CN103571874A - Application of BIGH3 in preparation of animal model with corneal dystrophy - Google Patents
Application of BIGH3 in preparation of animal model with corneal dystrophy Download PDFInfo
- Publication number
- CN103571874A CN103571874A CN201210282649.8A CN201210282649A CN103571874A CN 103571874 A CN103571874 A CN 103571874A CN 201210282649 A CN201210282649 A CN 201210282649A CN 103571874 A CN103571874 A CN 103571874A
- Authority
- CN
- China
- Prior art keywords
- bigh3
- gene
- expression constructs
- ires
- saltant type
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to an application of BIGH3 in preparation of an animal model with corneal dystrophy. The corneal dystrophy model with stability in genetics and stability in phenotype is established, and the model is realized by mutating the 124th site of a Bigh3 protein of a non-human mammalian from Arg to His. By taking the transgenic animal model provided by the invention as a research model, the feasibility of preventing and treating corneal dystrophy diseases can be investigated on the gene level, and a research basis is provided for gene diagnosis and treatment of granular corneal dystrophy.
Description
Technical field
The invention belongs to biological technical field; More specifically, the present invention relates to the application of BIGH3 in preparing cerneal dystrophy animal model.
Background technology
Cerneal dystrophy (Corneal Dystrophy) is one group of primary relevant to gene genetic, carrying out property, blinding keratopathy, it is type common in cornea genetic diseases, up to now, Penetrating Keratoplasty is still the Main Means of this disease for the treatment of.But research shows, after Penetrating keratoplasty, still have recurrence and deterioration (the Yoo SY of the cerneal dystrophy state of an illness, Kim T, Lee SY, et al.A simple DNA chip for diagnosis of most common corneal dystrophies caused by beta igh3gene mutations.Proceedings of the frontiers in the convergence of Bioscience and Information Technologies, 2007,69-74).
At present the fixed karyomit(e) relevant to cerneal dystrophy has: 1,5,9,10,12,16,17,20,21 and X chromosome.Disease-causing gene mainly contains (the Klintworth GK.Advances in the molecular genetics of corneal dystrophies.Am J Ophthalmol such as BIGH3, CHST6, K3, K12, M1SI, GSN, 1999,128 (6): 747-754).Cerneal dystrophy is mostly autosomal dominant inheritance, and minority is autosomal recessive inheritance or X-linkage heredity.
Research shows that polytype cerneal dystrophy is all relevant with the sudden change of BIGH3 (TGFBI) gene, and therefore these cerneal dystrophies that produced by BIGH3 transgenation are called as BIGH3 gene-correlation cerneal dystrophy conventionally.The BIGH3 gene TGFBI gene that is otherwise known as, be positioned 5q31 (long-armed 3 district's 1 bands of No. 5 karyomit(e)s of the mankind), gene span 30kb (Skonier J, Bennett K, Rothwell V, et al.Beta-igh3:a transforming growth factor-beta responsive gene encoding a secreted protein that inhibits cell attachment invitro and suppresses the growth of CHO cells in nude mice[J] .DNA Cell Biol 1994,13 (6): 571-584).
Have been found that at present BIGH3 gene exists a plurality of sudden changes and relevant to disease generation, has research to a plurality of catastrophe points of BIGH3 gene.But, for BIGH3 transgenation, only rest on the phenotypic character observation that each mutational site produces, and the study of incident mechanism of the cerneal dystrophy that transgenation causes for BIGH3 mainly concentrates on the detection of its gene mutation site of research, so far there are no, and whether bibliographical information can successfully set up disease animal model about BIGH3 transgenation, and whether can obtain the stable disease animal model going down to posterity.
Owing to existing many restrictive factors in the research in the congenital illness in eye of the mankind, larger for research difficulty such as the mankind's the mechanism of congenital keratopathy and the clones of Disease-causing gene, successfully set up disease animal model and will bring very large help to its pathogenetic research.
Summary of the invention
The object of the present invention is to provide the application of BIGH3 in preparing cerneal dystrophy animal model.
Another object of the present invention is to provide a kind of method of preparing cerneal dystrophy animal model.
In a first aspect of the present invention, a kind of method of preparing transgenic nonhuman mammal is provided, described method comprises:
(1) provide an expression constructs, this expression constructs comprises by 5 ' → 3 ' element that following operability connects successively: PGK promotor, people's saltant type Bigh3 gene, IRES gene; Wherein, the 124th of the people Bigh3 albumen of described saltant type Bigh3 genes encoding sports His by Arg;
(2) expression constructs of (1) is injected into non-human mammal fertilized egg cell's male pronucleus, the zygote transplation after injection, in the uterine tube of the non-human mammal of false pregnancy, makes its production of becoming pregnant, and obtains transgenic nonhuman mammal.
In a preference, described non-human mammal is mouse or rat.
In another preference, in step (1), the 3 ' end at IRES gene, also comprises: EGFP gene.
In another preference, in step (1), the 3 ' end at IRES gene, also comprises: terminator.
In another preference, the nucleotide sequence of described people's saltant type Bigh3 gene is as shown in SEQ ID NO:1.
In another aspect of this invention, the purposes of the transgenic nonhuman mammal that the method described in providing obtains, for the animal model as cerneal dystrophy; Or for screening the medicine that prevents and/or treats cerneal dystrophy.
In a preference, described cerneal dystrophy is granular corneal dystrophy.
In another aspect of this invention, provide a kind of expression constructs, this expression constructs comprises by 5 ' → 3 ' element that following operability connects successively: PGK promotor, people's saltant type Bigh3 gene, IRES gene; Wherein, the 124th of the Bigh3 albumen of described saltant type Bigh3 genes encoding the sports His by Arg.
In another preference, the 3 ' end at IRES gene, also comprises: EGFP gene and/or terminator.
In another preference, described expression constructs is expression vector.
In another aspect of this invention, the purposes of the expression constructs described in providing, for the preparation of the transgenic nonhuman mammal of cerneal dystrophy.
Other side of the present invention, due to disclosure herein, is apparent to those skilled in the art.
Accompanying drawing explanation
Fig. 1, PGK-BIGH3 (M)-IRES-EGFP recombinant expression plasmid schematic diagram.
Fig. 2, pPGK-Bigh3 (M)-IRES-EGFP plasmid linearization and electrophorogram; Wherein,
Swimming lane 1: plasmid DNA of pPGK-Bigh3 (M)-IRES-EGFP;
Swimming lane 2: plasmid DNA of pPGK-Bigh3 (M)-IRES-EGFP is the fragment for microinjection through XbaI enzyme cutting linearizing;
Swimming lane MW:MBI GeneRuler 1kb DNA Ladder (brilliant U.S. biological, Cat#SM0311).
Fig. 3, RT-PCR identify transgenic positive F
0for the situation of mouse, using the sign of people BIGH3 gene masculine as transgenic positive.
The transparency cornea of Fig. 4, wild-type mice.
Fig. 5, M53 mouse F1 generation mouse present muddy cornea.
The OCT image of the cornea of Fig. 6, wild-type mice.
The OCT image of Fig. 7, M53 mouse F1 generation mouse cornea.
Embodiment
The inventor is through deeply and research widely, set up a kind of inheritance stability, cerneal dystrophy model that phenotype is stable, and it is realized by sporting His by the 124th of the Bigh3 albumen of non-human mammal by Arg.Take transgenic animal of the present invention as research model, can at gene level, inquire into the feasibility of control cerneal dystrophy disease, for carrying out gene diagnosis and the treatment of granular corneal dystrophy, provide Research foundation.Completed on this basis the present invention.
In the present invention, described non-human mammal can be selected from: mouse, rat, rabbit, dog, ape and monkey etc.; Described non-human mammal approaches at the aspects such as genomic composition, individual growth, metabolic way, anatomical organ, disease incidence mechanism and the mankind.Preferably, described non-human mammal is mouse; Mouse more preferably.
As used herein, described " cerneal dystrophy " is the general name of a series of carrying out property of the primary relevant with familial inheritance keratopathies.This disease is most is the autosomal dominant property lost; Be primary in cornea.
As used herein, described " granular corneal dystrophy " is a kind of of cerneal dystrophy, show as visible canescence shape muddiness under cornea central authorities bowman's lamina, be merged into differ in size, well-defined circle or irregular agglomerate, come in every shape, progressively, to cornea essence Deep Development, between muddy piece, occur that diffusivity is muddy, has a strong impact on eyesight late period.
As used herein, described " being operably connected " or " operability connection " refer to functional spatial disposition of two or more nucleic acid region or nucleotide sequence.For example: promoter region is placed in the specific position with respect to goal gene nucleotide sequence, make transcribing of nucleotide sequence be subject to the guiding of this promoter region, thereby promoter region is " operably connected " on this nucleotide sequence.
As used herein, described " promotor " or " promoter region (territory) " refer to a kind of nucleotide sequence, and the upstream (5 ' end) that it is present in goal gene encoding sequence conventionally, can be transcribed into mRNA by guiding nucleus acid sequence.Usually, promotor or promoter region provide RNA polymerase and correct initial recognition site of transcribing necessary other factors.In this article, described promotor or promoter region comprise the variant of promotor, and it,, by inserting or delete regulation and control region, carries out random or rite-directed mutagenesis etc. and obtain.
The construction process of described transgenic nonhuman mammal comprises: the method by an expression casette by microinjection imports in the zygote of animal, thereby cultivate described zygote, obtains described transgenic animal; Wherein, described expression cassette from 5 ' to 3 ' end has following element successively: PGK promotor, people's saltant type Bigh3 gene, IRES gene; Wherein, the 124th of the Bigh3 albumen of described saltant type Bigh3 genes encoding the sports His by Arg.
Described PGK promotor is a kind of constitutive promoter, can be in a plurality of tissues wide expression, in the structure of transgenic models, be widely used.
Described Bigh3 gene is one and the closely-related gene of cerneal dystrophy.Yet people also do not utilize Bigh3 transgenation successfully to build the animal model of cerneal dystrophy.This is because a plurality of sites on Bigh3 gene all may be relevant to cerneal dystrophy, and to suddenly change the typical animal model of successful acquired character to be unknown in which or which site.
Saltant type Bigh3 gene of the present invention has the nucleotide sequence described in SEQ ID NO:1, and the 124th of the Bigh3 albumen of its coding sports His by Arg (R).The invention still further relates to the varient of described " saltant type Bigh3 gene ", is His as long as the Bigh3 albumen of its coding retains the aminoacid sequence approaching with wild-type and the 124th.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural occurs.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing in fact the function of the polypeptide (saltant type Bigh3 albumen) of its coding.
As optimal way of the present invention, in described expression cassette, also reporter gene can be set.Described reporter gene for example can be selected from: luciferase encoding gene, green fluorescent protein encoding gene or red fluorescent protein encoding gene.Preferred, described reporter gene is green fluorescent protein encoding gene.
Described genetic expression also comprises terminator, and suitably selection and the structure of terminator are technology well known in the art, in the present invention, can adopt terminator known in the art.
Described expression casette is imported in the zygote of animal, thereby obtains described transgenic animal by cultivating described zygote.Cultivate the zygote intrauterine that conventionally zygote need to be remigrated to parent that makes it to grow and carry out, after maturation, by parent, given a birth, thereby obtain heritable genetically modified animal strain.Described transgenic animal also can be by mating, thereby obtains offspring animal, can from offspring animal, find out the animal of carrying described expression cassette in genome.
The present invention also provides the purposes of described transgenic animal, and described transgenic animal are for screening the medicine of prevention or treatment cerneal dystrophy.
In addition, the present invention also provides a kind of cell that derives from described transgenic nonhuman mammal, contains an expression casette in the genome of described cell, and described expression cassette from 5 ' to 3 ' end has following element successively: PGK promotor, people's saltant type Bigh3 gene, IRES gene; Wherein, the 124th of the Bigh3 albumen of described people's saltant type Bigh3 genes encoding sports His by Arg (R).Preferably, described cell is somatocyte.
As optimal way of the present invention, using mouse as model animals, compare with the mankind, it is all very approaching with the mankind in genomic composition, individual growth, metabolic way, anatomical organ, disease incidence mechanism etc., therefore can be applied to well the aspects such as human diseases pathogenesis, pharmacopathology research.
Screening method
The present invention utilizes transgenic technology, obtains the transgenic animal that contain saltant type Bigh3 gene, can apply this animal and carry out the research of cerneal dystrophy disease and the screening of control medicine.The transgenic animal model screening of medicaments of utilizing the present invention to build, existing molecule or the facility of cell screening model aspect Mechanism Study, there is again the advantage of animal model aspect disease simulation and medicine mass action, it is the good model of drug screening and evaluation, and for research and screening combination drug, for example the drug screening of Chinese medicine and compound thereof and research are significant.
As one aspect of the present invention, provide a kind of screening to there is the method for the potential material (as compound) of control cerneal dystrophy, described method comprises step: (1) provides the transgenic animal of cerneal dystrophy, in the genome of described transgenic animal, contain an expression casette, described expression cassette from 5 ' to 3 ' end has following element successively: PGK promotor, people's saltant type Bigh3 gene, IRES gene; Wherein, the 124th of the Bigh3 albumen of described saltant type Bigh3 genes encoding the sports His by Arg (R); (2) candidate substances is given to the transgenic animal of step (1); (3) detect the membranaceous condition of horn, if the corneal conditions of described candidate substances is significantly improved, show that this candidate substances is the potential material of control cerneal dystrophy disease.
The above-mentioned potential material filtering out can form a screening storehouse, can carry out further cell experiment, animal experiment and/or clinical trial to these materials, further to confirm the effect of the control cerneal dystrophy of described potential material.
With utilize traditional animal model to carry out drug screening to compare, utilize transgenic animal model of the present invention to screen can to realize adult flux and evaluate relevant candidate substances.
Major advantage of the present invention is:
(a) inheritance stability, the phenotype of the cerneal dystrophy animal model that the present invention obtains are stable.
(b) with the animal model that the inventive method obtains, can educate, grow normal; Bigh3(R124H) expression of mutator gene change can Mendelian's law heredity to offspring mouse.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment are only not used in and limit the scope of the invention for the present invention is described.The experimental technique of unreceipted actual conditions in the following example, writes molecular cloning experiment guide, the condition described in Science Press, or the condition of advising according to manufacturer conventionally as J. Pehanorm Brooker etc. according to normal condition.Unless otherwise indicated, otherwise per-cent and umber calculate by weight.
Unless otherwise defined, the same meaning that all specialties of using in literary composition and scientific words and one skilled in the art are familiar.In addition, any method similar or impartial to described content and material all can be applicable in the present invention.The use that better implementation method described in literary composition and material only present a demonstration.
The structure of embodiment 1, PGK-BIGH3 (M)-IRES-EGFP recombinant expression plasmid
Take PGK-Up and PGK-Down as primer, PL451 plasmid (available from Shanghai Nanfangmoshi Biological Sci-Tech Dev Co., Ltd.) DNA of take is template, use TaKaRa Ex Taq to carry out PCR, agarose gel electrophoresis reclaims pcr amplified fragment, obtains the PGK promoter fragment that both sides have respectively the 0.5kb of XhoI and SalI restriction enzyme site.
PGK promotor (Promoter) builds primer sequence:
PGK-Up：CGACTCGAGACCGGGTAGGGGAGGCGCTTT(SEQ?ID?NO:2)；
PGK-Down：GGCGTCGACTCGAAAGGCCCGGAGATGAGG(SEQ?ID?NO:3)。
The PGK promoter fragment that aforementioned recovery is obtained is connected with plasmid pCAG-IRES-EGFP (available from Shanghai Nanfangmoshi Biological Sci-Tech Dev Co., Ltd.), through XhoI and SalI double digestion, connection, conversion, obtain pPGK-CAG-IRES-EGFP recombinant plasmid.
Plasmid pPGK-CAG-IRES-EGFP cuts through PhBI enzyme, the separated CAG-promoter fragment of removing wherein of agarose gel electrophoresis, and glue recovery carrier segments, carrier segments is through the ligation of T4 ligase enzyme, and transformed competence colibacillus intestinal bacteria are to obtain pPGK-IRES-EGFP recombinant plasmid.
People Bigh3 cDNA, be connected with pMD-T18 (available from Shanghai JaRa Bioisystech Co., Ltd) and obtain pMD-T18-Bigh3-Mutation plasmid (preparation of Shanghai JaRa Bioisystech Co., Ltd), determined dna sequence confirms that the Bigh3 cDNA fragment including has the sudden change of the 140G → A of expection, this Bigh3Mutation cDNA fragment is through SalI and SacII double digestion pMD-T18-Bigh3-Mutation and Purified in electrophoresis acquisition, and be connected with the pPGK-IRES-EGFP carrier segments of SalI and SacII double digestion, transform, recombinant plasmid vector called after pPGK-Bigh3 (the M)-IRES-EGFP obtaining.This plasmid vector structure confirms to build correct through determined dna sequence.
(SEQ ID NO:1) is as follows for the cDNA sequence of people's saltant type Bigh3:
TTAGTCGACGCCACCATGGCGCTCTTCGTGCGGCTGCTGGCTCTCGCCCTGGCTCTGGCCCTGGGCCCCGCCGCGACCCTGGCGGGTCCCGCCAAGT
CCTACCAGCTGGTGCTGCAGCACAGCAGGCTCCGGGGCCGCCAGCACGGCCCCAACGTGTGTGCTGTGCAGAAGGTTATTGGCACTAATAGGAAGTACTTCACCAACTGCAAGCAGTGGTACCAAAGGAAAATCTGTGGCAAATCAACAGTCATCAGCTACGAGTGCTGTCCTGGATATGAAAAGGTCCCTGGGGAGAAGGGCTGTCCAGCAGCCCTACCACTCTCAAACCTTTACGAGACCCTGGGAGTCGTTGGATCCACCACCACTCAGCTGTACACGGACCGCACGGAGAAGCTGAGGCCTGAGATGGAGGGGCCCGGCAGCTTCACCATCTTCGCCCCTAGCAACGAGGCCTGGGCCTCCTTGCCAGCTGAAGTGCTGGACTCCCTGGTCAGCAATGTCAACATTGAGCTGCTCAATGCCCTCCGCTACCATATGGTGGGCAGGCGAGTCCTGACTGATGAGCTGAAACACGGCATGACCCTCACCTCTATGTACCAGAATTCCAACATCCAGATCCACCACTATCCTAATGGGATTGTAACTGTGAACTGTGCCCGGCTGCTGAAAGCCGACCACCATGCAACCAACGGGGTGGTGCACCTCATCGATAAGGTCATCTCCACCATCACCAACAACATCCAGCAGATCATTGAGATCGAGGACACCTTTGAGACCCTTCGGGCTGCTGTGGCTGCATCAGGGCTCAACACGATGCTTGAAGGTAACGGCCAGTACACGCTTTTGGCCCCGACCAATGAGGCCTTCGAGAAGATCCCTAGTGAGACTTTGAACCGTATCCTGGGCGACCCAGAAGCCCTGAGAGACCTGCTGAACAACCACATCTTGAAGTCAGCTATGTGTGCTGAAGCCATCGTTGCGGGGCTGTCTGTAGAGACCCTGGAGGGCACGACACTGGAGGTGGGCTGCAGCGGGGACATGCTCACTATCAACGGGAAGGCGATCATCTCCAATAAAGACATCCTAGCCACCAACGGGGTGATCCACTACATTGATGAGCTACTCATCCCAGACTCAGCCAAGACACTATTTGAATTGGCTGCAGAGTCTGATGTGTCCACAGCCATTGACCTTTTCAGACAAGCCGGCCTCGGCAATCATCTCTCTGGAAGTGAGCGGTTGACCCTCCTGGCTCCCCTGAATTCTGTATTCAAAGATGGAACCCCTCCAATTGATGCCCATACAAGGAATTTGCTTCGGAACCACATAATTAAAGACCAGCTGGCCTCTAAGTATCTGTACCATGGACAGACCCTGGAAACTCTGGGCGGCAAAAAACTGAGAGTTTTTGTTTATCGTAATAGCCTCTGCATTGAGAACAGCTGCATCGCGGCCCACGACAAGAGGGGGAGGTACGGGACCCTGTTCACGATGGACCGGGTGCTGACCCCCCCAATGGGGACTGTCATGGATGTCCTGAAGGGAGACAATCGCTTTAGCATGCTGGTAGCTGCCATCCAGTCTGCAGGACTGACGGAGACCCTCAACCGGGAAGGAGTCTACACAGTCTTTGCTCCCACAAATGAAGCCTTCCGAGCCCTGCCACCAAGAGAACGGAGCAGACTCTTGGGAGATGCCAAGGAACTTGCCAACATCCTGAAATACCACATTGGTGATGAAATCCTGGTTAGCGGAGGCATCGGGGCCCTGGTGCGGCTAAAGTCTCTCCAAGGTGACAAGCTGGAAGTCAGCTTGAAAAACAATGTGGTGAGTGTCAACAAGGAGCCTGTTGCCGAGCCTGACATCATGGCCACAAATGGCGTGGTCCATGTCATCACCAATGTTCTGCAGCCTCCAGCCAACAGACCTCAGGAAAGAGGGGATGAACTTGCAGACTCTGCGCTTGAGATCTTCAAACAAGCATCAGCGTTTTCCAGGGCTTCCCAGAGGTCTGTGCGACTAGCCCCTGTCTATCAAAAGTTATTAGAGAGGATGAAGCATTAGTAACCGCGGGCG
Note: catastrophe point on wild-type basis: 139-141 position: C
gc C
ac
PPGK-Bigh3 (M)-IRES-EGFP plasmid DNA, after XbaI enzyme cutting, phenol and chloroform separation and purification, prepares transgenic mice for microinjection.PPGK-Bigh3 (M)-IRES-EGFP plasmid electrophoresis result is as Fig. 2.
Select mouse species C57BL/6J (model animals research centre, south, Shanghai), adopt the clean mouse (F1) of first-filial generation SPF level in 4～5 week age, adopt male pronucleus injecting method, will after the expression plasmid linearizing of above-mentioned structure, be expelled in male pronucleus; Zygote after injection is cultivated after 1 day in vitro, chooses the normal zygote transplation of division in the uterine tube of false pregnancy mouse, it is become pregnant and wait for birth.After mutant mice birth, whether the tail end tissue extraction that takes a morsel DNA, have genetically modified importing with PCR method checking, gets the person of building mouse headed by the mouse of the PCR positive, with the breeding of wild-type C57BL/6J mouse, set up the transgenic mice strain that stable background is consistent respectively.
As a result, 81 F0 are for mouse in microinjection birth, in 2-3, cut tail extracting genomic dna age in week, through PCR screening, obtain 5 transgenic positive mouse.Positive mouse and 3 wild-type mices (Neg) are cut tail extracting genomic dna again, and double-blind method is carried out PCR detection again, confirm that these 5 for transgenic positive mouse (M25, M28, M32, M53, M81), wherein male 2, female 3.The electrophorogram of the PCR qualification result of transgenic mice is as Fig. 3.
Transgenic mice primers designed sequence (people R124H sudden change bigh3 gene):
bigh3-Up：GACTAGCCCCTGTCTATCAAAAGTT(SEQ?ID?NO:4)；
bigh3-Down：AACCTCGACTAAACACATGTAAAGC(SEQ?ID?NO:5)。
F0 is for mouse and wild-type C57BL/6J hybridization at present, PCR identifies totally 40 of transgenic positive mouse, naked eyes can and cornea have totally 10 of hickies, cornea and prosthomere OCT performance are as Fig. 5 and Fig. 7, present cornea holostrome and thicken, in central hypothallus, occur the phenotype of the muddy piece of sharply marginated canescence.As reference, wild-type mice cornea as shown in Figure 4 and Figure 6.
To sum up, the inventor successfully sets up the mouse model of the granular corneal dystrophy of BIGH3 transgenation, has obvious hickie pathology on mouse cornea, and it is typical cerneal dystrophy symptom.And, this pathology energy genetic stability.
All documents of mentioning in the present invention are all quoted as a reference in this application, just as each piece of document, are quoted as a reference separately.In addition should be understood that those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.
Claims (10)
1. a method of preparing transgenic nonhuman mammal, is characterized in that, described method comprises:
(1) provide an expression constructs, this expression constructs comprises by 5 ' → 3 ' element that following operability connects successively: PGK promotor, people's saltant type Bigh3 gene, IRES gene; Wherein, the 124th of the people Bigh3 albumen of described saltant type Bigh3 genes encoding sports His by Arg;
(2) expression constructs of (1) is injected into non-human mammal fertilized egg cell's male pronucleus, the zygote transplation after injection, in the uterine tube of the non-human mammal of false pregnancy, makes its production of becoming pregnant, and obtains transgenic nonhuman mammal.
2. the method for claim 1, is characterized in that, described non-human mammal is mouse or rat.
3. the method for claim 1, is characterized in that, in step (1), the 3 ' end at IRES gene, also comprises: EGFP gene.
4. the method for claim 1, is characterized in that, in step (1), the 3 ' end at IRES gene, also comprises: terminator.
5. the method for claim 1, is characterized in that, the nucleotide sequence of described people's saltant type Bigh3 gene is as shown in SEQ ID NO:1.
6. the purposes of the transgenic nonhuman mammal that method claimed in claim 1 obtains, for the animal model as cerneal dystrophy; Or for screening the medicine that prevents and/or treats cerneal dystrophy.
7. an expression constructs, is characterized in that, this expression constructs comprises by 5 ' → 3 ' element that following operability connects successively: PGK promotor, people's saltant type Bigh3 gene, IRES gene; Wherein, the 124th of the Bigh3 albumen of described saltant type Bigh3 genes encoding the sports His by Arg.
8. expression constructs as claimed in claim 7, is characterized in that, the 3 ' end at IRES gene, also comprises: EGFP gene and/or terminator.
9. expression constructs as claimed in claim 7, is characterized in that, described expression constructs is expression vector.
10. the purposes of the arbitrary described expression constructs of claim 7-9, for the preparation of the transgenic nonhuman mammal of cerneal dystrophy.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210282649.8A CN103571874A (en) | 2012-08-09 | 2012-08-09 | Application of BIGH3 in preparation of animal model with corneal dystrophy |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210282649.8A CN103571874A (en) | 2012-08-09 | 2012-08-09 | Application of BIGH3 in preparation of animal model with corneal dystrophy |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103571874A true CN103571874A (en) | 2014-02-12 |
Family
ID=50044585
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210282649.8A Pending CN103571874A (en) | 2012-08-09 | 2012-08-09 | Application of BIGH3 in preparation of animal model with corneal dystrophy |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103571874A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111269942A (en) * | 2020-02-28 | 2020-06-12 | 中国人民解放军军事科学院军事医学研究院 | Application of TGFBI as marker for regulating and controlling osteogenic differentiation of mesenchymal stem cells |
| CN113981001A (en) * | 2021-10-15 | 2022-01-28 | 上海科技大学 | Method for visually marking proximity in tissue |
-
2012
- 2012-08-09 CN CN201210282649.8A patent/CN103571874A/en active Pending
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111269942A (en) * | 2020-02-28 | 2020-06-12 | 中国人民解放军军事科学院军事医学研究院 | Application of TGFBI as marker for regulating and controlling osteogenic differentiation of mesenchymal stem cells |
| CN113981001A (en) * | 2021-10-15 | 2022-01-28 | 上海科技大学 | Method for visually marking proximity in tissue |
| CN113981001B (en) * | 2021-10-15 | 2024-05-10 | 上海科技大学 | Visual proximity marking method in nerve tissue |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2018177351A1 (en) | Method for preparing non-chimeric gene knockout animal based on crispr/cas9 technology | |
| Balling et al. | Craniofacial abnormalities induced by ectopic expression of the homeobox gene Hox-1.1 in transgenic mice | |
| Stuart et al. | Replication, integration and stable germ-line transmission of foreign sequences injected into early zebrafish embryos | |
| Shu et al. | Disruption of muREC2/RAD51L1 in mice results in early embryonic lethality which can be partially rescued in a p53−/− background | |
| McMahon et al. | The Wnt-1 (int-1) proto-oncogene is required for development of a large region of the mouse brain | |
| Labosky et al. | The winged helix gene, Mf3, is required for normal development of the diencephalon and midbrain, postnatal growth and the milk-ejection reflex | |
| AU2017101108A4 (en) | Construction method of animal model of mucopolysaccharidosis type II and use thereof | |
| CN110684777B (en) | Application of isolated nucleotide sequence in construction of zebra fish with reduced intramuscular stings | |
| CN110438160A (en) | A kind of construction method of Cd2ap Gene Knock-Out Animal Model and application | |
| CN111418553A (en) | Hyperuricemia rat model and construction method thereof | |
| CN113151361A (en) | Method for cultivating crucian carp strain without muscle intermingled bones | |
| CN111560401A (en) | Molecular breeding method for thickening interpuscular spurs of erythroculter ilishaeformis and megalobrama amblycephala | |
| Tewari et al. | Mendelian transmission, structure and expression of transgenes following their injection into the cytoplasm of trout eggs | |
| CN111549031A (en) | Molecular breeding method for thickening muscle of grass carp and black carp | |
| CN105002215A (en) | Expression vector containing regulatably expressible cre recombinase gene and reporter gene LacZ, construction method and application thereof | |
| CN103571874A (en) | Application of BIGH3 in preparation of animal model with corneal dystrophy | |
| WO2024103631A1 (en) | Transgenic mouse with ggc repeat expansion mutation in notch2nlc gene, construction method therefor, and use thereof | |
| CN101948860A (en) | Vector of uPA expression regulated by Tet-on system and application thereof | |
| Wu et al. | Characterization of transgene integration pattern in F4 hGH-transgenic common carp (Cyprinus carpio L.) | |
| Ohtoshi et al. | Neonatal lethality, dwarfism, and abnormal brain development in Dmbx1 mutant mice | |
| CN107955818B (en) | Establishing method and application of non-human primate animal model with neurological diseases | |
| CN103045606A (en) | K14-VEGF transgenic mouse model, and construction method and application of model | |
| CN111549030A (en) | Molecular breeding method for thickening crucian muscles | |
| Feng et al. | Black carp growth hormone gene transgenic allotetraploid hybrids of Carassius auratus red var.(♀)× Cyprinus carpio (♂) | |
| CN105440111A (en) | Pair of transcription activator-like effector nucleases (CTFs), coding sequences and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20140212 |