAAAAGGAGTGAACATTTTGACTAGCTACATTAATGAACTTCGAACCTTCATGATAAAGTTTCCTTGGAAGCTAACAGATGCTATAGATGAATATGATGTACATGAAAATGTCCCCAAAGTAAAGGAGAGCAATATATGGAAGAAACTCAGCTTTGAGGAAGTTATTGCCAGCGCCATTTTAAACAACAAAATACCAGAGGCACAGACTTTCTTCAGGATTGATAGTCATTCTGCTCAAAAACTTGAGGAGCTTATTGGCATAGGCCTAAATTTGGTCTTTGACAATTTAAAAAAGAACAATATAAAGGAAGCCTCTGAACTTTTGAAGAATATGGGGTTTGATGTAAAAGGCCAATTGCTCAAGATCTGCTTCTATACAACTAATAAAAATATACGTGACTTTTTGGTTGAAATTTTAAAAGAAAAAAATTATTTTTCTGAAAAAGAGAAAAGAACTATAGACTTCGTGCATCAAGTTGAGAAGCTTTATTTGGGACATTTCCAAGAAAATATGCAAATCCAGTCATTTCCCAGGTACTGGATAAAGGAACAAGATTTTTTCAAGCACAAGTCTGTTTTGGACTCATTCCTGAAATATGATTGTAAAGATGAATTTAACAAACAGGACCATAGAATTGTGTTAAATTGGGCTCTGTGGTGGGATCAACTAACACAAGAATCCATCCTTCTCCCCAGGATAAGTCCAGAAGAATACAAATCATATTCCCCTGAAGCCCTCTGGAGATACCTCACAGCTCGCCATGATTGGTTAAACATTATCTTATGGATTGGAGAATTTCAAACCCAGCATAGTTATGCTTCACTTCAGCAGAACAAATGGCCCCTTCTGACTGTTGATGTTATTAACCAGAATACTTCCTGTAACAACTACATGAGGAATGAAATTTTAGATAAGCTGGCCAGGAATGGGGTTTTTTTGGCATCTGAACTGGAAGACTTTGAATGCTTCCTCCTAAGACTGAGCCGTATTGGAGGTGTAATACAGGATACCCTCCCTGTTCAAAACTACAAGACCAAAGAAGGTTGGGATTTCCATTCTCAATTCATTCTCTATTGTTTGGAGCACAGTCTGCAGCATCTTCTTTATGTCTACCTTGACTGTTACAAACTTAGTCCTGAAAATTGTCCCTTTTTGGAAAAAAAAGAGTTACATGAAGCACACCCTTGGTTTGAATTTTTAGTTCAGTGTCGACAAGTTGCCAGTAACTTAACAGATCCCAAACTGATCTTCCAGGCTAGCCTTGCAAATGCTCAGATTTTGATTCCCACCAATCAGGCCAGTGTAAGCAGTATGCTATTGGAAGGACATACCCTCCTGGCCCTTGCTACTACAATGTATTCTCCTGGGGGTGTCAGTCAGGTTGTTCAGAATGAAGAAAATGAAAACTGTTTGAAGAAAGTGGATCCCCAGCTATTGAAGATGGCATTAACTCCTTACCCCAAGCTAAAAACTGCTCTCTTCCCACAGTGCACTCCTCCTAGTGTCCTGCCATCTGATATTACAATCTACCACCTTATTCAGTCATTATCACCCTTTGATCCTAGCAGATTGTTTGGCTGGCAGTCTGCTAACACACTAGCTATAGGAGATGCATGGAGTCATCTCCCACATTTCTCTAGCCCTGACCTGGTTAATAAATATGCTATAGTGGAACGTCTGAATTTTGCTTATTATTTACATAATGGGCGGCCATCATTTGCATTTGGTACTTTTCTGGTCCAGGAATTAATCAAGAGCAAGACTCCCAAGCAGCTGATCCAGCAAGTAGGCAATGAAGCCTATGTTATAGGGCTCTCCTCCTTCCACATACCTTCAATAGGAGCTGCATGTGTTTGTTTCTTAGAATTGCTTGGCCTTGACAGCCTCAAGCTCAGAGTTGATATGAAAGTGGCCAATATAATTTTGAGCTACAAGTGCAGAAATGAAGATGCTCAGTACAGCTTTATCAGAGAGTCTGTAGCCGAAAAACTATCTAAACTAGCTGATGGTGAAAAGACAACCACAGAAGAATTGCTTGTTCTCTTAGAAGAAGGTACATGGAACAGCATTCAGCAACAGGAAATAAAGAGGTTATCCAGTGAATCTAGCAGCCAATGGGCATTAGTGGTGCAGTTCTGCAGGCTACACAATATGAAACTAAGCATATCTTACCTTAGAGAATGTGCCAAAGCAAATGATTGGCTGCAGTTCATTATTCACAGCCAACTCCACAACTACCACCCAGCAGAGGTGAAATCCCTTATCCAGTACTTCAGCCCAGTCATTCAAGACCACTTAAGGCTGGCTTTTGAGAACTTGCCCTCAGTGCCCACCTCCAAAATGGACAGCGATCAAGTCTGCAATAAGTGCCCCCAGGAACTTCAAGGAAGCAAACAAGAGATGACCGATTTATTTGAAATTCTGCTCCAATGCTCAGAGGAGCCAGACTCCTGGCACTGGCTTCTGGTTGAAGCAGTGAAACAACAGGCCCCTATCCTCAGTGTTCTGGCCTCATGTCTCCAGGGTGCCAGTGCCATTTCTTGTCTCTGTGTTTGGATCATCACTTCTGTGGAGGACAATGTTGCAACTGAAGCAATGGGACACATTCAGGACTCAACAGAGGACCATACCTGGAACCTTGAGGATCTTTCAGTCATCTGGAGAACATTATTAACAAGACAAAAGAGCAAAACTCTCATCAGAGGTTTCCAGCTTTTCTTTAAGGATTCCCCGTTACTACTGGTGATGGAGATGTATGAACTGTGTATGTTCTTCAGGAATTATAAAGAAGCTGAAGCTAAACTTCTGGAGTTTCAGAAGAGCCTTGAAACGCTTAACACAGCAGCCACAAAGGTCCACCCTGTCATCC CTGCCATGTGGCTGGAGGATCAGGTGTGTTTCCTTTTGAAGCTTATGCTACAGCAGTGTAAGACCCAGTATGAGCTGGGGAAGCTTTTACAGCTCTTTGTTGAAAGAGAGCATCTCTTCTCTGATGGTCCAGATGTGAAAAAGCTTTGCATCCTTTGCCAGATTTTGAAGGATACATCCATAGCCATTAATCATACAATTATTACCAGCTACAGCATTGAGAATCTTCAGCATGAATGTAGATCTATTTTGGAAAGACTGCAGACAGATGGACAATTCGCTTTGGCCAGGAGGGTAGCAGAATTAGCTGAGTTACCTGTGGACAACTTGGTTATTAAAGAGATAACACAGGAAATGCAGACCCTAAAACACATTGAACAGTGGTCACTAAAACAAGCAAGAATTGACTTCTGGAAAAAATGCCATGAGAATTTTAAGAAAAATTCAATTTCAAGCAAAGCAGCTTCTTCCTTTTTCTCAACCCAGGCCCATGTGGCATGTGAGCACCCAACTGGATGGAGCAGCATGGAGGAGCGCCATCTGCTGCTCACCTTGGCAGGGCACTGGCTTGCCCAGGAGGACGTGGTGCCCTTGGATAAGCTGGAGGAGCTGGAGAAGCAGATCTGGCTGTGCCGCATCACCCAGCACACTCTTGGAAGAAATCAGGAGGAAACAGAGCCCAGATTTTCTCGACAGATCTCAACTAGTGGTGAACTTTCCTTTGATAGTTTAGCCAGTGAGTTTTCCTTCTCCAAGTTGGCTGCTCTGAACACATCAAAATACTTAGAACTTAACAGCCTTCCATCCAAAGAGACATGCGAGAATAGATTGGATTGGAAAGAGCAGGAGTCACTAAACTTTTTGATTGGGCGCCTACTGGATGATGGCTGTGTGCATGAAGCAAGTAGAGTATGCCGGTATTTTCATTTTTATAATCCAGATGTCGCCTTGGTATTGCACTGCAGAGCACTGGCCTCAGGGGAAGCTAGTATGGAGGATCTGCACCCAGAGATCCATGCTCTCCTACAAAGTGCTGAGCTGCTTGAGGAAGAAGCACCCGACATTCCCCTAAGGAGAGTCCACAGCACTTCAAGTCTGGATAGTCAGAAGTTTGTGACAGTGCCCTCCAGTAATGAAGTGGTAACTAACCTGGAAGTGCTGACAAGCAAATGCCTCCATGGGAAGAACTACTGTCGACAGGTCCTCTGTCTGTATGATCTTGCCAAGGAGTTGGGCTGTTCCTACACAGATGTTGCTGCTCAGGATGGTGAAGCCATGCTCCGGAAAATCTTGGCCTCTCAGCAGCCTGACCGATGCAAACGAGCCCAGGCCTTCATCAGCACACAGGGCCTTAAGCCAGATACTGTGGCTGAACTCGTGGCAGAAGAGGTGACACGGGAGCTGCTTACTTCATCACAGGGAACAGGACATAAGCAGATGTTCAACCCAACAGAGGAAAGCCAGACATTTCTTCAGCTGACCACTCTGTGTCAAGACCGCACATTGGTAGGCATGAAGTTGTTGGATAAGATTTCCTCCGTTCCCCATGGGGAACTGTCTTGCACCACAGAGCTCCTGATCCTGGCCCATCATTGCTTCACCCTGACGTGCCACATGGAGGGCATCATCCGAGTCCTACAGGCCGCCCACATGCTCACAGATAACCACCTGGCCCCCAGTGAGGAGTATGGGCTGGTGGTACGGCTCCTCACTGGCATTGGAAGGTACAACGAGATGACATACATATTTGATTTGCTGCATAAAAAGCACTACTTTGAAGTGCTAATGAGGAAGAAGTTGGATCCGAGTGGTACCCTGAAAACAGCCCTGCTGGACTACATCAAACGCTGCCGTCCTGGAGACAGTGAAAAGCACAATATGATTGCCCTGTGCTTCAGCATGTGCCGGGAGATTGGCGAGAACCACGAGGCAGCTGCCCGCATCCAACTGAAATTGATTGAGTCTCAGCCCTGGGAGGACAGCCTCAAGGATGGGCACCAGCTGAAACAACTGCTGCTGAAGGCCCTGACTCTGATGTTGGATGCAGCAGAGAGTTATGCCAAGGACTCCTGTGTGCGACAGGCCCAGCACTGTCAGCGGCTCACCAAGTTGATAACTCTGCAGATTCACTTTCTGAACACTGGCCAGAACACAATGCTCATCAACTTGGGCCGCCACAAGCTGATGGACTGTATTCTGGCCCTACCTCGGTTCTACCAGGCTTCTATTGTGGCTGAGGCCTACGATTTTGTTCCAGATTGGGCTGAAATTTTATA CCAGCAAGTGATTCTTAAAGGAGACTTTAATTACTTGGAAGAATTTAAGCAGCAAA GGTTATTAAAGTCCAGTATATTTGAAGAGATTTCCAAAAAATATAAACAACATCAG CCTACTGACATGGTCATGGAAAACCTGAAGAAATTACTCACATATTGTGAAGATGT TTACCTGTATTACAAGTTGGCATACGAACACAAGTTTTATGAAATTGTAAATGTGC TTCTGAAGGACCCTCAGACAGGTTGCTGTCTAAAGGACATGCTAGCAGGTTAG (SEQ ID NO:1), the protein of its coding has amino acid sequence as follows (2443Aa):

MAAEEGVASAASAGGSWGTAAMGRVLPMLLVPVPAEAMGQLGSRAQLRTQPEALGSLTAAGSLQVLSLTPGSRGGGRCCLEGPFWHFLWEDSRNSSTPTEKPKLLALGENYELLIYEFNLKDGRCDATILYSCSREALQKLIDDQDISISLLSLRILSFHNNTSLLFINKCVILHIIFPERDAAIRVLNCFTLPLPAQAVDMIIDTQLCRGILFVLSSLGWIYIFDVVDGTYVAHVDLALHKEDMCNEQQQEPAKISSFTSLKVSQDLDVAVIVSSSNSAVALNLNLYFRQHPGHLLCERILEDLPIQGPKGVDEDDPVNSAYNMKLAKFSFQIDRSWKAQLSSLNETIKNSKLEVSCCAPWFQDILHLESPESGNHSTSVQSWAFIPQDIMHGQYNVLQKDHAKTSDPGRSWKIMHISEQEEPIELKCVSVTGFTALFTWEVERMGYTITLWDLETQGMQCFSLGTKCIPVDSSGDQQLCFVLTENGLSLILFGLTQEEFLNRLMIHGSASTVDTLCHLNGWGRCSIPIHALEAGENRQLDTVNFFLKSKENLFNPSSKSSVSDQFDHLSSHLYLRNVEELIPALDLLCSAIRESYSEPQSKHFSEQLLNLTLSFLNNQIKELFIHTEELDEHLQKGVNILTSYINELRTFMIKFPWKLTDAIDEYDVHENVPKVKESNIWKKLSFEEVIASAILNNKIPEAQTFFRIDSHSAQKLEELIGIGLNLVFDNLKKNNIKEASELLKNMGFDVKGQLLKICFYTTNKNIRDFLVEILKEKNYFSEKEKRTIDFVHQVEKLYLGHFQENMQIQSFPRYWIKEQDFFKHKSVLDSFLKYDCKDEFNKQDHRIVLNWALWWDQLTQESILLPRISPEEYKSYSPEALWRYLTARHDWLNIILWIGEFQTQHSYASLQQNKWPLLTVDVINQNTSCNNYMRNEILDKLARNGVFLASELEDFECFLLRLSRIGGVIQDTLPVQNYKTKEGWDFHSQFILYCLEHSLQHLLYVYLDCYKLSPENCPFLEKKELHEAHPWFEFLVQCRQVASNLTDPKLIFQASLANAQILIPTNQASVSSMLLEGHTLLALATTMYSPGGVSQVVQNEENENCLKKVDPQLLKMALTPYPKLKTALFPQCTPPSVLPSDITIYHLIQSLSPFDPSRLFGWQSANTLAIGDAWSHLPHFSSPDLVNKYAIVERLNFAYYLHNGRPSFAFGTFLVQELIKSKTPKQLIQQVGNEAYVIGLSSFHIPSIGAACVCFLELLGLDSLKLRVDMKVANIILSYKCRNEDAQYSFIRESVAEKLSKLADGEKTTTEELLVLLEEGTWNSIQQQEIKRLSSESSSQWALVVQFCRLHNMKLSISYLRECAKANDWLQFIIHSQLHNYHPAEVKSLIQYFSPVIQDHLRLAFENLPSVPTSKMDSDQVCNKCPQELQGSKQEMTDLFEILLQCSEEPDSWHWLLVEAVKQQAPILSVLASCLQGASAISCLCVWIITSVEDNVATEAMGHIQDSTEDHTWNLEDLSVIWRTLLTRQKSKTLIRGFQLFFKDSPLLLVMEMYELCMFFRNYKEAEAKLLEFQKSLETLNTAATKVHPVIPAMWLEDQVCFLLKLMLQQCKTQYELGKLLQLFVEREHLFSDGPDVKKLCILCQILKDTSIAINHTIITSYSIENLQHECRSILERLQTDGQFALARRVAELAELPVDNLVIKEITQEMQTLKHIEQWSLKQARIDFWKKCHENFKKNSISSKAASSFFSTQAHVACEHPTGWSSMEERHLLLTLAGHWLAQEDVVPLDKLEELEKQIWLCRITQHTLGRNQEETEPRFSRQISTSGELSFDSLASEFSFSKLAALNTSKYLELNSLPSKETCENRLDWKEQESLNFLIGRLLDDGCVHEASRVCRYFHFYNPDVALVLHCRALASGEASMEDLHPEIHALLQSAELLEEEAPDIPLRRVHSTSSLDSQKFVTVPSSNEVVTNLEVLTSKCLHGKNYCRQVLCLYDLAKELGC?SYTDVAAQDGEAMLRKILASQQPDRCKRAQAFISTQGLKPDTVAELVAEEVTRELLTSSQGTGHKQMFNPTEESQTFLQLTTLCQDRTLVGMKLLDKISSVPHGELSCTTELLILAHHCFTLTCHMEGIIRVLQAAHMLTDNHLAPSEEYGLVVRLLTGIGRYNEMTYIFDLLHKKHYFEVLMRKKLDPSGTLKTALLDYIKRCRPGDSEKHNMIALCFSMCREIGENHEAAARIQLKLIESQPWEDSLKDGHQLKQLLLKALTLMLDAAESYAKDSCVRQAQHCQRLTKLITLQIHFLNTGQNTMLINLGRHKLMDCILALPRFYQASIVAEAYDFVPDWAEILYQQVILKGDFNYLEEFKQQRLLKSSIFEEISKKYKQHQPTDMVMENLKKLLTYCEDVYLYYKLAYEHKFYEIVNVLLKDPQTGCCLKDMLAG(SEQ?IDNO：2)。

C.2863delG the cDNA sequence (2886nt) of the formed SPGll gene mutation body of phase shift mutation is as follows:

ATGGCTGCAGAGGAAGGGGTCGCGAGTGCTGCTTCCGCCGGCGGTAGCTGGGGCACCGCGGCCATGGGGCGGGTTCTACCGATGCTGTTGGTGCCAGTCCCCGCCGAGGCGATGGGGCAGCTCGGCTCCCGGGCGCAGCTGCGCACACAGCCGGAGGCTCTGGGGAGCCTGACGGCTGCGGGCAGCCTCCAAGTGCTTTCTTTGACGCCTGGCAGCCGGGGCGGGGGTCGCTGCTGCCTGGAGGGCCCCTTCTGGCACTTTCTATGGGAGGATTCTCGTAACAGCAGCACACCAACTGAAAAGCCCAAACTGCTCGCTCTTGGTGAAAATTATGAACTGCTTATCTATGAATTTAATTTGAAAGATGGAAGATGTGATGCAACCATTTTGTATAGCTGTAGTAGGGAGGCATTGCAAAAGCTCATTGACGATCAAGATATCAGTATTTCCTTATTGTCTTTGAGAATCCTGTCATTTCACAATAACACATCATTACTGTTCATCAACAAATGTGTCATCCTACATATTATATTTCCTGAAAGAGATGCTGCAATTAGAGTACTCAACTGTTTCACACTTCCCTTGCCTGCACAGGCAGTGGACATGATTATTGACACGCAGCTCTGCAGAGGAATTCTTTTTGTTTTGAGTAGTTTAGGCTGGATCTACATTTTTGATGTTGTGGATGGTACATATGTAGCTCATGTGGATTTAGCACTTCACAAAGAAGACATGTGTAATGAGCAGCAACAGGAGCCAGCCAAGATTTCTTCATTTACTTCACTGAAAGTTTCTCAAGACCTCGATGTTGCAGTGATTGTCAGCTCCTCCAACTCCGCAGTTGCTCTTAACTTAAATTTGTATTTCAGGCAACACCCAGGACACCTACTGTGTGAAAGAATACTAGAAGATCTTCCTATTCAAGGACCTAAGGGCGTAGATGAAGATGATCCTGTTAACTCTGCCTACAACATGAAACTGGCCAAGTTTTCCTTCCAAATTGATAGGTCTTGGAAAGCCCAGCTATCATCATTGAATGAAACAATAAAGAACTCCAAACTGGAGGTTTCCTGTTGTGCTCCATGGTTCCAGGATATTTTGCATTTGGAGTCACCTGAATCTGGTAACCACAGTACAAGTGTGCAGAGCTGGGCCTTCATTCCACAGGACATAATGCATGGGCAATATAATGTTCTACAGAAAGATCATGCCAAGACCAGTGATCCAGGAAGATCATGGAAAATAATGCACATCAGTGAACAAGAGGAACCCATAGAGCTTAAATGTGTGTCTGTGACAGGATTCACTGCACTGTTTACTTGGGAAGTGGAAAGGATGGGCTATACCATTACCCTCTGGGATTTGGAGACCCAGGGCATGCAGTGTTTTTCCCTTGGCACAAAGTGTATTCCTGTAGACAGTAGTGGAGACCAGCAGCTGTGCTTTGTTTTGACAGAGAATGGACTCTCTCTGATTTTGTTTGGTTTGACTCAAGAAGAGTTTTTAAACAGACTCATGATCCATGGAAGTGCCAGCACTGTGGACACTCTTTGTCATCTCAATGGCTGGGGAAGGTGCTCAATTCCCATACATGCACTAGAGGCCGGGATAGAAAATCGTCAGCTGGACACAGTAAATTTCTTTTTGAAGAGCAAGGAAAATCTTTTTAATCCATCCTCAAAATCTTCTGTATCTGATCAGTTTGATCACTTGTCATCCCATTTATATTTAAGAAATGTGGAAGAGCTGATACCAGCATTGGATTTACTTTGCTCGGCAATTAGAGAAAGTTATTCTGAACCCCAAAGCAAACACTTTTCAGAACAATTGCTTAATCTTACACTGTCTTTCCTTAACAACCAAATAAAGGAGCTTTTCATTCACACTGAAGAACTAGATGAACATCTGCAAAAAGGAGTGAACATTTTGACTAGCTACATTAATGAACTTCGAACCTTCATGATAAAGTTTCCTTGGAAGCTAACAGATGCTATAGATGAATATGATGTACATGAAAATGTCCCCAAAGTAAAGGAGAGCAATATATGGAAGAAACTCAGCTTTGAGGAAGTTATTGCCAGCGCCATTTTAAACAACAAAATACCAGAGGCACAGACTTTCTTCAGGATTGATAGTCATTCTGCTCAAAAACTTGAGGAGCTTATTGGCATAGGCCTAAATTTGGTCTTTGACAATTTAAAAAAGAACAATATAAAGGAAGCCTCTGAACTTTTGAAGAATATGGGGTTTGATGTAAAAGGCCAATTGCTCAAGATCTGCTTCTATACAACTAATAAAAATATACGTGACTTTTTGGTTGAAATTTTAAAAGAAAAAAATTATTTTTCTGAAAAAGAGAAAAGAACTATAGACTTCGTGCATCAAGTTGAGAAGCTTTATTTGGGACATTTCCAAGAAAATATGCAAATCCAGTCATTTCCCAGGTACTGGATAAAGGAACAAGATTTTTTCAAGCACAAGTCTGTTTTGGACTCATTCCTGAAATATGATTGTAAAGATGAATTTAACAAACAGGACCATAGAATTGTGTTAAATTGGGCTCTGTGGTGGGATCAACTAACACAAGAATCCATCCTTCTCCCCAGGATAAGTCCAGAAGAATACAAATCATATTCCCCTGAAGCCCTCTGGAGATACCTCACAGCTCGCCATGATTGGTTAAACATTATCTTATGGATTGGAGAATTTCAAACCCAGCATAGTTATGCTTCACTTCAGCAGAACAAATGGCCCCTTCTGACTGTTGATGTTATTAACCAGAATACTTCCTGTAACAACTACATGAGGAATGAAATTTTAGATAAGCTGGCCAGGAATGGGGTTTTTTTGGCATCTGAACTGAAGACTTTGAATGCTTCCTCCTAA(SEQ?ID?NO：3)，

The protein with p.Glu955Lysfs*7 sudden change of its coding has aminoacid sequence as follows (961Aa):

MAAEEGVASAASAGGSWGTAAMGRVLPMLLVPVPAEAMGQLGSRAQLRTQPEALGSLTAAGSLQVLSLTPGSRGGGRCCLEGPFWHFLWEDSRNSSTPTEKPKLLALGENYELLIYEFNLKDGRCDATILYSCSREALQKLIDDQDISISLLSLRILSFHNNTSLLFINKCVILHIIFPERDAAIRVLNCFTLPLPAQAVDMIIDTQLCRGILFVLSSLGWIYIFDVVDGTYVAHVDLALHKEDMCNEQQQEPAKISSFTSLKVSQDLDVAVIVSSSNSAVALNLNLYFRQHPGHLLCERILEDLPIQGPKGVDEDDPVNSAYNMKLAKFSFQIDRSWKAQLSSLNETIKNSKLEVSCCAPWFQDILHLESPESGNHSTSVQSWAFIPQDIMHGQYNVLQKDHAKTSDPGRSWKIMHISEQEEPIELKCVSVTGFTALFTWEVERMGYTITLWDLETQGMQCFSLGTKCIPVDSSGDQQLCFVLTENGLSLILFGLTQEEFLNRLMIHGSASTVDTLCHLNGWGRCSIPIHALEAGENRQLDTVNFFLKSKENLFNPSSKSSVSDQFDHLSSHLYLRNVEELIPALDLLCSAIRESYSEPQSKHFSEQLLNLTLSFLNNQIKELFIHTEELDEHLQKGVNILTSYINELRTFMIKFPWKLTDAIDEYDVHENVPKVKESNIWKKLSFEEVIASAILNNKIPEAQTFFRIDSHSAQKLEELIGIGLNLVFDNLKKNNIKEASELLKNMGFDVKGQLLKICFYTTNKNIRDFLVEILKEKNYFSEKEKRTIDFVHQVEKLYLGHFQENMQIQSFPRYWIKEQDFFKHKSVLDSFLKYDCKDEFNKQDHRIVLNWALWWDQLTQESILLPRISPEEYKSYSPEALWRYLTARHDWLNIILWIGEFQTQHSYASLQQNKWPLLTVDVINQNTSCNNYMRNEILDKLARNGVFLASELKTLNASS(SEQ?ID?NO：4)。

The cDNA sequence (6858nt) of the formed SPGll gene mutation body of c.C6856T is as follows:

ATGGCTGCAGAGGAAGGGGTCGCGAGTGCTGCTTCCGCCGGCGGTAGCTGGGGCACCGCGGCCATGGGGCGGGTTCTACCGATGCTGTTGGTGCCAGTCCCCGCCGAGGCGATGGGGCAGCTCGGCTCCCGGGCGCAGCTGCGCACACAGCCGGAGGCTCTGGGGAGCCTGACGGCTGCGGGCAGCCTCCAAGTGCTTTCTTTGACGCCTGGCAGCCGGGGCGGGGGTCGCTGCTGCCTGGAGGGCCCCTTCTGGCACTTTCTATGGGAGGATTCTCGTAACAGCAGCACACCAACTGAAAAGCCCAAACTGCTCGCTCTTGGTGAAAATTATGAACTGCTTATCTATGAATTTAATTTGAAAGATGGAAGATGTGATGCAACCATTTTGTATAGCTGTAGTAGGGAGGCATTGCAAAAGCTCATTGACGATCAAGATATCAGTATTTCCTTATTGTCTTTGAGAATCCTGTCATTTCACAATAACACATCATTACTGTTCATCAACAAATGTGTCATCCTACATATTATATTTCCTGAAAGAGATGCTGCAATTAGAGTACTCAACTGTTTCACACTTCCCTTGCCTGCACAGGCAGTGGACATGATTATTGACACGCAGCTCTGCAGAGGAATTCTTTTTGTTTTGAGTAGTTTAGGCTGGATCTACATTTTTGATGTTGTGGATGGTACATATGTAGCTCATGTGGATTTAGCACTTCACAAAGAAGACATGTGTAATGAGCAGCAACAGGAGCCAGCCAAGATTTCTTCATTTACTTCACTGAAAGTTTCTCAAGACCTCGATGTTGCAGTGATTGTCAGCTCCTCCAACTCCGCAGTTGCTCTTAACTTAAATTTGTATTTCAGGCAACACCCAGGACACCTACTGTGTGAAAGAATACTAGAAGATCTTCCTATTCAAGGACCTAAGGGCGTAGATGAAGATGATCCTGTTAACTCTGCCTACAACATGAAACTGGCCAAGTTTTCCTTCCAAATTGATAGGTCTTGGAAAGCCCAGCTATCATCATTGAATGAAACAATAAAGAACTCCAAACTGGAGGTTTCCTGTTGTGCTCCATGGTTCCAGGATATTTTGCATTTGGAGTCACCTGAATCTGGTAACCACAGTACAAGTGTGCAGAGCTGGGCCTTCATTCCACAGGACATAATGCATGGGCAATATAATGTTCTACAGAAAGATCATGCCAAGACCAGTGATCCAGGAAGATCATGGAAAATAATGCACATCAGTGAACAAGAGGAACCCATAGAGCTTAAATGTGTGTCTGTGACAGGATTCACTGCACTGTTTACTTGGGAAGTGGAAAGGATGGGCTATACCATTACCCTCTGGGATTTGGAGACCCAGGGCATGCAGTGTTTTTCCCTTGGCACAAAGTGTATTCCTGTAGACAGTAGTGGAGACCAGCAGCTGTGCTTTGTTTTGACAGAGAATGGACTCTCTCTGATTTTGTTTGGTTTGACTCAAGAAGAGTTTTTAAACAGACTCATGATCCATGGAAGTGCCAGCACTGTGGACACTCTTTGTCATCTCAATGGCTGGGGAAGGTGCTCAATTCCCATACATGCACTAGAGGCCGGGATAGAAAATCGTCAGCTGGACACAGTAAATTTCTTTTTGAAGAGCAAGGAAAATCTTTTTAATCCATCCTCAAAATCTTCTGTATCTGATCAGTTTGATCACTTGTCATCCCATTTATATTTAAGAAATGTGGAAGAGCTGATACCAGCATTGGATTTACTTTGCTCGGCAATTAGAGAAAGTTATTCTGAACCCCAAAGCAAACACTTTTCAGAACAATTGCTTAATCTTACACTGTCTTTCCTTAACAACCAAATAAAGGAGCTTTTCATTCACACTGAAGAACTAGATGAACATCTGCAAAAAGGAGTGAACATTTTGACTAGCTACATTAATGAACTTCGAACCTTCATGATAAAGTTTCCTTGGAAGCTAACAGATGCTATAGATGAATATGATGTACATGAAAATGTCCCCAAAGTAAAGGAGAGCAATATATGGAAGAAACTCAGCTTTGAGGAAGTTATTGCCAGCGCCATTTTAAACAACAAAATACCAGAGGCACAGACTTTCTTCAGGATTGATAGTCATTCTGCTCAAAAACTTGAGGAGCTTATTGGCATAGGCCTAAATTTGGTCTTTGACAATTTAAAAAAGAACAATATAAAGGAAGCCTCTGAACTTTTGAAGAATATGGGGTTTGATGTAAAAGGCCAATTGCTCAAGATCTGCTTCTATACAACTAATAAAAATATACGTGACTTTTTGGTTGAAATTTTAAAAGAAAAAAATTATTTTTCTGAAAAAGAGAAAAGAACTATAGACTTCGTGCATCAAGTTGAGAAGCTTTATTTGGGACATTTCCAAGAAAATATGCAAATCCAGTCATTTCCCAGGTACTGGATAAAGGAACAAGATTTTTTCAAGCACAAGTCTGTTTTGGACTCATTCCTGAAATATGATTGTAAAGATGAATTTAACAAACAGGACCATAGAATTGTGTTAAATTGGGCTCTGTGGTGGGATCAACTAACACAAGAATCCATCCTTCTCCCCAGGATAAGTCCAGAAGAATACAAATCATATTCCCCTGAAGCCCTCTGGAGATACCTCACAGCTCGCCATGATTGGTTAAACATTATCTTATGGATTGGAGAATTTCAAACCCAGCATAGTTATGCTTCACTTCAGCAGAACAAATGGCCCCTTCTGACTGTTGATGTTATTAACCAGAATACTTCCTGTAACAACTACATGAGGAATGAAATTTTAGATAAGCTGGCCAGGAATGGGGTTTTTTTGGCATCTGAACTGGAAGACTTTGAATGCTTCCTCCTAAGACTGAGCCGTATTGGAGGTGTAATACAGGATACCCTCCCTGTTCAAAACTACAAGACCAAAGAAGGTTGGGATTTCCATTCTCAATTCATTCTCTATTGTTTGGAGCACAGTCTGCAGCATCTTCTTTATGTCTACCTTGACTGTTACAAACTTAGTCCTGAAAATTGTCCCTTTTTGGAAAAAAAAGAGTTACATGAAGCACACCCTTGGTTTGAATTTTTAGTTCAGTGTCGACAAGTTGCCAGTAACTTAACAGATCCCAAACTGATCTTCCAGGCTAGCCTTGCAAATGCTCAGATTTTGATTCCCACCAATCAGGCCAGTGTAAGCAGTATGCTATTGGAAGGACATACCCTCCTGGCCCTTGCTACTACAATGTATTCTCCTGGGGGTGTCAGTCAGGTTGTTCAGAATGAAGAAAATGAAAACTGTTTGAAGAAAGTGGATCCCCAGCTATTGAAGATGGCATTAACTCCTTACCCCAAGCTAAAAACTGCTCTCTTCCCACAGTGCACTCCTCCTAGTGTCCTGCCATCTGATATTACAATCTACCACCTTATTCAGTCATTATCACCCTTTGATCCTAGCAGATTGTTTGGCTGGCAGTCTGCTAACACACTAGCTATAGGAGATGCATGGAGTCATCTCCCACATTTCTCTAGCCCTGACCTGGTTAATAAATATGCTATAGTGGAACGTCTGAATTTTGCTTATTATTTACATAATGGGCGGCCATCATTTGCATTTGGTACTTTTCTGGTCCAGGAATTAATCAAGAGCAAGACTCCCAAGCAGCTGATCCAGCAAGTAGGCAATGAAGCCTATGTTATAGGGCTCTCCTCCTTCCACATACCTTCAATAGGAGCTGCATGTGTTTGTTTCTTAGAATTGCTTGGCCTTGACAGCCTCAAGCTCAGAGTTGATATGAAAGTGGCCAATATAATTTTGAGCTACAAGTGCAGAAATGAAGATGCTCAGTACAGCTTTATCAGAGAGTCTGTAGCCGAAAAACTATCTAAACTAGCTGATGGTGAAAAGACAACCACAGAAGAATTGCTTGTTCTCTTAGAAGAAGGTACATGGAACAGCATTCAGCAACAGGAAATAAAGAGGTTATCCAGTGAATCTAGCAGCCAATGGGCATTAGTGGTGCAGTTCTGCAGGCTACACAATATGAAACTAAGCATATCTTACCTTAGAGAATGTGCCAAAGCAAATGATTGGCTGCAGTTCATTATTCACAGCCAACTCCACAACTACCACCCAGCAGAGGTGAAATCCCTTATCCAGTACTTCAGCCCAGTCATTCAAGACCACTTAAGGCTGGCTTTTGAGAACTTGCCCTCAGTGCCCACCTCCAAAATGGACAGCGATCAAGTCTGCAATAAGTGCCCCCAGGAACTTCAAGGAAGCAAACAAGAGATGACCGATTTATTTGAAATTCTGCTCCAATGCTCAGAGGAGCCAGACTCCTGGCACTGGCTTCTGGTTGAAGCAGTGAAACAACAGGCCCCTATCCTCAGTGTTCTGGCCTCATGTCTCCAGGGTGCCAGTGCCATTTCTTGTCTCTGTGTTTGGATCATCACTTCTGTGGAGGACAATGTTGCAACTGAAGCAATGGGACACATTCAGGACTCAACAGAGGACCATACCTGGAACCTTGAGGATCTTTCAGTCATCTGGAGAACATTATTAACAAGACAAAAGAGCAAAACTCTCATCAGAGGTTTCCAGCTTTTCTTTAAGGATTCCCCGTTACTACTGGTGATGGAGATGTATGAACTGTGTATGTTCTTCAGGAATTATAAAGAAGCTGAAGCTAAACTTCTGGAGTTTCAGAAGAGCCTTGAAACGCTTAACACAGCAGCCACAAAGGTCCACCCTGTCATCC?CTGCCATGTGGCTGGAGGATCAGGTGTGTTTCCTTTTGAAGCTTATGCTACAGCAGTGTAAGACCCAGTATGAGCTGGGGAAGCTTTTACAGCTCTTTGTTGAAAGAGAGCATCTCTTCTCTGATGGTCCAGATGTGAAAAAGCTTTGCATCCTTTGCCAGATTTTGAAGGATACATCCATAGCCATTAATCATACAATTATTACCAGCTACAGCATTGAGAATCTTCAGCATGAATGTAGATCTATTTTGGAAAGACTGCAGACAGATGGACAATTCGCTTTGGCCAGGAGGGTAGCAGAATTAGCTGAGTTACCTGTGGACAACTTGGTTATTAAAGAGATAACACAGGAAATGCAGACCCTAAAACACATTGAACAGTGGTCACTAAAACAAGCAAGAATTGACTTCTGGAAAAAATGCCATGAGAATTTTAAGAAAAATTCAATTTCAAGCAAAGCAGCTTCTTCCTTTTTCTCAACCCAGGCCCATGTGGCATGTGAGCACCCAACTGGATGGAGCAGCATGGAGGAGCGCCATCTGCTGCTCACCTTGGCAGGGCACTGGCTTGCCCAGGAGGACGTGGTGCCCTTGGATAAGCTGGAGGAGCTGGAGAAGCAGATCTGGCTGTGCCGCATCACCCAGCACACTCTTGGAAGAAATCAGGAGGAAACAGAGCCCAGATTTTCTCGACAGATCTCAACTAGTGGTGAACTTTCCTTTGATAGTTTAGCCAGTGAGTTTTCCTTCTCCAAGTTGGCTGCTCTGAACACATCAAAATACTTAGAACTTAACAGCCTTCCATCCAAAGAGACATGCGAGAATAGATTGGATTGGAAAGAGCAGGAGTCACTAAACTTTTTGATTGGGCGCCTACTGGATGATGGCTGTGTGCATGAAGCAAGTAGAGTATGCCGGTATTTTCATTTTTATAATCCAGATGTCGCCTTGGTATTGCACTGCAGAGCACTGGCCTCAGGGGAAGCTAGTATGGAGGATCTGCACCCAGAGATCCATGCTCTCCTACAAAGTGCTGAGCTGCTTGAGGAAGAAGCACCCGACATTCCCCTAAGGAGAGTCCACAGCACTTCAAGTCTGGATAGTCAGAAGTTTGTGACAGTGCCCTCCAGTAATGAAGTGGTAACTAACCTGGAAGTGCTGACAAGCAAATGCCTCCATGGGAAGAACTACTGTCGACAGGTCCTCTGTCTGTATGATCTTGCCAAGGAGTTGGGCTGTTCCTACACAGATGTTGCTGCTCAGGATGGTGAAGCCATGCTCCGGAAAATCTTGGCCTCTCAGCAGCCTGACCGATGCAAACGAGCCCAGGCCTTCATCAGCACACAGGGCCTTAAGCCAGATACTGTGGCTGAACTCGTGGCAGAAGAGGTGACACGGGAGCTGCTTACTTCATCACAGGGAACAGGACATAAGCAGATGTTCAACCCAACAGAGGAAAGCCAGACATTTCTTCAGCTGACCACTCTGTGTCAAGACCGCACATTGGTAGGCATGAAGTTGTTGGATAAGATTTCCTCCGTTCCCCATGGGGAACTGTCTTGCACCACAGAGCTCCTGATCCTGGCCCATCATTGCTTCACCCTGACGTGCCACATGGAGGGCATCATCCGAGTCCTACAGGCCGCCCACATGCTCACAGATAACCACCTGGCCCCCAGTGAGGAGTATGGGCTGGTGGTACGGCTCCTCACTGGCATTGGAAGGTACAACGAGATGACATACATATTTGATTTGCTGCATAAAAAGCACTACTTTGAAGTGCTAATGAGGAAGAAGTTGGATCCGAGTGGTACCCTGAAAACAGCCCTGCTGGACTACATCAAACGCTGCCGTCCTGGAGACAGTGAAAAGCACAATATGATTGCCCTGTGCTTCAGCATGTGCCGGGAGATTGGCGAGAACCACGAGGCAGCTGCCCGCATCCAACTGAAATTGATTGAGTCTCAGCCCTGGGAGGACAGCCTCAAGGATGGGCACCAGCTGAAACAACTGCTGCTGAAGGCCCTGACTCTGATGTTGGATGCAGCAGAGAGTTATGCCAAGGACTCCTGTGTGTGA(SEQ?ID?NO：5)，

The protein with p.Arg2286X sudden change of its coding has aminoacid sequence as follows (2285Aa):

MAAEEGVASAASAGGSWGTAAMGRVLPMLLVPVPAEAMGQLGSRAQLRTQPEALGSLTAAGSLQVLSLTPGSRGGGRCCLEGPFWHFLWEDSRNSSTPTEKPKLLALGENYELLIYEFNLKDGRCDATILYSCSREALQKLIDDQDISISLLSLRILSFHNNTSLLFINKCVILHIIFPERDAAIRVLNCFTLPLPAQAVDMIIDTQLCRGILFVLSSLGWIYIFDVVDGTYVAHVDLALHKEDMCNEQQQEPAKISSFTSLKVSQDLDVAVIVSSSNSAVALNLNLYFRQHPGHLLCERILEDLPIQGPKGVDEDDPVNSAYNMKLAKFSFQIDRSWKAQLSSLNETIKNSKLEVSCCAPWFQDILHLESPESGNHSTSVQSWAFIPQDIMHGQYNVLQKDHAKTSDPGRSWKIMHISEQEEPIELKCVSVTGFTALFTWEVERMGYTITLWDLETQGMQCFSLGTKCIPVDSSGDQQLCFVLTENGLSLILFGLTQEEFLNRLMIHGSASTVDTLCHLNGWGRCSIPIHALEAGIENRQLDTVNFFLKSKENLFNPSSKSSVSDQFDHLSSHLYLRNVEELIPALDLLCSAIRESYSEPQSKHFSEQLLNLTLSFLNNQIKELFIHTEELDEHLQKGVNILTSYINELRTFMIKFPWKLTDAIDEYDVHENVPKVKESNIWKKLSFEEVIASAILNNKIPEAQTFFRIDSHSAQKLEELIGIGLNLVFDNLKKNNIKEASELLKNMGFDVKGQLLKICFYTTNKNIRDFLVEILKEKNYF?SEKEKRTIDFVHQVEKLYLGHFQENMQIQ?SFPRYWIKEQDFFKHKSVLDSFLKYDCKDEFNKQDHRIVLNWALWWDQLTQESILLPRISPEEYKSYSPEALWRYLTARHDWLNIILWIGEFQTQHSYASLQQNKWPLLTVDVINQNTSCNNYMRNEILDKLARNGVFLASELEDFECFLLRLSRIGGVIQDTLPVQNYKTKEGWDFHSQFILYCLEHSLQHLLYVYLDCYKLSPENCPFLEKKELHEAHPWFEFLVQCRQVASNLTDPKLIFQASLANAQILIPTNQASVSSMLLEGHTLLALATTMYSPGGVSQVVQNEENENCLKKVDPQLLKMALTPYPKLKTALFPQCTPPSVLPSDITIYHLIQSLSPFDPSRLFGWQSANTLAIGDAWSHLPHFSSPDLVNKYAIVERLNFAYYLHNGRPSFAFGTFLVQELIKSKTPKQLIQQVGNEAYVIGLSSFHIPSIGAACVCFLELLGLDSLKLRVDMKVANIILSYKCRNEDAQYSFIRESVAEKLSKLADGEKTTTEELLVLLEEGTWNSIQQQEIKRLSSESSSQWALVVQFCRLHNMKLSISYLRECAKANDWLQFIIHSQLHNYHPAEVKSLIQYFSPVIQDHLRLAFENLPSVPTSKMDSDQVCNKCPQELQGSKQEMTDLFEILLQCSEEPDSWHWLLVEAVKQQAPILSVLASCLQGASAISCLCVWIITSVEDNVATEAMGHIQDSTEDHTWNLEDLSVIWRTLLTRQKSKTLIRGFQLFFKDSPLLLVMEMYELCMFFRNYKEAEAKLLEFQKSLETLNTAATKVHPVIPAMWLEDQVCFLLKLMLQQCKTQYELGKLLQLFVEREHLFSDGPDVKKLCILCQILKDTSIAINHTIITSYSIENLQHECRSILERLQTDGQFALARRVAELAELPVDNLVIKEITQEMQTLKHIEQWSLKQARIDFWKKCHENFKKNSISSKAASSFFSTQAHVACEHPTGWSSMEERHLLLTLAGHWLAQEDVVPLDKLEELEKQIWLCRITQHTLGRNQEETEPRFSRQISTSGELSFDSLASEFSFSKLAALNTSKYLELNSLPSKETCENRLDWKEQESLNFLIGRLLDDGCVHEASRVCRYFHFYNPDVALVLHCRALASGEASMEDLHPEIHALLQSAELLEEEAPDIPLRRVHSTSSLDSQKFVTVPSSNEVVTNLEVLTSKCLHGKNYCRQVLCLYDLAKELGCSYTDVAAQDGEAMLRKILASQQPDRCKRAQAFISTQGLKPDTVAELVAEEVTRELLTSSQGTGHKQMFNPTEESQTFLQLTTLCQDRTLVGMKLLDKISSVPHGELSCTTELLILAHHCFTLTCHMEGIIRVLQAAHMLTDNHLAPSEEYGLVVRLLTGIGRYNEMTYIFDLLHKKHYFEVLMRKKLDPSGTLKTALLDYIKRCRPGDSEKHNMIALCFSMCREIGENHEAAARIQLKLIESQPWEDSLKDGHQLKQLLLKALTLMLDAAESYAKDSCV(SEQ?ID?NO：6)。

The SPGll gene mutation body that contriver finds is compared with SEQ ID NO:1, have and be selected from c.C6856T and at least one sudden change c.2863delG, with respect to wild-type SPG11 gene, the C of the 6856th of the cDNA of SPG11 gene mutation body of the present invention sports T, and/or the G of the 2863rd disappearance.Thus, its coded product is compared with wild-type SPG11 albumen (SEQ ID NO:2), has at least one sudden change that is selected from p.Arg2286X and p.Glu955Lysfs*7.Wherein, it should be noted that, the 2862nd and 2863 bit bases of SPG11 gene cDNA are all G, therefore, " c.2863delG " sudden change of SPG11 gene mutation body both can represent the 2863rd bit base G disappearance, also can represent the 2862nd bit base G disappearance, thereby in the present invention, c.2863delG can represent c.2863delG or c.2862delG.In addition, in " p.Arg2286X ", X represents translation termination, and because c.C6856T sudden change occurs for the cDNA of SPG11 gene mutation body, the codon mutation of the Arg that causes encoding is terminator codon, translation premature termination, and mutant protein is 2285 amino acid.In the aminoacid sequence of " p.Glu955Lysfs*7 " expression SPG11 mutant, the 955th amino acids Glu sports Lys, ends at the 7th amino acids of counting since 955, and mutant protein is 961 amino acid.

Further, contriver's discovery, when occurring c.C6856T simultaneously and c.2863delG suddenly change in SPG11 gene mutation body, the efficiency of the autosomal recessive inheritance type hereditary spastic paraplegia susceptibility of detection of biological sample is higher.Whether the SPG11 gene mutation body by detection with 2 mutational sites exists in biological sample, can predict accurately and effectively whether organism easily suffers from autosomal recessive inheritance type hereditary spastic paraplegia.

It should be noted that, the c.C6856T of the SPG11 gene not yet proposing relevant for the present invention at present and c.2863delG sudden change cause the report of AR-HSP.

According to a second aspect of the invention, the present invention proposes a kind of isolated polypeptide.According to embodiments of the invention, to compare with SEQID NO:2, this isolated polypeptide has at least one sudden change that is selected from p.Arg2286X and p.Glu955Lys^*7.According to concrete examples more of the present invention, this polypeptide is to be encoded by the nucleic acid of the coding SPG11 mutant of aforementioned separation (being SPG11 gene mutation body).By whether expressing this polypeptide in detection of biological sample, whether detection of biological sample easily suffers from autosomal recessive inheritance type hereditary spastic paraplegia effectively, also can in organism, whether exist by detecting these polypeptide, can effectively predict whether organism easily suffers from autosomal recessive inheritance type hereditary spastic paraplegia.

The method of the biological sample of autosomal recessive inheritance type hereditary spastic paraplegia is easily suffered from screening

According to a third aspect of the invention we, the present invention proposes a kind of method of screening the biological sample of easy trouble autosomal recessive inheritance type hereditary spastic paraplegia.According to embodiments of the invention, the method that the biological sample of autosomal recessive inheritance type hereditary spastic paraplegia is easily suffered from this screening can comprise the following steps:

First, from extraction from biological material sample of nucleic acid.According to embodiments of the invention, the type of biological sample is also not particularly limited, as long as can extract the sample of nucleic acid whether reflection biological sample SPG11 exists sudden change from this biological sample.According to embodiments of the invention, biological sample can for be selected from blood of human body, skin, hypodermic at least one.Thus, can sample easily and detect, thereby can further improve the efficiency that the biological sample of autosomal recessive inheritance type hereditary spastic paraplegia is easily suffered from screening.According to embodiments of the invention, here the term that used " sample of nucleic acid " should be interpreted broadly, it can be anyly can reflect whether SPG11 in biological sample exists the sample of sudden change, it can be for example the complete genome DNA directly extracting from biological sample, also can be a part that comprises SPG11 encoding sequence in this full genome, can be the total RNA extracting from biological sample, can be also the mRNA extracting from biological sample.According to one embodiment of present invention, described sample of nucleic acid is complete genome DNA.Thus, can expand the source range that comes of biological sample, and can to the much information of biological sample, determine simultaneously, thereby can improve the efficiency that the biological sample of autosomal recessive inheritance type hereditary spastic paraplegia is easily suffered from screening.In addition, according to embodiments of the invention, for adopting RNA as sample of nucleic acid, from extraction from biological material sample of nucleic acid, may further include: from extraction from biological material RNA sample, preferably RNA sample is mRNA; And based on resulting RNA sample, by reverse transcription reaction, obtain cDNA sample, resulting cDNA composition of sample sample of nucleic acid.Thus, can further improve and utilize RNA as sample of nucleic acid screening, easily to suffer from the efficiency of the biological sample of autosomal recessive inheritance type hereditary spastic paraplegia.

Next, after obtaining sample of nucleic acid, can analyze sample of nucleic acid, thereby can determine the nucleotide sequence of resulting sample of nucleic acid.According to embodiments of the invention, determine resulting sample of nucleic acid nucleotide sequence method and apparatus and be not particularly limited.According to a particular embodiment of the invention, can pass through sequence measurement, the nucleotide sequence of definite kernel acid sample.According to embodiments of the invention, can and be not particularly limited for the method and apparatus that checks order.According to embodiments of the invention, can adopt s-generation sequencing technologies, also can adopt the third generation and the 4th generation or more advanced sequencing technologies.According to concrete example of the present invention, can utilize be selected from Hiseq2000, SOLiD, 454 and at least one of single-molecule sequencing device nucleotide sequence is checked order.Thus, in conjunction with up-to-date sequencing technologies, for Single locus, can reach the higher order-checking degree of depth, detection sensitivity and accuracy improve greatly, thereby can utilize the high-throughput of these sequencing devices, the feature of degree of depth order-checking, further improve sample of nucleic acid is detected to the efficiency of analyzing.Thereby, can improve follow-up accuracy and accuracy when sequencing data is analyzed.Thus, according to embodiments of the invention, the nucleotide sequence of definite kernel acid sample may further include: first, for resulting sample of nucleic acid, build nucleic acid sequencing library; And checked order in resulting nucleic acid sequencing library, to obtain the sequencing result being formed by a plurality of sequencing datas.According to some embodiments of the present invention, can adopt be selected from Hiseq2000, SOLiD, 454 and at least one of single-molecule sequencing device checked order in resulting nucleic acid sequencing library.In addition, according to embodiments of the invention, can screen sample of nucleic acid, enrichment SPG11 exon, this screening enrichment can build in sequencing library process before building sequencing library, or carried out after building sequencing library.According to one embodiment of present invention, for sample of nucleic acid, build nucleic acid sequencing library and further comprise: utilize SPG11 gene extron Auele Specific Primer, sample of nucleic acid is carried out to pcr amplification; And for resulting amplified production, build nucleic acid sequencing library.Thus, can pass through pcr amplification, enrichment SPG11 exon, thus can further improve the efficiency that the biological sample of autosomal recessive inheritance type hereditary spastic paraplegia is easily suffered from screening.According to embodiments of the invention, the sequence of SPG11 gene extron Auele Specific Primer is not particularly limited, and according to a preferred embodiment of the invention, these SPG11 gene extron Auele Specific Primers have the nucleotide sequence shown in SEQID NO:7-10.

Contriver is surprised to find, and by adopting these primers, can in PCR reaction system, significantly effectively complete SPG11 exon especially c.C6856T and the c.2863delC amplification of the exon sequence at place.It should be noted that, the nucleotide sequence shown in these SEQ ID NO:7-10 be the present inventor after having paid arduous labor, unexpected obtain.

About for sample of nucleic acid, build method and the flow process of sequencing library, those skilled in the art can suitably select according to different sequencing technologies, details about flow process, can be referring to manufacturer's rules that for example Illumina company provides of order-checking instrument, for example, referring to the Multiplexing Sample Preparation Guide (Part#1005361 of Illumina company; Feb 2010) or Paired-End SamplePrep Guide (Part#1005063; Feb 2010), by reference, be incorporated to herein.According to embodiments of the invention, the method and apparatus from extraction from biological material sample of nucleic acid, is also not particularly limited, and can adopt commercial nucleic acid extraction kit to carry out.

It should be noted that, broad understanding should be made in the term that here used " nucleotide sequence ", it can be after the sequencing data that obtains that sample of nucleic acid is checked order is assembled, the complete nucleic acid sequence information obtaining, also can be directly to adopt by resulting sequencing data (reads) that sample of nucleic acid is checked order as nucleotide sequence, as long as the encoding sequence that contains corresponding SPG11 in these nucleotide sequences.

Finally, after the nucleotide sequence of definite kernel acid sample, the sequence of the nucleotide sequence of resulting sample of nucleic acid and SEQ ID NO:1 is compared.If had in resulting nucleotide sequence, be selected from c.C6856T and at least one sudden change c.2863delC, indicator organism sample is easily suffered from autosomal recessive inheritance type hereditary spastic paraplegia.Thus, by easily suffer from the method for the biological sample of autosomal recessive inheritance type hereditary spastic paraplegia according to the screening of the embodiment of the present invention, can effectively screen the biological sample of easy trouble autosomal recessive inheritance type hereditary spastic paraplegia.According to embodiments of the invention, the method and apparatus that nucleotide sequence and SEQ ID NO:1 are compared is also not particularly limited, and can adopt the software of any conventional to operate, and according to specific examples of the present invention, can adopt SOAP software to compare.

It should be noted that, according to the purposes of " method of the biological sample of autosomal recessive inheritance type hereditary spastic paraplegia is easily suffered from screening " of the embodiment of the present invention, be not particularly limited, for example can be as the screening method of non-diagnostic purpose.

System and the test kit of the biological sample of autosomal recessive inheritance type hereditary spastic paraplegia easily suffered from screening

According to a forth aspect of the invention, the present invention proposes and a kind ofly can effectively implement the system of method that the biological sample of autosomal recessive inheritance type hereditary spastic paraplegia is easily suffered from above-mentioned screening.

With reference to figure 1, according to embodiments of the invention, the system 1000 that the biological sample of autosomal recessive inheritance type hereditary spastic paraplegia is easily suffered from this screening comprises: nucleic acid-extracting apparatus 100, nucleotide sequence determining device 200 and judgment means 300.

According to embodiments of the invention, nucleic acid-extracting apparatus 100 is for from extraction from biological material sample of nucleic acid.As previously mentioned, according to embodiments of the invention, the type of sample of nucleic acid is also not particularly limited, and for adopting RNA as sample of nucleic acid, nucleic acid-extracting apparatus further comprises RNA extraction unit 101 and reverse transcription unit 102, wherein, extraction unit 101 is for from extraction from biological material RNA sample, and reverse transcription unit 102 is connected with RNA extraction unit 101, for RNA sample is carried out to reverse transcription reaction, to obtain cDNA sample, resulting cDNA composition of sample sample of nucleic acid.

According to embodiments of the invention, nucleotide sequence determining device 200 is connected with nucleic acid-extracting apparatus 100, for sample of nucleic acid is analyzed, so that the nucleotide sequence of definite kernel acid sample.As previously shown, can adopt the nucleotide sequence of the method definite kernel acid sample of order-checking.Thus, according to one embodiment of present invention, described nucleotide sequence determining device 200 may further include: library construction unit 201 and order-checking unit 202.Library construction unit 201, for for sample of nucleic acid, builds nucleic acid sequencing library; Order-checking unit 202 is connected with library construction unit 201, for being checked order in nucleic acid sequencing library, to obtain the sequencing result consisting of a plurality of sequencing datas.As previously mentioned, can pass through pcr amplification, enrichment SPG11 exon, further improves the efficiency that the biological sample of autosomal recessive inheritance type hereditary spastic paraplegia is easily suffered from screening.Thus, library construction unit 201 may further include pcr amplification module (not shown), in this pcr amplification module, be provided with SPG11 gene extron Auele Specific Primer, to utilize SPG11 gene extron Auele Specific Primer, described sample of nucleic acid is carried out to pcr amplification, according to a particular embodiment of the invention, SPG11 gene extron Auele Specific Primer has the nucleotide sequence as shown in SEQ ID NO:7-10.According to embodiments of the invention, order-checking unit 202 can comprise and is selected from Hiseq2000, SOLiD, 454 and at least one of single-molecule sequencing device.Thus, in conjunction with up-to-date sequencing technologies, for Single locus, can reach the higher order-checking degree of depth, detection sensitivity and accuracy improve greatly, thereby can utilize the high-throughput of these sequencing devices, the feature of degree of depth order-checking, further improve sample of nucleic acid is detected to the efficiency of analyzing.Thereby, improve follow-up accuracy and accuracy when sequencing data is analyzed.

According to embodiments of the invention, judgment means 300 is connected with nucleotide sequence determining device 200, be suitable for the nucleotide sequence of sample of nucleic acid to compare, so that the difference of the nucleotide sequence based on sample of nucleic acid and SEQ ID NO:1 judges whether biological sample easily suffers from autosomal recessive inheritance type hereditary spastic paraplegia.Whether particularly, the nucleotide sequence based on sample of nucleic acid is compared with SEQ IDNO:1, have and be selected from c.C6856T and at least one sudden change c.2863delG, judges whether biological sample easily suffers from autosomal recessive inheritance type hereditary spastic paraplegia.As previously mentioned, according to one embodiment of present invention, the nucleotide sequence of sample of nucleic acid is compared with SEQ ID NO:1, and have and be selected from c.C6856T and at least one sudden change c.2863delG, be the indication that biological sample is easily suffered from autosomal recessive inheritance type hereditary spastic paraplegia.As previously mentioned, according to embodiments of the invention, the equipment that nucleotide sequence and SEQ ID NO:1 are compared is also not particularly limited, and can adopt the software of any conventional to operate, and according to specific examples of the present invention, can adopt SOAP software to compare.

Thus, utilize this system, can effectively implement aforementioned screening and easily suffer from the method for the biological sample of autosomal recessive inheritance type hereditary spastic paraplegia, thereby can effectively screen the biological sample of easy trouble autosomal recessive inheritance type hereditary spastic paraplegia.

According to a fifth aspect of the invention, the present invention proposes a kind of for screening the test kit of the biological sample of easy trouble autosomal recessive inheritance type hereditary spastic paraplegia.According to embodiments of the invention, should comprise for screening the test kit of the biological sample of easy trouble autosomal recessive inheritance type hereditary spastic paraplegia: the reagent that is suitable for detecting SPG11 gene mutation body, wherein compare with SEQ ID NO:1, this SPG11 gene mutation body has and is selected from c.C6856T and at least one sudden change c.2863delG.Utilize test kit according to an embodiment of the invention, can effectively screen the biological sample of easy trouble autosomal recessive inheritance type hereditary spastic paraplegia.In this article, the term using " is suitable for detecting the reagent of SPG11 gene mutation body " and should be interpreted broadly, can be the reagent that detects SPG11 encoding gene, can be also the reagent that detects SPG11 mutant, for example, can adopt the antibody in identification specificity site.According to one embodiment of present invention, described reagent is nucleic acid probe, thus, can screen efficiently the biological sample of easy trouble autosomal recessive inheritance type hereditary spastic paraplegia.According to another embodiment of the invention, test kit of the present invention comprises the SPG11 gene extron Auele Specific Primer with nucleotide sequence as shown in SEQ ID NO:7-10.Thus, utilize test kit of the present invention can screen accurately, quickly and efficiently the biological sample of easily suffering from autosomal recessive inheritance type hereditary spastic paraplegia.

It should be noted that, feature and advantage before herein described in the method part of the biological sample of the easy trouble of screening autosomal recessive inheritance type hereditary spastic paraplegia, the system or the test kit that are equally applicable to screen the biological sample of easy trouble autosomal recessive inheritance type hereditary spastic paraplegia, do not repeat them here.

In addition, it will be understood by those skilled in the art that the term " nucleotide sequence " that used in this article, actual any of comprising complementary two strands, or two.For convenience, in the present specification and claims, in most cases only provide a chain, but in fact also disclose another chain of complementation with it.Particularly, for example, the phraseology used in this article " nucleotide sequence of sample of nucleic acid is compared with SEQ ID NO:1; have and be selected from c.C6856T and at least one sudden change is c.2863delG the indication that described biological sample is easily suffered from autosomal recessive inheritance type hereditary spastic paraplegia ", wherein said " nucleotide sequence of sample of nucleic acid " comprises its complementary sequence.Those skilled in the art are further appreciated that and utilize a chain can detect another chain with its complementation, and vice versa.And in this article, " nucleotide sequence " comprises DNA form or rna form, open wherein a kind of sequence of form, means that the sequence of another kind of form is also disclosed.For example, disclose the cDNA sequence of SPG11 gene, reality also discloses its corresponding RNA sequence.

Below with reference to specific embodiment, the present invention will be described, it should be noted that, these embodiment are only illustrative, and can not be interpreted as limitation of the present invention.

If do not specialize, the conventional means that the technique means adopting in embodiment is well known to those skilled in the art, can carry out with reference to the < < molecular cloning experiment guide > > third edition or related products, the reagent adopting and product are also and can business obtain.Various processes and the method do not described in detail are ordinary methods as known in the art, the source of agents useful for same, trade(brand)name and be necessary to list its moiety person, all when occurring first, indicate, identical reagent used is if no special instructions, all identical with the content of indicating first thereafter.

Embodiment 1 is complete, and Disease-causing gene and mutational site are determined in the order-checking of exon group

1, sample collection:

Contriver collects an AR-HSP family with 3 patients, its pedigree chart as shown in Figure 2: non-consanguineous mating ，10Ming family member, patient's onset symptoms is two weakness of the lower extremities, frequently falls, abnormal gait while walking; Clinical except visible two lower limb spastic paralysiss, deep sensory go down, urine obstacle, myatrophy, still there are epileptic seizures, intelligence to decline and the performance such as peripheral neuropathy.

Wherein, as shown in Figure 2, zero represents normal female; represents normal male; ■ represents male patient; ● represent female patient.

2, Disease-causing gene and mutational site are determined in full exon group order-checking

Contriver utilizes NimbleGen SeqCap EZ Human Exome Library v2.0, in conjunction with Illumina Hiseq 2000 high throughput sequencing technologies, 3 patients (II 2, II 4, II 6) and father and mother (I 2, I 3) thereof have been carried out to the order-checking of exon group, and concrete steps are as follows:

2.1 sample preparation

Gather respectively above-mentioned 3 patients and father and mother's thereof peripheral blood, then utilize QIAmp Blood kit (Qiagen, Hilden, Germany) genomic dna in extracting peripheral blood leucocyte, and utilize Qubit Fluorometer and agarose gel electrophoresis to measure concentration and the purity of DNA, the OD260/OD280 of each sample genomic dna of gained is all between 1.7-2.0, and concentration is no less than 50ng/ μ l, and total amount is no less than 3 μ g.

2.2 library constructions and order-checking

Utilize ultrasonoscope (CovarisS2, Massachusetts, USA) each genomic dna sample is broken at random to the fragment of 250-300bp left and right, the process specifications providing according to manufacturers subsequently, at fragment two ends, connect respectively top connection and prepare library (can be referring to: the Illumina/Solexa standard that http://www.illumina.com/ provides is built storehouse specification sheets, by with reference to it is incorporated to herein in full).Linear amplification and SureSelect Biotiny lated RNA Library (BAITS) hybridizing reagent through Ligation-mediated PCR (LM-PCR) after library is purified are hybridized enrichment, pass through again the linear amplification of LM-PCR, the order-checking that is available on the machine after library detection is qualified, to obtain primitive sequencer data.Wherein, with reference to the cluster of Illumina standard and the protocol of order-checking, check order, order-checking platform is Illumina Hiseq 2000, and reading length is 90bp, the average order-checking degree of depth of sample is 100 *.

2.3 variation detection, annotation and database comparisons

Utilize the primitive sequencer data of 1.7 pairs of above-mentioned acquisitions of Illumina basecalling Software to process, after filtration depollutes, use the SOAPaligner/SOAP2 (can be referring to: Li R, Li Y, Kristiansen K, et al, SOAP:shortoligonucleotide alignment program.Bioinformatics 2008,24 (5): 713-714; Li R, Yu C, Li Y, ea al, SOAP2:an improved ultrafast tool for short read alignment.Bioinformatics 2009,25 (15): 1966-1967., is incorporated to it herein in full by reference) comparison is arrived with reference to genome, to obtain unique aligned sequences of comparing on genome.Then utilize the SOAPsnp (can be referring to: Li R, Li Y, Fang X, Yang H, et al, SNPdetection for massively parallel whole-genome resequencing.Genome Res 2009,19 (6): 1124-1132., by with reference to it is incorporated to herein in full) determine the genotype of target region.

As a result, contriver finds respectively 92244,92471,91773 single nucleotide polymorphism (SNPs) and 6975,6637,6802 place's insertion/deletions in case II 2, II 4, II 6; In the father I 2 of these three cases, find 94519 single nucleotide polymorphism (SNPs) and 6933 place's insertion/deletions, in mother I 3, find 105050 single nucleotide polymorphism (SNPs) and 7341 place's insertion/deletions.By the filtration of the public databases such as dbSNP database (http://www.ncbi.nlm.nih.gov/projects/SNP/snp_summary.cgi), thousand human genome databases (www.1000genomes.org/), HapMap Project database (http://hapmap.ncbi.nlm.nih.gov/), Yan Di and Huang Di, two legendary rulers of remote antiquity's database (http://yh.genomics.org.cn/), remove all known variations subsequently.Then, utilize SIFT software to carry out SNP function prediction, and in conjunction with genetics law, selecting a certain site of father on a certain gene is heterozygous mutant, mother another site on this gene is heterozygous mutant, and three children each site on these two allelotrope has respectively the site with father, heterozygous mutant that mother is identical.Finally, contriver obtains 57 candidate mutational sites, and wherein only having SPG11 gene is the gene relevant to AR-HSP of reporting before, and therefore, contriver thinks that this family disease is very likely also because SPG11 sudden change causes.Particularly, in candidate mutational site, on SPG11 gene, sport c.C6856T (p.Arg2286X) and the compound heterozygous mutations of (p.Glu955Lysfs*7) (be SPG11 gene respectively have a different heterozygous mutant) on two homologous chromosomess of patient c.2863delG.

Because SPG11 gene compound heterozygous mutations obtained above is the mutation type that SPG11 gene is new, and there is false positive to a certain degree in the order-checking of exon group, therefore, next, contriver utilizes again Sanger sequence measurement, to thering is the compound heterozygosis site of pathogenic meaning in mutational site obtained above, in 10 members of family, carried out verifying (pedigree chart mark as shown in Figure 2), got rid of false positive, confirm the c.C6856T (p.Arg2286X) of SPG11 gene and c.2863delG distribution in family of the compound heterozygous mutations of (p.Glu955Lysfs*7) and phenotype be divided into from, because this compound heterozygous mutations has caused AR-HSP.In addition, in existing database example dbSNP described above, thousand human genomes, Yan Di and Huang Di, two legendary rulers of remote antiquity and Hapmap database, all do not find said mutation site.

Therefore, in sum, contriver think c.C6856T on the SPG11 gene that the present invention finds and c.2863delG sudden change be the new pathogenic mutation site of AR-HSP.

Embodiment 2Sanger method sequence verification (the inside and outside sample checking of family situation)

Sample: the 10Ming family member in the family shown in Fig. 2, comprise 3 patient II2, II4, II6, and normal people's (i.e. this 3 routine patient's father and mother I2, I3 and other persons related by blood I1, I4, II 5, III1 and III2, all not morbidity) in 7 familys.

Respectively normal people in 3 patients and 7 familys is detected, for the c.C6856T (p.Arg2286X) of SPG11 gene and the primers at the place, compound heterozygous mutations site of (p.Glu955Lysfs*7) c.2863delG, method by pcr amplification, product purification, order-checking obtains the relevant sequence of SPG11 gene, and according to sequencing result, belong to saltant type or wild-type, the dependency between checking SPG11 and AR-HSP.Concrete grammar step is as follows:

1, DNA extraction:

Gather the peripheral blood of above-mentioned 10Ming family member, utilize the genomic dna in conventional phenol-chloroform method extracting peripheral blood leucocyte, and utilize concentration and the purity of spectrophotometer measurement DNA, the OD260/OD280 of each sample genomic dna of gained is all between 1.7-2.0, concentration is no less than 200ng/ μ l, and total amount is no less than 30 μ g.

2, design of primers and PCR reaction

Reference men and women's genoid data unit sequence storehouse GRCh37/hg19, the sequences Design SPG11 gene extron Auele Specific Primer for the c.C6856T of SPG11 gene and place, compound heterozygous mutations site c.2863delG, specifically sees the following form.

A) primer sequence:

B) then, configure respectively according to the following ratio the PCR reaction system of each genomic dna sample:

Reaction system: 50 μ l

C) then, each PCR reaction system is carried out respectively to PCR reaction according to following reaction conditions:

Reaction conditions:

Thus, obtain the pcr amplification product of normal people in patient and family.

3, order-checking

The pcr amplification product available from normal people in 3 routine patients, 7 familys obtaining in step 2 is directly carried out to DNA sequencing.

Normal people's SPG11 gene c.C6856T and the c.2863delG Sanger sequence verification result demonstration in mutational site in 3 routine patients and 7 familys, patient II2, II4, II6 all have c.C6856T and compound heterozygous mutations c.2863delG, the normal member of phenotype is except I4 is normal people, all the other are carrier, and I3, II5, III2 only have c.C6856T sudden change; I1, I2, III1 only have c.2863delG sudden change.Wherein, partial results is as follows:

Table 1 has shown the Sanger sequence verification result of patient II2, II4, II6, and as shown in table 1, patient II2, II4, II6 all have c.6856C > T and c.2863delC compound heterozygous mutations;

Fig. 3 has shown the Sanger sequence verification peak figure of the SPG11 gene mutation site of patient II 2, wherein, A is c.C6856T mutational site Sanger sequence verification peak figure, B is mutational site Sanger sequence verification peak figure c.2863delG, as shown in Figure 3, patient II 2 has c.C6856T and c.2863delG sudden change simultaneously;

Fig. 4 has shown the Sanger sequence verification peak figure of the SPG11 gene mutation site of normal people I 3 in family, wherein, A is c.C6856T mutational site Sanger sequence verification peak figure, B is mutational site Sanger sequence verification peak figure c.2863delG, as shown in Figure 4, I3 only has c.C6856T sudden change, is carrier;

Fig. 5 has shown the Sanger sequence verification peak figure of the SPG11 gene mutation site of normal people I2 in family, wherein, A is c.C6856T mutational site Sanger sequence verification peak figure, B is mutational site Sanger sequence verification peak figure c.2863delG, as shown in Figure 5, I2 only has c.2863delG sudden change, is carrier;

Fig. 6 has shown the Sanger sequence verification peak figure of the SPG11 gene mutation site of normal people I4 in family, wherein, A is c.C6856T mutational site Sanger sequence verification peak figure, B is mutational site Sanger sequence verification peak figure c.2863delG, as shown in Figure 6, I4 does not have aforementioned sudden change, is normal people.

Table 1

To sum up, to patient and family member thereof carry out the c.C6856T of SPG11 gene and c.2863delG mutational site investigation find: patient II2, II4, II6 all have c.C6856T and compound heterozygous mutations c.2863delG, the normal member of phenotype is except I4 is normal people, all the other are carrier, and I3, II5, III2 only have c.C6856T sudden change; I1, I2, III1 only have c.2863delG sudden change, further confirm the c.C6856T of SPG11 gene and c.2863delG the distribution of compound heterozygous mutations in family and phenotype be divided into from, and all do not find said mutation site in the routine dbSNP described above of existing database, thousand human genomes, Yan Di and Huang Di, two legendary rulers of remote antiquity and Hapmap database.Thus, further having verified, confirmed the c.C6856T of SPG11 gene and c.2863delG having suddenlyd change is the new pathogenic mutation of autosomal recessive inheritance type hereditary spastic paraplegia.

Further, to 100 familys, outer normal people carries out SPG11 gene sequencing, c.C6856T and c.2863delG sudden change all do not detected.Thus, the c.C6856T of SPG11 gene and compound heterozygous mutations pathogenic have c.2863delG further been confirmed.

Embodiment 3 detection kit

Prepare a detection kit, it comprises can detect the primer with the SPG11 gene mutation body that is selected from c.C6856T and at least one sudden change c.2863delG, for screening the biological sample of easy trouble autosomal recessive inheritance type hereditary spastic paraplegia, wherein these primers are SPG11 gene extron Auele Specific Primer, and its sequence is as described in example 1 above shown in SEQ ID NO:7-10.

The concrete steps of utilizing the screening of mentioned reagent box easily to suffer from the biological sample of autosomal recessive inheritance type hereditary spastic paraplegia are: according to the method described in the step 1 of embodiment 2, extract person DNA to be measured, the DNA that extracted of take carries out PCR as template with the exon Auele Specific Primer of above-mentioned SPG11 gene and reacts, and according to this area ordinary method to PCR product purification, the product of purifying is checked order, then by the observation resulting sequence that checks order, whether have and be selected from c.C6856T and at least one sudden change c.2863delG, whether can effectively detect SPG11 gene mutation body of the present invention exists in person DNA to be measured, thereby can effectively detect person to be measured and whether easily suffer from autosomal recessive inheritance type hereditary spastic paraplegia, further, can from person to be measured, filter out the biological sample of easy trouble autosomal recessive inheritance type hereditary spastic paraplegia.

In the description of this specification sheets, the description of reference term " embodiment ", " some embodiment ", " example ", " concrete example " or " some examples " etc. means to be contained at least one embodiment of the present invention or example in conjunction with specific features, structure, material or the feature of this embodiment or example description.In this manual, the schematic statement of above-mentioned term is not necessarily referred to identical embodiment or example.And the specific features of description, structure, material or feature can be with suitable mode combinations in any one or more embodiment or example.

Although illustrated and described embodiments of the invention, those having ordinary skill in the art will appreciate that: in the situation that not departing from principle of the present invention and aim, can carry out multiple variation, modification, replacement and modification to these embodiment, scope of the present invention is limited by claim and equivalent thereof.

Claims (10)

1. a nucleic acid for separated coding SPG11 mutant, is characterized in that, compare with SEQ ID NO:1, described nucleic acid have be selected from c.C6856T and c.2863delG at least one sudden change,

Optionally, described nucleic acid is DNA.

2. an isolated polypeptide, is characterized in that, compares with SEQ ID NO:2, and described isolated polypeptide has at least one sudden change that is selected from p.Arg2286X and p.Glu955Lysfs*7,

Optionally, described polypeptide is by nucleic acid encoding claimed in claim 1.

3. a method for the biological sample of autosomal recessive inheritance type hereditary spastic paraplegia is easily suffered from screening, it is characterized in that, comprises the following steps:

From described extraction from biological material sample of nucleic acid;

Determine the nucleotide sequence of described sample of nucleic acid;

The nucleotide sequence of described sample of nucleic acid is compared with SEQ ID NO:1, has to be selected from c.C6856T and at least one sudden change is c.2863delG the indication that described biological sample is easily suffered from autosomal recessive inheritance type hereditary spastic paraplegia,

Optionally, described biological sample is to be selected from least one of blood of human body, skin, hair and muscle,

Optionally, described sample of nucleic acid is complete genome DNA.

4. method according to claim 3, is characterized in that, from described extraction from biological material sample of nucleic acid, further comprises:

From described extraction from biological material RNA sample, preferred described RNA sample is mRNA; And

Based on described RNA sample, by reverse transcription reaction, obtain cDNA sample, sample of nucleic acid described in described cDNA composition of sample.

5. method according to claim 3, is characterized in that, determines that the nucleotide sequence of described sample of nucleic acid further comprises:

For described sample of nucleic acid, build nucleic acid sequencing library; And

Checked order in described nucleic acid sequencing library, to obtain the sequencing result formed by a plurality of sequencing datas, optionally, adopt be selected from Hiseq2000, SOLiD, 454 and at least one of single-molecule sequencing device checked order in described nucleic acid sequencing library,

Optionally, for described sample of nucleic acid, build nucleic acid sequencing library and further comprise:

Utilize SPG11 gene extron Auele Specific Primer, described sample of nucleic acid is carried out to pcr amplification; And

For resulting amplified production, build described nucleic acid sequencing library,

Optionally, described SPG11 gene extron Auele Specific Primer has the nucleotide sequence as shown in SEQ ID NO:7-10.

6. a system for the biological sample of autosomal recessive inheritance type hereditary spastic paraplegia is easily suffered from screening, it is characterized in that, comprising:

Nucleic acid-extracting apparatus, described nucleic acid-extracting apparatus is used for from described extraction from biological material sample of nucleic acid;

Nucleotide sequence determining device, described nucleotide sequence determining device is connected with described nucleic acid-extracting apparatus, for described sample of nucleic acid is analyzed, to determine the nucleotide sequence of described sample of nucleic acid;

Judgment means, described judgment means is connected with described nucleotide sequence determining device, so that the nucleotide sequence based on described sample of nucleic acid is compared with SEQ ID NO:1, whether have and be selected from c.C6856T and at least one sudden change c.2863delG, judge whether described biological sample easily suffers from autosomal recessive inheritance type hereditary spastic paraplegia.

7. system according to claim 6, is characterized in that, described nucleic acid-extracting apparatus further comprises:

RNA extraction unit, described RNA extraction unit is used for from described extraction from biological material RNA sample; And

Reverse transcription unit, described reverse transcription unit is connected with described RNA extraction unit, for described RNA sample is carried out to reverse transcription reaction, to obtain cDNA sample, sample of nucleic acid described in described cDNA composition of sample.

8. system according to claim 6, is characterized in that, described nucleotide sequence determining device further comprises:

Library construction unit, described library construction unit, for for described sample of nucleic acid, builds nucleic acid sequencing library; And

Order-checking unit, described order-checking unit is connected with described library construction unit, for being checked order in described nucleic acid sequencing library, to obtain the sequencing result being formed by a plurality of sequencing datas,

Optionally, described library construction unit further comprises:

Pcr amplification module, is provided with SPG11 gene extron Auele Specific Primer in described pcr amplification module, to utilize SPG11 gene extron Auele Specific Primer, described sample of nucleic acid is carried out to pcr amplification,

Optionally, described SPG11 gene extron Auele Specific Primer has the nucleotide sequence as shown in SEQ ID NO:7-10,

Optionally, described order-checking unit comprises and is selected from Hiseq2000, SOLiD, 454 and at least one of single-molecule sequencing device.

9. for screening a test kit for the biological sample of easy trouble autosomal recessive inheritance type hereditary spastic paraplegia, it is characterized in that, contain:

Be suitable for detecting the reagent of SPG11 gene mutation body, wherein compare with SEQ ID NO:1, described SPG11 gene mutation body has and is selected from c.C6856T and at least one sudden change c.2863delG.

10. test kit according to claim 9, is characterized in that, described reagent is nucleic acid probe,

Optionally, described test kit comprises the SPG11 gene extron Auele Specific Primer with nucleotide sequence as shown in SEQ ID NO:7-10.

Images