CN103554262A - Anti-cyclooxygenase humanized single-chain antibody - Google Patents

Abstract

The invention relates to an anti-cyclooxygenase humanized single-chain antibody, belonging to a humanized antibody. The anti-cyclooxygenase humanized single-chain antibody is a humanized single-chain antibody which is in specific combination and capable of inhibiting the COX-2 (cyclooxygenases 2) activity, and the nucleotide sequence of the humanized single-chain antibody is shown by Sequence No.1; the anti-cyclooxygenase humanized single-chain antibody also comprises an endoplasmic reticulum retention signal peptide KDEL gene coding sequence and an E-tag peptide gene coding sequence, and the nucleotide sequence is shown by Sequence No.. The invention also relates to an application of the anti-cyclooxygenase humanized single-chain antibody in preparing a medicine with an effect of inhibiting cyclooxygenase activity and an application of the anti-cyclooxygenase humanized single-chain antibody in preparing a medicine with an anti-tumor effect. The anti-cyclooxygenase humanized single-chain antibody provided by the invention is a low-toxicity, efficient and specific molecule for inhibiting COX-2 activity, and has the advantages of small molecular weight, low immunogenicity and the like; the tumor-targeted therapy of the antibody is performed by use of a tumor-specific eukaryotic expression vector, and controllability of the therapy gene can be realized; the anti-cyclooxygenase humanized single-chain antibody has tumor specificity and guarantees the safety and effectiveness of the therapy.

Description

A kind of anti-cyclooxygenase human single chain variable fragments antibody

Technical field

The present invention relates to a kind of human antibody.A kind of gene of human single chain variable fragments antibody and the acquisition of albumen and activity characterization thereof with the specific recognition COX-2 albumen that suppresses cyclooxygenase-2 activity and anti-tumor activity specifically.

Background technology

Cyclooxygenase (cyclooxygenase, COX) claim again prostanoid superoxide synthetic enzyme (prostaglandin endoperoxide synthase), it is the rate-limiting enzyme that conversion of arachidonic acid is converted into prostaglandins (prostaglandin, PGs).This enzyme mainly contains two kinds of isozyme forms in mammalian cell, is respectively COX-1 and COX-2.COX-1 is structure-type to express, and COX-2 is inducible expression.

The unbalance of cell proliferation and apoptosis is the major reason that tumour produces.The Prostaglandin PGE2 that COX-2 mainly produces by its catalysis promotes growth and the propagation of normal cell and tumour cell.Prescott S M etc. 2000 are at BiochimBiophys Acta, 2000,1470 (2): 69-78 points out that it is that EP/cAMP approach activates intracellular kinase promotion cell proliferation that PGE2 both can be combined with prostaglandin receptor EP by G albumen coupling approach, also can enter in core and peroxisome proliferation activated receptor (peroxisome proliferator-activated receptor gamma, PPAR) oncogene such as zygotic induction Bcl-2, H-ras, K-ras is expressed and is acted on peripheral cell by paracrine effect, promotes growth of tumour cell.Kinoshita T etc. 1999 are at Biochimica et Biophsica Acta, 1999,1438 (1): in 120-130, point out to occur in the human colon cancer cell of transfection COX-2cDNA that DNA resultant velocity accelerates, promotes the effect of cell proliferation, expression of epidermal growth factor receptor raises simultaneously, and cox 2 inhibitor indomethacin can suppress this variation.Pockaj B A etc. 2004 are at AnnSurg Oncol, 2004,11 (3): 328-339 points out that COX-2 crosses expression and causes that PGE2 level improves, can suppress some cytokine in host, oncological surveillance being played an important role and immunomodulators, as induced, produce IL-10, thereby suppress the generation of TNF and IL-12; Also can make tumour cell escape immunosurveillance by the propagation of suppressor T cell and B cell and the anti-tumor activity of NK cell.Kang Y etc. 2003 are at Cancer Cell, and 2003,3 (6): 537-549 points out COX-2 high expression level in multiple metastatic tumour cell, by affecting the motion of tumour cell, stick ability and promote the aspects such as blood vessel generation to promote metastases.A large amount of studies have shown that, the abduction delivering of COX-2 is that one of early stage characteristic events occurs tumour, and is an important promotion factor of the pernicious transformation of tumour cell.COX-2 plays the part of important role in the events such as tumorigenesis, infiltration metastasis, so COX-2 is an important target spot of oncotherapy.These results are all for COX-2 provides experimental basis as an Effective target site of oncotherapy.

A lot of research is all devoted to seek effectively to suppress enzymatic this biochemical route of COX, and then the effective ways of mitigate the disease.Non-steroidal anti-inflammatory drugs, if acetylsalicylic acid (aspirin), indomethacin (indomethacin), Ibuprofen BP/EP (ibuprofen) etc. are the antipyretic and analgesic that conventional wide spectrum suppresses COX, but because COX-1 is the enzyme that regulates the structure-type expression of the normal physiological functions such as gastric mucosa, therefore these medicines, in the effects such as performance relieving inflammation and relaxing pain, there will be untoward reactions such as causing gastrorrhagia and ulcer.Therefore and COX-2 is inflammation-induced medium, becoming rapidly can anti-inflammatory analgesic, there is no again the design target spot of stomach and intestine untoward reaction ntipyretic analgesic medicine.Kurumbail R G etc. have proposed the architecture basics of research and development COX-2 selective depressant at Nature in 1996 in 1996,384 (6610): 644 – 648 1 literary compositions.Accordingly, the COX-2 selective depressant celecoxib (celecoxib) of synthetic went on the market in the U.S. in December, 1998.And then investigator designs and has synthesized a series of COX-2 selective depressant, as celecoxib (celecoxib), Rumi former times cloth (1umiracoxib), rofecoxib (Rofecoxib), etoricoxib (etoricoxib) etc.People expect that they can be used as selective COX-2-2 inhibitor that stomach and intestine are had no side effect and use.Wu T and work together 2004 at Mol Cancer Ther.2004,3 (3): point out in 299-307 that celecoxib can promote apoptosis of tumor cells, suppress growth of human cholangiocarcinoma cells.Sun W H etc. 2009 are at Cancer Lett, and 2009,275 (2): in 247-255, confirm to use respectively cox 2 inhibitor can suppress prostate cancer cell line SWl990 growth and induce its apoptosis.Chell S etc. 2006 are at Biochim Biophys Acta, 2006,1766 (1): in 104-119, point out that cox 2 inhibitor can reduce the sickness rate of colorectal carcinoma, its mechanism is mainly cell death inducing, cell cycle regulation, affect tumor-blood-vessel growth etc.These achievements in research show, suppress the active all energy of COX-2 inhibition tumor cell propagation, and COX-2 is an Effective target site of oncotherapy.

But along with going deep into of research, it is found that once and be described as " super " Asprin, clinically for suppressing the anti-inflammatory drug of first choice Celecoxib of COX-2 activity, due to its cardiovascular toxic side effect, had to stop its cancer therapy drug clinical application.Also studies have found that the antisense and the RNAi technology that suppress COX-2 expression also can suppress COX-2 activity, inhibition tumor cell propagation.Xu L etc. 2006 are at Cancer Res., and 2006,66 (24): in 11859-11868, adopt RNA perturbation technique to utilize the siRNA of COX-2 obviously to suppress growth and the propagation of liver cancer cell.Fu YG etc., at Cancer Lett, point out to import antisense COX-2cDNA gene in stomach cancer cell in 2005,224:243-252, can suppress propagation, the migration of cell.But the shortage specificity and the tumour cell targeting that in the research of the antineoplaston of above-mentioned inhibition COX-2 activity, have micromolecular inhibitor, will produce obvious toxic side effect like this; Secondly there is the problems such as relatively unstable, sphere of action is narrower in antisense technology and RNA perturbation technique, thereby can not realize target, the efficient inactivation of COX-2.Therefore, the medicine of development cancer target, special, efficient antagonism COX-2 activity has important theory significance and actual application value, will for oncotherapy, open up new approach.

Single-chain antibody is the small molecular antibody of preparing by gene engineering method, it is the recombinant antibodies variable region of heavy chain of antibody (VH) and variable region of light chain (VL) being formed by connecting by elasticity connection peptides (being generally 12-15 amino acid), its molecular weight is only equivalent to the sixth of former natural antibody, but single-chain antibody contains whole antigen binding sites, so single-chain antibody has farthest retained the antigen-binding activity of antibody, it is the small segment with parental antibody antigen-binding activity.After single-chain antibody occurs, people are in the process of research single-chain antibody, find that single-chain antibody has some unrivaled superiority, so people just utilize prior art that single-chain antibody is transformed and modified, to improve function and the new purposes of development of single-chain antibody, wherein intracellular antibody (intracellular antibody or intrabody) technology is in recent years, along with the further investigation of people's antagonist engineering and Cellular Signaling Transduction Mediated, derive the antibody technique of important target protein in a brand-new cell capable of blocking.Intracellular antibody technology makes it be anchored to cell privileged site, thereby reaches the effect of combination and the arbitrary cytoplasmic structure of inactivation after can modifying by the N end to scFv gene coded protein or C end, realizes the phenotypic knock-up of important target molecule.It is another novel gene treatment approach after the technology such as sense-rna, specific ribozyme, dominant negative sudden change, suicide gene.And the RNAi technology of getting up with new development is compared, intracellular antibody can high specific, act on to high stability intracellular protein, in Antioncogene treatment, has great potential and application prospect.

Because endoplasmic reticulum itself is the place of natural antibody assembling and protein synthesis, in its tube chamber, exist and be conducive to the required cofactor of antibody formation activity conformation, simultaneously, antibody is stranded on endoplasmic reticulum tube chamber or endoplasmic reticulum and has greatly increased antibody and the interactional chance of target protein, improved the stress efficacy of scFv.And the target protein COX-2 the present invention is directed to is mainly distributed in endoplasmic reticulum, therefore by modification, scFv is stranded in to endoplasmic reticulum and will greatly increases the effect chance of antibody and target protein, the efficient function that suppresses target protein, will provide new approach and strategy for COX-2 in efficient inactivation cell.

Summary of the invention

The invention provides a kind of anti-cyclooxygenase human single chain variable fragments antibody, with relative unstable, the problem such as sphere of action is narrower that solves that toxic side effect that shortage specificity that the micromolecular inhibitor of current inhibition COX-2 activity exists causes with tumour cell targeting and antisense technology and RNA perturbation technique etc. exist, realize it and in cell, effectively knock out the phenotypic function of COX-2, thereby reach the object that inhibition tumor cell is bred.

The technical scheme that the present invention takes is:

A cyclooxygenase human single chain variable fragments antibody, is specific anti-human COX-2 human single chain variable fragments antibody, and its nucleotide sequence is as described in Sequence No.1.

Described anti-cyclooxygenase human single chain variable fragments antibody, also comprises ER retention signal peptide KDEL, E-tag labelled peptide gene coded sequence, and its nucleotide sequence is as described in Sequence No.2.

Described anti-cyclooxygenase human single chain variable fragments antibody has the application in the medicine that suppresses cyclooxygenase-2 activity effect in preparation.

Described anti-cyclooxygenase human single chain variable fragments antibody has the application in the medicine of antitumor action in preparation.

The recombinant human COX-2 albumen of take is antigen, by " absorption-wash-out-amplification " elutriation process, from people source Phage Antibody Library, obtain the single-chain antibody gene ANX-2 of specific anti-human COX-2 albumen, further by technology such as prokaryotic expression, ELISA, Western blot and immunoprecipitations, ANX-2 albumen is carried out to activity characterization, obtain humanized's single-chain antibody of specific binding COX-2.Because endoplasmic reticulum is the main mobilizing function district of COX-2, in order to realize ANX-2 specificity, disturb or block the activity of the COX-2 that is distributed in endoplasmic reticulum, realize the phenotypic knock-up of COX-2, thereby the antitumor action of performance ANX-2, further take ANX-2 as template, by polymerase chain reaction (PCR), be cloned into ER retention signal KDEL, E-tag detection signal, add corresponding restriction enzyme site, obtain single-chain antibody gene ERANX-2 in anti-COX-2 people source born of the same parents, and then be subcloned in carrier for expression of eukaryon pcDNA3.1, thereby built the carrier for expression of eukaryon pERANX-2 of single-chain antibody gene in the anti-COX-2 people of reconstitution cell endoplasmic reticulum retention type source born of the same parents.By after the carrier for expression of eukaryon pERANX-2 transfection mankind HepG2 cell building, expression and Bioactivity to the restructuring anti-COX-2 people of endoplasmic reticulum retention type source intracellular antibody gene have carried out series of studies, result shows, anti-COX-2 human single chain variable fragments antibody ANX-2 add single-chain antibody gene (ERANX-2) in the anti-COX-2 people of the endoplasmic reticulum retention type source born of the same parents that obtain after ER retention signal can be in tumour cell effective expression effectively suppress the biological activity of COX-2.The stably express of this gene is inhibition tumor cell growth and propagation significantly, causes cell-cycle arrest, and obvious cell death inducing.

Tool of the present invention has the following advantages: the people source anti-COX-2 single-chain antibody ANX-2 obtaining in the present invention is a kind of low toxicity, efficiently, the active molecule of special inhibition COX-2, because this antibody is human antibody, avoided the toxic side effect of heterologous antibody for human body, this antibody is micromolecular single-chain antibody, there is molecular weight little, the advantages such as immunogenicity is low, overcome that monoclonal antibody molecule amount was large in the past, the shortcoming that immunogenicity is high, in addition can be by introducing endoplasmic reticulum signal for locating, further restructuring is in carrier for expression of eukaryon, make this single-chain antibody privileged site in cell efficient, stable bond, deactivation COX-2 function, for new way is opened up in oncotherapy.In addition, can also, by using tumour-specific carrier for expression of eukaryon, carry out the neoplasm targeted therapy of this antibody, realize the controllability of this therapeutic gene, can not only give full play to the tumor-inhibiting action of antibody like this, and there is tumour-specific, guarantee the safe and effective for the treatment of.

Accompanying drawing explanation

Fig. 1. phage antibody and COX-2 antigen binding capacity are measured.

Fig. 2 .ELISA method detects the combination activity of soluble single-chain antibody and COX-2 albumen.

The solubility expression of Fig. 3 .ANX-2 and purifying.1 and 2 are respectively ANX-2/HB2151 IPTG induces forward and backward bacterial sediment; 3.ANX-2/HB2151 IPTG induces supernatant; 4. sample 3 is through nickel post effluent liquid; 5.40mM imidazoles scrub stream fluid; 6-8.500mM imidazoles elutriant; 9. molecular weight of albumen standard.

Fig. 4 .Western blot identifies ANX-2.1.ANX-2/HB2151 IPTG induces supernatant; 2.ANX-2/HB2151 induces supernatant without IPTG; 3. the ANX-2 albumen of purifying.

The ANX-2 that Fig. 5 .Western blot detects purifying is combined activity with recombinant human COX-2.1.pET28b-COX-2/BL21 bacterial sediment before IPTG induction; 2. the recombinant human COX-2 albumen of purifying.V5Ab: anti-V5 antibody.

Fig. 6. the competitive inhibition of anti-COX-2 monoclonal antibody to ANX-2.A. only add ANX-2; B. add anti-COX-2 polyclonal antibody and ANX-2 simultaneously; C. only add anti-COX-2 polyclonal antibody. ^*P<0.01vs?A?or?C。

Fig. 7. competitive ELISA detects ANX-2 specific binding COX-2. ^*p<0.01vs only add the positive controls of ANX-2 or in advance nothing to do with protein B SA hatch group.#P>0.05vs only adds the positive controls of ANX-2.

The avidity of Fig. 8 .ANX-2 is measured.

Fig. 9 .Western blot detects ANX-2 and the HepG2 of purifying, and the COX-2 of MCF-7 cell endogenous expression is in conjunction with activity.Using the internal reference contrast of β-actin as cell pyrolysis liquid Western blot albumen application of sample.V5Ab: anti-V5 antibody.

Figure 10. co-immunoprecipitation is analyzed ANX-2 and is combined activity with the COX-2 of cell endogenous expression.V5Ab: anti-V5 antibody; COX-2Ab: anti-COX-2 monoclonal antibody.

The pcr amplification of Figure 11 .ERANX-2 and recombinant expression vector pERANX-2 build.A.PCR amplification wherein.1.DL-2000Marker; 2.PCR product; 3. the evaluation of the PCR product .B. recombinant expression vector pERANX-2 reclaiming.1.1kb DNA ladder marker; 2.pcDNA3.1 plasmid; 3.pERANX-2 plasmid; 4.pcDNA3.1/Hind III+EcoR I; 5.pERANX-2/Hind III+EcoR I; 6.ERANX-2/Hind III+EcoR I; 7.DL-2000Marker.

Figure 12 .RT-PCR analyzes the expression of ERANX-2 in the HepG2 of transfection cell.

Figure 13. immunofluorescence detects expression and the location of ERANX-2 in the HepG2 of transfection cell.Hoechst33342 is combined with nuclear area, sends blue-fluorescence.The ERANX-2 of two anti-detection cell inner expressions of anti-E-Tag antibody and FITC mark, sends green fluorescence, and Merge is by the blue-fluorescence of the same area and green fluorescence stack.

Figure 14 .Western-blot analyzes the expression of ERANX-2 in stable transfected cells.1.HepG2;2.HepG2/pcDNA3.1;3.HepG2/pERANX-2。

Figure 15. co-immunoprecipitation is analyzed ERANX-2 COX-2 in cell and is combined activity.

Figure 16 .ELISA method detects the impact of ERANX-2 on PGE2 level.

Figure 17 .MTT method is measured the in-vitro multiplication activity influence of ERANX-2 to HepG2 cell.

Figure 18. flow cytometer detects ERANX-2 to be affected the HepG2 cell cycle. ^*p<0.01vs?HepG2or?HepG2/pcDNA3.1at?the?same?phase，n=3。

Figure 19 .Annexin-V detects ERANX-2 to apoptotic impact.1.HepG2;2.HepG2/pcDNA3.1;3.HepG2/pERANX-2。 ^*p<0.01vs?HepG2?or?HepG2/pcDNA3.1，n=3。

Embodiment

The preparation of embodiment 1 specific anti-human COX-2 human single chain variable fragments antibody, for the ease of reading, this patent " specific anti-human COX-2 human single chain variable fragments antibody " is hereinafter to be referred as " ANX-2 "

One, experiment material

1. plasmid and bacterial strain

Intestinal bacteria (Escherichia coli) JM109, HB2151 and XL1-Blue are purchased from Beijing Ding Guo biotechnology limited liability company.Helper phage VCSM13 is purchased from Stratagene company.

2. the main related reagent of molecular cloning

Tryptone for microbial culture (tryptone), yeast extract (yeast extract), purchased from Oxid company.Prokaryotic expression and purification of recombinant human COX-2 albumen with reference to Gu Chunfang etc. 2006 at Wuhan University Journal (Edition), 2006,52 (2): the 2008 Nian Jilin University journals (Edition) such as 197-201 and Cao Yuhua, 2008,46 (5): the method in 992-996; HRP/Anti-M13 monoclonal antibody is purchased from Pharmacia company, and anti-V5 monoclonal antibody is Invitrogen company product; Anti-COX-2 antibody is purchased from Santa Cruz Biotechnology company.Ferritin (Fer) and ovalbumin (OA), OPD, coomassie brilliant blue R_250, G-250, PMSF, Tris, BSA, microbiotic (Amp, Tet) are purchased from Sigma company.His Trap HP Kit, PD-10 desalting column are purchased from Amersham Bioscience.Skim-milk is purchased from Bio-Rad company.Nitrocellulose (NC) film is purchased from Amersham Bioscience.ECL luminescence reagent box is purchased from Transgen biotech company.The plastics consumptive materials such as albumen Marker, HRP mark goat anti-mouse igg, Eppendorf pipe, pipettor gun point are purchased from Beijing Ding Guo biotechnology limited liability company.Other reagent are analytically pure domestic biochemical reagents.Plasmid extraction, purification kit, purchased from Promega company.

3. the preparation of related solution is with reference to < < molecular cloning experiment guide > >.

Two, experimental technique

1. the screening of anti-COX-2 human single chain variable fragments antibody Gene A NX-2

The Nat Biotechnol such as the concrete reference literature Sblattero of the acquisition D in phage human single chain variable fragments antibody storehouse, 2000,18:74-80 and Sblattero D etc. 1998 are at Immunotechnology, 1998, the method of 3:271-278 is carried out, by titer determination, show, finally obtaining storage capacity is 1 * 10 ¹¹phage human single chain variable fragments antibody storehouse.

The screening of antibody library adopts immobilization antigen immune absorption sieve method, people COX-2 albumen is diluted to 100 μ g/ml with 0.05mol/L carbonate buffer solution, with the coated immunity pipe of 1ml (NUNC company), with reference to Li Chunying etc. at Chinese skin cypridology magazine, the antagonist of method described in 2005,19:388-390 storehouse is carried out 4 and is taken turns " absorption-wash-out-amplification " screening.Each is taken turns screening and all measures secondary storehouse titre, and calculates phage input/output ratio (rate of recovery), as the index of specific phage antibody enrichment.

Take turns random 100 clones of picking the bacterium colony culture plate of screening from the 4th, be seeded in 2 * YT and cultivate, after spending the night with helper virus VCSM13 superingection inducing culture, collection supernatant is phage antibody.The people COX-2 of 10 μ g/ml of take is antigen coated elisa plate, after 1%BSA sealing, adds phage antibody supernatant to be measured, take HRP/Anti-M13 monoclonal antibody as two anti-, hatches, washs rear OPD substrate colour developing; The positive clone that develops the color is coated with elisa plate with people's ferritin (Fer) and ovalbumin (OA) with object antigens c OX-2 more simultaneously, identify the specificity of its antigen antibody reaction, used two resist the monoclonal antibody for HRP/Anti-M13, add after OPD colour developing, read A ₄₉₀value.

By A ₄₉₀the phage antibody supernatant that is worth positive specific binding object antigen infects the HB2151 bacterial strain of logarithmic phase, and 37 ℃ are coated with 2 * YT dull and stereotyped (50 μ g/ml Amp) after hatching 30min.The single bacterium colony of picking next day is transferred with 1:100 dilution after overnight incubation in 2 * YT nutrient solution, cultivates logarithmic phase, and adding IPTG is 1mmol/L to final concentration, and 30 ℃ of inducing culture spend the night, and centrifugal collection supernatant is soluble single-chain antibody.With the coated elisa plate of 2 μ g/ml people COX-2, after sealing, add expression supernatant to be detected, hatch 1h for 37 ℃, the Anti-V5 monoclonal antibody that adds suitable dilution after washing, hatches 1 hour for 37 ℃, adds the HRP-goat anti-mouse igg of suitable dilution after washing, add after OPD colour developing, read A ₄₉₀value.Select to infect in conjunction with the highest active clone phagocytosis antibody supernatant the XL1-Blue bacterial strain of logarithmic phase, 37 ℃ are coated with 2 * YT dull and stereotyped (20 μ g/ml Amp, 10 μ g/mlTet) after hatching 30min.The single bacterium colony of picking next day is in 2 * YT nutrient solution (20 μ g/ml Amp, 10 μ g/ml Tet) after middle overnight incubation, preserve bacterial classification and press Wizard Plus SV Minipreps DNA Purification System test kit operation instructions and extract plasmid, by Shanghai, Sheng Gong biotechnology company limited checks order.

2. solubility expression and the purifying of anti-COX-2 single-chain antibody ANX-2

ANX2 clone is inoculated in to 400ml containing in 2 * YT substratum of Amp+ resistance, centrifugal collection supernatant after the IPTG of 1mM induces and spends the night.In supernatant, add the ammonium sulfate of 40%-60% to carry out low-temperature sludge, the albumen of the centrifugal 20min collecting precipitation of 12000rpm, the albumen of precipitation dissolves through the 0.01M of pH7.4 PBS, dialysis, desalination; Because the C-terminal of the anti-COX-2 single-chain antibody of expressing contains His-Tag, so the albumen of precipitation can carry out purifying with His Trap HP Kit after desalination.During purifying, His Trap HP Kit post is first by the Binding Buffer balance containing 10mmol/L imidazoles, by the protein solution upper prop through filtering, then successively with Binding Buffer and the washing Buffer that contains imidazoles respectively upper prop wash clearly foreign protein, using 500mmol/L imidazoles as elutriant, collect each and flow out component and carry out SDS-PAGE electrophoresis, determine best wash concentration.Bradford colorimetric method for determining protein content for the albumen of purifying.

3.Western blot Analysis and Identification ANX-2 antibody

By the albumen of purifying after 12% SDS-PAGE electrophoresis; Half dry type transfer groove 100mA transferase 12 h, arrives protein delivery on nitrocellulose (NC) film; Take out NC film, after PBST washing, put into 5% skim-milk-PBST room temperature sealing 1h; NC film is taken out and puts into anti-V5 monoclonal antibody (1:5000 is diluted in 5% skim-milk-PBST) incubated at room 2h; Take out PBST vibration washing 3 times, each 10min; Again NC film is put into goat anti-mouse igg (1:5000 is diluted in 5% skim-milk-PBST) the incubated at room 1h of HRP mark; In PBST, wash each 10min 3 times; The appearance of ECL luminescence reagent box testing goal band.

Three, results and analysis

1. the screening of anti-COX-2 people source phage antibody

Through 4, take turns screening, the phage antibody rate of recovery obtains approximately 60 times of enrichments, from last 1 100 clones that take turns picking, prepare phage antibody, by ELISA method, carry out primary dcreening operation, found that 20 clones that can be combined with people COX-2 antigen, use again ferritin (Fer) and ovalbumin (OA) in contrast antigen carry out Phage-ELISA evaluation, only 8 clones' phage antibody can with people COX-2 specific binding, nothing to do with antigen does not possess binding characteristic (accompanying drawing 1).

2. the expression of soluble single-chain antibody and combination are active

Active in order to detect the phage antibody of acquisition and the combination of people COX-2, the phage antibody supernatant of 8 positive colonies is infected to the bacterial strain HB2151 suppressing without amber, IPTG induction soluble single-chain antibody expression, with the coated elisa plate of people COX-2, take solubility expression supernatant, Anti-V5 monoclonal antibody and HRP-goat anti-mouse igg is antibody, carry out ELISA detection, result shows to only have 4 clones to have specific binding activity (accompanying drawing 2).Through order-checking and subsequent analysis result, show, in conjunction with the highest full length gene 762bp cloning for No. 12 of activity, sequence as described in Sequence No.1,254 amino acid of encoding, sequence is as described in Sequence No.3.This antibody can with COX-2 specific binding, so we are defined as anti-COX-2 human single chain variable fragments antibody, called after ANX-2, and carried out a series of research.

3. solubility expression, purifying and the evaluation of anti-COX-2 human single chain variable fragments antibody ANX-2

The IPTG induction supernatant of ANX-2/HB2151 is carried out to ammonium sulfate precipitation, and precipitation is carried out affinity purification after dissolving and dialysing.Because bacterioprotein may contain poly Histidine, and there is non-specific binding, in order to obtain the albumen that purity is higher, once carried out repeatedly purification condition and grope.When with containing the binding buffer liquid of 10mM imidazoles, containing the lavation buffer solution of 40mM imidazoles, better containing the elution buffer purification effect of 500mM imidazoles.Result as shown in Figure 3, is analyzed through SDS-PAGE, and an obvious protein band appears in the solution that 500mM imidazoles elutes at about 31kD place.Through BandScan scanning analysis, purity of protein is about more than 95%.By the anti-COX-2 single-chain antibody of purifying, after SDS-PAGE electrophoresis, the anti-V5Tag monoclonal antibody of take is carried out Western blot analysis to it as primary antibodie.As shown in Figure 4, the anti-COX-2 single-chain antibody sample lane after the upper cleer and peaceful purifying of the ANX-2/HB2151 of IPTG induction has specificity object band to occur to result at 31kDa place, and object band do not detected in the ANX-2/HB2151 supernatant without induction.These results show successfully to have realized solubility expression and the purifying of anti-COX-2 single-chain antibody.The ANX-2 albumen that purifying obtains is stored in-80 ℃, for activity characterization.The activity characterization of the anti-COX-2 human single chain variable fragments antibody of embodiment 2 ANX-2

One, experiment material

MCF-7 Human Breast Cancer Cells and people's liver cancer HepG ₂cell strain provides for Jilin University immunity teaching and research room.For cell cultures, DMEM, calf serum are purchased from Gibco company.DTT, trypsinase, Protein G on Sepharose

4Bfast flow, anti-β-actin mouse monoclonal antibody are purchased from Sigma company, the anti-COX-2 polyclonal antibody of rabbit is purchased from Santa Cruz Biotechnology company, and the goat anti-mouse igg of the goat anti-rabbit igg of HRP mark and HRP mark is purchased from Beijing Ding Guo biotechnology limited liability company.Tissue Culture Plate, culturing bottle, cell are scraped the company purchased from Costar.All the other reagent and material are with reference to embodiment 1.

Two, experimental technique

1.Western blot analyzes the anti-COX-2 single-chain antibody ANX-2 of purifying and the combination of recombinant human COX-2 is active

Recombinant human COX-2 albumen is after 12% SDS-PAGE electrophoresis; Half dry type transfer groove 100mA transferase 12 h, arrives protein delivery on nitrocellulose (NC) film; Take out NC film, after PBST washing, put into 5% skim-milk-PBST room temperature sealing 1h; NC film is taken out and puts into ANX-2 (being dissolved in 5% skim-milk-PBST) incubated at room 2h; The Anti-V5 monoclonal antibody that adds suitable dilution after washing is primary antibodie, and the goat anti-mouse igg of HRP mark is two anti-, the appearance of ECL luminescence reagent box testing goal band.

2.ELISA method detects the competitive binding of anti-COX-2 polyclonal antibody and anti-COX-2 single-chain antibody ANX-2

With the coated elisa plate of the recombinant human COX-2 albumen of 2 μ g/ml 4 ℃, spend the night; Seal 2h with 0.05%BSA-PBST next day; Then every hole adds the ANX-2 of 50 μ l purifying, adds the anti-COX-2 polyclonal antibody of isopyknic rabbit jointly to hatch (gained A as competitive inhibitor (diluting by 1:2000 with 0.05%BSA-PBST) ₄₉₀value suppress rear A value), using not with competitive inhibitor as positive control (gained A ₄₉₀value suppress front A value), not add ANX-2, only add the negative contrast of the anti-COX-2 polyclonal antibody of rabbit, after hatching 2h, add anti-V5 mouse monoclonal antibody (diluting by 1:5000 with 0.05%BSA-PBST) to hatch 2h, add again HRP-goat anti-mouse igg (pressing 1:5000 dilution with 0.05%BSA-PBST), take OPD as the colour developing of substrate lucifuge, read A ₄₉₀value.With following formula, calculate inhibiting rate: inhibiting rate=100% * (the rear A value of A value-inhibition before suppressing)/A value before suppressing

3.ELISA method detects the binding specificity of single-chain antibody and COX-2

With the coated elisa plate of the recombinant human COX-2 albumen of 2 μ g/ml 4 ℃, spend the night; Seal 2h with 0.05%BSA-PBST next day; Simultaneously single-chain antibody (being diluted to 20ug/ml) is diluted to 200ug/ml with COX-2(with 3% skimmed milk-PBST respectively) and BSA(with 3% skimmed milk-PBST, be diluted to 200ug/ml) equal-volume mixes, and hatches 1h for 37 ℃; Then every hole add 100 μ l in advance 37 ℃ of corresponding solution (COX-2 of ANX-2+ purifying of the ANX-2 of purifying, purifying is, the ANX-2+BSA of purifying) of hatching 1h hatch and add after 2h anti-V5 mouse monoclonal antibody (with 0.05%BSA-PBST by 1:5000 dilution) to hatch 2h, add again HRP-goat anti-mouse igg (pressing 1:5000 dilution with 0.05%BSA-PBST), take OPD as the colour developing of substrate lucifuge, read A ₄₉₀value.

4. the mensuration of anti-COX-2 single-chain antibody ANX-2 avidity

First with the COX-2 protein 10 0 μ l through 2n gradient dilution, in 4 ℃ of coated polystyrene board, spend the night; Abandon supernatant next day, with 0.05%BSA-PBST 200 μ l sealing 1h; Add again the ANX-2 100 μ l incubated at room 2h through 2n gradient dilution; Abandon supernatant, add anti-V5 mouse monoclonal antibody (diluting by 1:5000 with 0.05%BSA-PBST) to hatch 2h; Abandon supernatant, then add 50 μ l HRP-goat anti-mouse iggs (pressing 1:5 000 dilution with 0.05%BSA-PBST); Take OPD as the colour developing of substrate lucifuge, read the value of OD490.Then according to formula (n[Ab1]-[Ab])/(n-1) calculate the affinity costant of ANX-2, the extension rate that n is ANX-2, Ab and Ab1 represent respectively when antigen concentration is Ag and Ag1, the ANX-2 concentration that 1/2MaxOD490 is corresponding.

5.MCF-7, the cultivation of HepG2 cell

MCF-7, HepG2 cell cultures is in containing in the DMEM perfect medium of 10% calf serum, in 37 ℃ of saturated humidities, 5%CO2 incubator, cultivates.Cell attachment growth, every 3-5 days trypsin digestion and cell, the cultivation of going down to posterity.

6.Western blot experiment

By the MCF-7 collecting, HepG2 cell (every pipe approximately 2 * 10 ⁶individual) add 20 μ l SDS-PAGE sample-loading buffers, mix rear ice bath 30min, after boiling water boiling sample 3-5min, carry out 12%SDS-PAGE electrophoresis; Half dry type transfer groove 100mA transferase 12 h, arrives protein delivery on nitrocellulose (NC) film; Take out NC film, after PBST washing, put into 5% skim-milk-PBST room temperature sealing 1h; NC film is taken out and puts into ANX-2 (5% skim-milk-PBST dilution) incubated at room 2h; The anti-V5 antibody (1:5 000 is diluted in 5% skim-milk-PBST) of take is again primary antibodie, and the goat anti-mouse igg of HRP mark is two anti-, the appearance of ECL luminescence reagent box testing goal band.

7. immunoprecipitation experiment

The cold PBS washed twice containing 1mM PMSF for HepG2 cell of logarithmic growth in 6 orifice plates will be cultivated, every hole adds cell pyrolysis liquid, with cell sleaker, is scraped, and is put in 1.5ml Eppendorf pipe, ice-bath ultrasonic twice, rear 15 000rpm4 ℃ centrifugal 10min; Get supernatant, add ANX-2, in 4 ℃, slowly put upside down 2h; Add again anti-V5 mouse monoclonal antibody, in 4 ℃, slowly put upside down 2h; Add again Protein G on Sepharose

4 ℃ of 4Bfast flow slowly put upside down and spend the night, and 8 000rpm4 ℃ of centrifugal 3min, abandon supernatant; Cell pyrolysis liquid washing 2 times, abandons supernatant, and precipitation adds after 20 μ l SDS-PAGE sample-loading buffer heat denatured, and electrophoresis is Western blot and is analyzed.It is primary antibodie that Western blot be take anti-COX-2 rabbit polyclonal antibody, and the goat anti-rabbit igg of HRP mark is two anti-, the appearance of ECL luminescence reagent box testing goal band.

Three, results and analysis

1. the anti-COX-2 single-chain antibody ANX-2 of purifying has with the combination of recombinant human COX-2 active

Active in order further to detect anti-COX-2 single-chain antibody and recombinant human COX-2 protein binding, with the negative contrast of pET28b-COX-2/BL21 (DE3) bacterial sediment without IPTG induction, by the recombinant human COX-2 albumen of itself and purifying after SDS-PAGE, transfer on NC film, first be combined with anti-COX-2 single-chain antibody, and then react with the goat anti-mouse igg of anti-V5 antibody and HRP mark, the ECL observation of developing, there is an obvious specific band in the recombinant human COX-2 protein sample of purifying, and in negative control group, do not find object band (accompanying drawing 5), this result has further verified that the anti-COX-2 single-chain antibody of purifying can specific binding people recombinant C OX-2 albumen.

2. the anti-COX-2 single-chain antibody of anti-COX-2 polyclonal antibody competitive inhibition ANX-2 is combined with antigen

In order to detect the ability of anti-COX-2 polyclonal antibody and ANX-2 competitive binding COX-2, carried out competitive ELISA experiment.In the ANX-2 of purifying, sneaking into the anti-COX-2 polyclonal antibody of rabbit is after experimental group suppresses as competitive inhibitor, before usining and only adding ANX-2 and do not add the anti-COX-2 polyclonal antibody of rabbit and suppress as positive control, detect the anti-COX-2 polyclonal antibody of rabbit and ANX-2 competition in conjunction with the ability of recombinant human COX-2, as shown in Figure 6, according to formula (inhibiting rate=(the rear A value of A value-inhibition before suppressing)/A value x100% before suppressing), can calculate the anti-COX-2 polyclonal antibody of rabbit is 35.51% to the competitive inhibition rate of ANX-2 to result.Experimental group and positive control have significant difference (P<0.01).From competitive inhibition rate, can find out, the anti-COX-2 polyclonal antibody of rabbit can competitive inhibition ANX-2 in conjunction with recombinant human COX-2.

3. anti-COX-2 single-chain antibody specific binding COX-2

In order to detect the specificity of the combination of single-chain antibody and COX-2, experimental group is the mixed solution group after single-chain antibody is hatched with recombinant human COX-2 albumen in advance, and control group is the mixed solution group after single-chain antibody is hatched with BSA separately or in advance.Result as shown in Figure 7, compare with control group, the binding ability of the single-chain antibody of hatching with antigen protein in advance and coated recombinant human COX-2 albumen significantly decline (P<0.01), hatch with BSA albumen the binding ability (P ﹥ 0.05) that does not affect single-chain antibody and coated recombinant human COX-2 albumen in advance, according to formula: inhibiting rate=(before suppressing after A value-inhibitions A value) front A value x100% of/inhibition can calculate single-chain antibody in advance with antigen hatch single-chain antibody is combined with antigen inhibiting rate be 87.85%, this significant restraining effect shows that the combination of single-chain antibody and COX-2 is specific.

4. the mensuration of anti-COX-2 single-chain antibody ANX-2 avidity

Application using non-competitive ELISA method, the concentration of antibody of take is X-coordinate, the OD490 value of antigen antibody reaction of take is made typical curve (accompanying drawing 8) as ordinate zou, according to curve and calculation formula (n[Ab1]-[Ab])/(n-1) the calculate affinity costant of anti-COX-2 single-chain antibody, n is the extension rate of ANX-2, Ab and Ab1 represent respectively when antigen concentration is Ag and Ag1, the ANX-2 concentration of 1/2Max OD490.By calculating the value of avidity, be (2.31 ± 0.78) * 10 ⁸m ^-1.

Anti-COX-2 single-chain antibody ANX-2 can with COX-2 protein binding in tumour cell

Due to this, testing anti-COX-2 single-chain antibody used is to take the recombinant human COX-2 albumen of prokaryotic expression from people source Phage Antibody Library, to obtain as antigen, and the ability that therefore must whether have in conjunction with the COX-2 albumen under native state it detects.For this reason, we have adopted respectively Western blot and immunoprecipitation technology to detect the anti-COX-2 single-chain antibody ANX-2 of purifying and whether the COX-2 of expression in tumor cells has interaction.

5.1?Western?blot

Active in order to detect the endogenous COX-2 protein binding of ANX-2 and cell, the MCF-7 that collection is obtained, HepG2 cell pyrolysis liquid is through SDS-PAGE electrophoresis, transfer on NC film, first hatch with ANX-2, and then react with the goat anti-mouse igg of anti-V5 antibody and HRP mark, ECL luminescence reagent box develops.Shown in result accompanying drawing 9, at about 72kD place, there is an obvious specific band (accompanying drawing 9), and (do not react with ANX-2 in negative control group, only add anti-V5 antibody) in do not find object band (accompanying drawing 9), using β-actin as the internal reference contrast of cell pyrolysis liquid Western blot albumen application of sample, and each is organized β-actin in sample and all detects band clearly.

5.2 co-immunoprecipitation

After the HepG2 lysis that collection is obtained, in supernatant, add successively ANX-2, V5 monoclonal antibody and Protein G on Sepharose

4B fast flow is hatched, and hatches precipitation and carries out SDS-PAGE and Western blot analysis.The anti-COX-2 rabbit polyclonal antibody of take when Western blot detects is primary antibodie, the goat anti-rabbit igg of HRP mark is two anti-, result as shown in Figure 10, at 72kD place, there is specific band, and without band, occur in the negative control group that does not add ANX-2, further proved the specificity of ANX-2 and COX-2 combination.

The clone of single-chain antibody ERANX-2 gene and the structure of recombinant eukaryon expression vector in the anti-COX-2 people of embodiment 3 source born of the same parents.For the ease of reading, this patent " single-chain antibody gene in anti-COX-2 people source born of the same parents " is hereinafter to be referred as " ERANX-2 "

One, experiment material

1. bacterial strain and plasmid

PcDNA3.1(+) plasmid is purchased from Invitrogen company; Intestinal bacteria E.coli JM109 is purchased from Beijing Ding Guo Bioisystech Co., Ltd.

2. the main related reagent of molecular cloning

Restriction enzyme Hind III, EcoR I, T4DNA ligase enzyme and corresponding damping fluid thereof, Taq archaeal dna polymerase and corresponding damping fluid thereof, dNTP is purchased from Dalian precious biotechnology company limited.Plasmid extraction purification kit is purchased from Promega company.DNA reclaims test kit, nucleic acid molecular weight standard (1kb Ladder and DL-2000DNA Marker) purchased from Beijing Ding Guo Bioisystech Co., Ltd.The required agarose of agarose gel electrophoresis, ethidium bromide, Tris etc. are purchased from Sigma company.All the other reagent and material are with reference to embodiment 1 and 2.

2. design of primers

The P1 (FP) (5 '-CCCAAGCTTATGGGATGGAGCTGTATCATCCTCTTCTTGGTATCAACAGCTACAGC TGTCCACTCCGCCCAGTCTGTGCTGACGCAGCC-3 ') of take is forward primer, take P2 (RP) (5 '-GGAATTCTTACAGCTCGTCCTTACGCGGTTCCAGCGGATCCGGATACGGCACCGGC GCACCTGAGGAGACGGTGACCAGGGT-3 ') as reverse primer structure intracellular antibody ERANX-2.This is tested primer used and is synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.

Two, experimental technique

(1) acquisition of ERANX-2 gene fragment

1. polymerase chain reaction (PCR)

In order to prepare single-chain antibody gene ERANX-2 in anti-human COX-2 born of the same parents by the method for directed cloning, and can be built in carrier for expression of eukaryon pcDNA3.1, we have designed two primers of P1/P2.Concrete sequence is shown in material part.

The anti-COX-2 human single chain variable fragments antibody Gene A NX-2 sequence screening from the phage antibody library of people source of take is template, single-chain antibody (ERANX-2) gene in the anti-human COX-2 born of the same parents that locate by the method amplification endoplasmic reticulum of PCR.

Schedule of operation: (1) 94 ℃, 4min; (2) 94 ℃, 45sec; (3) 55 ℃, 45sec; (4) 72 ℃, 45sec; (5) 72 ℃, 10min. wherein (2)-(4) carry out 30 circulations.

The recovery of 2.PCR amplified production

PCR product is separated through 1% agarose gel electrophoresis, according to DNA, reclaim purification kit reclaims and checks.

(1), after electrophoresis finishes, on gel imaging instrument, with scalpel, cut the agarose containing object fragment; (2) put into load weighted Eppendorf pipe in advance, weigh, smash to pieces, in 1:3(weight/mg: ratio volume/μ l) adds solution A; (3) 50 ℃ of metal bath 10min, dissolve completely to glue, at room temperature, add solution B, fully mix, and solution is transferred to respectively standing 2min in centrifugal column, and the centrifugal 1min of 8500rpm abandons liquid (if solution once cannot not add completely, can be centrifugal at twice); (4) abandon liquid, add 500 μ l solution C, 8500rpm is centrifugal, and 1min abandons liquid; Repeat once; (5) the centrifugal 1min of 12000rpm, dries remaining liq, removes residual alcohol; (6) centrifugal column is placed in to new centrifuge tube room temperature is spacious cover 8min, ethanol volatilization is use up; (7) add preheating solution D, the centrifugal 10min of 15000rpm, precipitation is target DNA.The DNA that takes a morsel carries out 1% agarose gel electrophoresis, and purity and the concentration of fragment is reclaimed in check.

3. the enzyme of object fragment is cut and is reclaimed

Hind III and the EcoR I double digestion reaction system of the pcr amplified fragment product reclaiming

Above-mentioned mixed solution is in 37 ℃ of metal bath digestion 1.5-2h, and product carries out 1% agarose gel electrophoresis, reclaims the object fragment (method is the same) of about 890bp, and 1% agarose gel electrophoresis is checked its recovering effect, and-20 ℃ save backup.

(2) acquisition of pcDNA3 carrier segments

Plasmid pcDNA3 is carried out to Hind III and EcoR I double digestion, 37 ℃ of digestion 1.5-2h, 1% sepharose, the object fragment of the separated about 5.4kb of 98mA electrophoresis 30-40min.

It is as follows that the enzyme of vector plasmid pcDNA3.1 is cut system:

With DNA, reclaim test kit and reclaim carrier segments pcDNA3.1, method is the same.1% agarose gel electrophoresis, fragment is reclaimed in check.

(3) being connected of carrier and goal gene: goal gene fragment and pcDNA3.1 enzyme are cut to large fragment and be connected by T4DNA ligase enzyme, obtain recombinant plasmid pERANX-2.Building process is shown in Fig. 1.Linked system is as follows:

Mix, 16 ℃ of metal baths connect 12-16h.

(4) preparation of JM109 competent cell

(1) frozen in the JM109 of-80 ℃ of refrigerators bacterial classification with aseptic inoculation ring scraping, streak inoculation, in not containing the LB agar plate of penbritin (Amp), is cultivated 16h left and right for 37 ℃; (2) the single colony inoculation of picking is in 5ml liquid LB substratum, and 37 ℃ of 180rpm joltings are cultured to OD60 ₀=0.4; (3) microbial culture pipe is taken out, more than being placed in rapidly ice bath 15min, make culture be cooled to 0 ℃; (4) under aseptic condition, inoculum is transferred in the 1.5ml Eppendorf pipe of aseptic, ice precooling (following operation all needs aseptic), 4 ℃, the centrifugal 10min of 4000rpm, abandon supernatant; (5) with the 0.1mol/L CaCl of 500 μ l ice precoolings ₂the resuspended bacterial precipitation of solution, ice bath 30min; (6) 4 ℃, the centrifugal 10min of 4000rpm, collect thalline, through the CaCl of 80 μ l ice precoolings ₂eddy diffusion thalline, is placed in 4 ℃ of refrigerator ice baths by competent cell standby.

(5) plasmid transforms

(1) connection product is joined in competent cell, mix gently, ice bath 30min; (2) pipe is put into 42 ℃ of metal baths, heat-shocked 2min; (3) fast transfer is in ice bath, cooling 2min; (4) every pipe adds the LB liquid nutrient medium of 900 μ l37 ℃ preheatings, 37 ℃, 150rpm shaking culture 45min; (5) 4000rpm, 4 ℃ of centrifugal 5min; (6) abandon 700-800 μ l supernatant, with remaining supernatant re-suspended cell, coat containing in the LB nutrient agar of 100 μ g/ml acillin resistances (Amp) standing 10min; Be inverted for 37 ℃ and cultivate 12～16h, occur recon bacterium colony.4 ℃, transformed bacteria dish saves backup.

(6) evaluation of expression plasmid pERANX-2

1. a small amount of extraction and purification of expression plasmid pERANX-2 (extracting in a small amount plasmid with reference to < < molecular cloning experiment guide > > alkaline lysis)

(1) the single positive colony of picking transformant, is inoculated in 5ml containing 100 μ g/ml Amp ⁺lB liquid nutrient medium in, 37 ℃, 180-200rpm shaking culture 12～16h; (2) bacterium liquid is sub-packed in 1.5ml Eppendorf pipe, and 15000rpm, 4 ℃ of centrifugal 5min receive bacterial sediment; (3) the solution I that adds the precooling of 0.1mL ice, blows outstanding precipitation, standing 5min; (4) add the 0.2mL solution II of now joining, put upside down and mix; (5) add the pre-cold soln III of 0.15mL ice, put upside down and mix gently; (6) ice bath 15min, 15000rpm4 ℃ of centrifugal 5min; (7) collect supernatant, add the dehydrated alcohol of 2.5 times of volumes, the standing 20min of room temperature; (8) 15000rpm4 ℃ of centrifugal 15min; (9) abandon supernatant, add 70% washing with alcohol of 2.5 times of volume precoolings, 15000rpm4 ℃ of centrifugal 5min; (10) abandon supernatant, control is dry, and rotary evaporation in vacuo is dry; (11) precipitation is dissolved in (containing 50 μ g/ml RNaseA) in 50 μ l TE, 37 ℃ of 30min, and 1% agarose gel electrophoresis check ,-20 ℃ save backup.

2. the enzyme of recombinant plasmid is cut evaluation

The recombinant plasmid that utilizes digestion with restriction enzyme method initial survey to extract.Recombinant plasmid is carried out to Hind III and EcoR I double digestion, 37 ℃ of digestion 1.5-2h, 1% sepharose, 98mA electrophoresis 30-40min, observes on gel image analyser.

The Hind III of pERANX-2 plasmid and EcoR I double digestion reaction system:

3. the sequencing of recombinant plasmid

By Shanghai, Sheng Gong biotechnology company limited checks order.

Three, results and analysis

In order to obtain single-chain antibody gene in the anti-COX-2 people source born of the same parents that are positioned endoplasmic reticulum, we take anti-COX-2 human single chain variable fragments antibody ANX-2 gene is template, with the primer that contains endoplasmic reticulum signal for locating, Hind III and EcoR I restriction enzyme site sequence and E-tag labelled peptide sequence, by single-chain antibody ERANX-2 gene in the anti-COX-2 people of the method amplification endoplasmic reticulum location type source born of the same parents of PCR.PCR product finds at about 890bp place, there is an obvious DNA band (Figure 11 A) after agarose gel electrophoresis; Product reclaims rear clone between the restriction enzyme Hind III and EcoR I in the CMV promotor downstream of eukaryon expression plasmid pcDNA3.1; Positive recombinant plasmid is through restriction enzyme Hind III and EcoR I double digestion, and agarose gel electrophoresis is found, at 5400bp and 890bp place, occurred respectively an obvious DNA band (Figure 11 B).Further by the object fragment on T7 and the logical carrier pERANX-2 of the positive and negative two-way survey of BGH universal primer, sequencing result shows, insertion sequence is consistent with experimental design, and reading frame is entirely true, this explanation has successfully been introduced endoplasmic reticulum signal for locating, E-tag detection label etc. by pcr amplification, ERANX-2 full length gene 873bp, and sequence is as described in Sequence No.2,291 amino acid of encoding, sequence is as described in Sequence No.4.This illustrates that we have successfully obtained the carrier for expression of eukaryon pERANX-2 of restructuring intracellular antibody ERANX-2 gene.

The anti-COX-2 single-chain antibody of embodiment 4 is at intracellular analysis of biological activity

One, experiment material

1. molecular biology related reagent and material

Go intracellular toxin plasmid extraction kit purchased from OMEGA company; Reverse transcription PCR (RT-PCR) test kit is purchased from Dalian precious biotechnology company limited; All the other are with reference to embodiment 1-3.

2. cell cultures, transfection, active detection reagent and material

Liposome (Lipofectamine 2000), G418, Trizol are Invitrogen company product; Hoechst 33342 is purchased from Sigma company; RIPA lysate is purchased from green skies Bioisystech Co., Ltd; Anti-E-tag antibody is purchased from Phamarcia company; FITC mark goat anti-mouse IgG is purchased from Beijing Ding Guo biotech company; All the other are with embodiment 1-3.Human prostate element E2(PGE2) enzyme-linked immunoassay kit is purchased from Shanghai Bang Yi commerce and trade Science and Technology Ltd..The required primer of RT-PCR is synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.

(1) RT-PCR amplification intracellular antibody primer sequence: forward primer P3 is 5 '-CCCAAGCTTATGGGATGGAGCTGT-3 ', and reverse primer P4 is 5 '-CCGCTCGAGGATAACTTCGTATAGTATACA TTATA-3 ', and amplified production is 470bp; (2) the synthetic primer sequence of β-actin in amplifying cells: forward primer P5 is 5 '-TGGAATCCTGTGGCATCCATGAAAC-3 ', and reverse primer P6 is 5 '-TAAAACGCAGCTCAGTAACAGTCCG-3 ', and amplified production is 350bp.

4. the preparation of related solution is with reference to < < molecular cloning experiment guide > >.

Two experimental techniques

1. the preparation (with reference to removing intracellular toxin plasmid extraction kit specification sheets) of plasmid for transfection

1.1 use front preparation work

RNaseA subsidiary in test kit is added in Solution I to 4 ℃ of preservations; In DNA Washing Buffer, add 60mL dehydrated alcohol to dilute, the DNA Washing Buffer room temperature preservation after dilution.

1.2 operation schemes (institute at room temperature carries out according to test kit specification sheets in steps)

(1) the inoculum of incubated overnight is transferred in a clean 5mL centrifuge tube, and the centrifugal 10min of 5000g room temperature abandons supernatant, collects bacterial sediment; (2) add 500 μ L Solution I, bacterial sediment is hanged, and transfer them in 1.5mL centrifuge tube; (3) add 500 μ L Solution II, turn upside down four times, the standing 2min of room temperature; (4) the Buffer N3 that adds 250 μ L ice baths, turns upside down four times, until there is white flocks, 12000g, 4 ℃, centrifugal 10min; (5) supernatant is transferred in a 1.5mL centrifuge tube carefully, added the ETR Solution of 0.1 volume, ice bath 10min, puts upside down several times therebetween; (6) 42 ℃ of lysates are hatched to 5min, the centrifugal 3min of 12000g, ETR Solution can form in bottom a blue band; (7) supernatant is transferred in 1.5mL centrifuge tube, and adds the dehydrated alcohol of 0.5 volume, fully mix, the standing 1～2min of room temperature; (8) above mixture 700 μ L are transferred to one and be enclosed within 2mL collection tube center pillar II, room temperature is centrifugal, 10000g, 1min; Effluent liquid is outwelled, pressed aforesaid operations, surplus solution is transferred in post also centrifugal again; (9) with 500 μ L HB Buffer, wash post, room temperature is centrifugal, 10000g, 1min; (10) outwell effluent liquid, the DNA Wash Buffer that contains ethanol with 700 μ L washes post, and room temperature is centrifugal, 10000g, and 1min, outwells effluent liquid, repeats this operation once; (11) outwell effluent liquid, by the centrifugal 13000g of void column, 3min, to be dried the medium of post, particularly removes ethanol; (12) post is placed in to a new 1.5mL centrifuge tube, adds Buffer(70 ℃ of preheating of Endotoxin-Free Elution of 100 μ L), the standing 2min of room temperature, 13000g, centrifugal 3min is with eluted dna; (13) abandon recovery post, eluted dna be stored in-20 ℃ standby.

The quantity and quality of 1.3 DNA

100 times of the DNA diluted samples that extracting is obtained, measure respectively it in the absorbancy at 260nm and 280nm place, obtain the ratio of DNA concentration (μ g/mL) and A260 and A280.The ratio of A260 and A280 can show nucleic acid purity, the ratio of this requirement of experiment should be between 1.8-2.0.

2. cell cultures

HepG2 cell cultures is in containing in the DMEM nutrient solution of 10% calf serum, in 37 ℃ of saturated humidities, 5%CO2 incubator, cultivates.Cell attachment growth, every 2-4 days trypsin digestion and cell, the cultivation of going down to posterity.

3. the foundation of stable transfected cells strain

By the HepG2 cell that changes liquid before the good 24h of growth conditions by 1 * 10 ⁶the density in cells/ hole is seeded in 6 orifice plates, 37 ℃, saturated humidity, 5%CO ₂in incubator, cultivate, when 6 orifice plate inner cells growths reach, when 90-95% converges, get final product transfection.Specific as follows:

(1) obtain solution A: be 250 μ L with not being mixed to gently cumulative volume containing antibiotic DMEM nutrient solution by 4 μ g plasmid DNA; (2) obtain solution B: 10 μ L LipofectAMINETM2000 and 240 μ L are not mixed to incubated at room 5min containing antibiotic DMEM nutrient solution; (3) solution B is joined in solution A, fully mix incubated at room 20min; (4) the cell in 6 orifice plates is not washed to twice containing antibiotic DMEM nutrient solution with serum-free, every hole adds 2mL not containing antibiotic DMEM nutrient solution; (5) add said mixture, 37 ℃, saturated humidity, 5%CO ₂cultivate; (6) after transfection, 72h digests transfectional cell, according to the 1:10 cultivation of going down to posterity, adds 400 μ g/mL G 418 to carry out resistance screening simultaneously, within every 3 days, changes liquid once and keeps the concentration of G 418.After approximately 2 weeks, empty map group cell is all dead, occurs positive colony, progressively reduces G 418 concentration to 200 μ g/mL and maintains screening.The strain of enlarged culturing stable transfected cells, frozen, correlation detection is standby.

The stably express analysis of 4.ERANX-2

4.1 RT-PCR detect

4.1.1 the extraction of total RNA

The HepG2 groups of cells of the stable transfection screening is digested respectively, and cold PBS washes after 2 times, adds 0.5mlTrizol extracting solution, and room temperature is placed 5min; Add 0.1ml chloroform concuss 15s, the standing 3min of room temperature; 4 ℃ of centrifugal 15min of 12000g; Upper strata water proceeds in new centrifuge tube, adds 0.25ml Virahol, mixes, and room temperature is placed 10min; 4 ℃ of centrifugal 10min of 12000g; Precipitation is washed once with 1ml75% ethanol (preparation of DEPC water); 4 ℃ of centrifugal 5min of 10000g; Air drying, adds appropriate DEPC water dissolution (55-60 ℃ of water-bath 10min hydrotropy), and 80 ℃ of Cun Yu – are standby.

4.1.2?RT-PCR

The mRNA extracting of take is initiator, according to the explanation of RT-PCR test kit, adds respectively the required various compositions of reverse transcription reaction to carry out RT reaction, and its condition is: 30 ℃ of 10min, 45 ℃ of 30min, 99 ℃ of 5min, 5 ℃ of 5min; 94 ℃ of 2min.From reaction mixture, respectively get 5 μ l and put into new PCR pipe, add successively the upstream and downstream primer P3 of 100pmol and upstream and downstream primer P5 and the P6 of P4 or β-actin, 5 μ l PCR damping fluids (10 *), the dNTP of 2.5mmol/L and the archaeal dna polymerase of 5U (Taq DNA Polymerase), final volume is 50 μ l; Place in PCR instrument and carry out pcr amplification, reaction parameter is 94 ℃ of 30S, 50 ℃ of 30S, 72 ℃ of 1min, 30 circulations; Finally in 72 ℃, extend 10min.After amplification, carry out 1% agarose gel electrophoresis check.

5. indirect immunofluorescence experiment

The slide glass of aseptically process is put in 6 well culture plates, and cell is seeded to respectively in 6 orifice plates by suitable density, 37 ℃ of saturated humidities, 5%CO ₂in incubator, cultivate, cell can be attached on slide glass naturally.When 6 orifice plate inner cells growths reach while more than 80% converging, cell climbing sheet is taken out from 6 well culture plates, 37 ℃ of D-Hanks wash 2 times, 5min/ time; By the sucking-off of D-Hanks liquid, 4% paraformaldehyde is 30min fixedly; Dd H ₂o washing 3 times, is respectively 10min, 10min, 5min; Blower fan dries up, and-20 ℃ save backup;-20 ℃ are taken out slice, thin piece room temperature aquation 20min; PBST washs 10min, PBS washing 3 times, each 5min; 0.01% trysinization 40s, PBS washing 3 times, each 5min; 3%H ₂o ₂room temperature blocking-up 20min, PBS washing 3 times, each 5min; 3%BSA-PBST seals 20min, PBST washing 3 times, each 10min; The anti-E-tag mouse monoclonal antibody that adds PBST dilution (1:125), 4 ℃ are spent the night; PBST washing 3 times, each 10min; The FITC-goat anti-mouse IgG that adds PBST dilution (1:100), lucifuge room temperature 20min; PBST washing 3 times, each 10min; The Hoechst33342 that adds 2 μ g/mL, room temperature lucifuge 20min; PBST fully washs; Glycerine mounting, upper machine is observed.

6.Western-blot analyzes

The HepG2 cell of collecting stable transfection, cold PBS washes 2 times; The RIPA fine melt liquid (containing 1mM PMSF) that adds approximately 500 μ L, on ice cracking 40min-1h; Ultrasonication, 15000rpm, 4 ℃ of centrifugal 3-5min, results supernatant liquor, carries out SDS-PAGE, with half dry type electroporation by protein delivery to nitrocellulose filter; After transferring film, by the PBST room temperature sealing 1h containing 5% skim-milk for film, add 4 ℃ of the primary antibodies of confining liquid dilution to spend the night, PBST washing 3 times, each 10min; The goat anti-mouse igg that adds the HRP mark of confining liquid dilution (1:5000), room temperature 1h, PBST washing 3 times, each 10min, utilizes ECL test kit to develop.Note: anti-E-tag mouse monoclonal antibody Dilution ratio (1:1000), anti-β-actin mouse monoclonal antibody Dilution ratio (1:5000).

7. co-immunoprecipitation experiment

The cold PBS washed twice containing 1mM PMSF for cell of logarithmic growth in 6 orifice plates will be cultivated, every hole adds the weak RIPA lysate of 500 μ l (containing 1mM PMSF), with cell sleaker, is scraped, and is put in 1.5mlEppendorf pipe, ice bath 40min, ultrasonication; 15000rpm4 ℃ of centrifugal 5min; Get supernatant, in each sample supernatant, add anti-E-tag antibody, 4 ℃, slowly put upside down, more than 1h; Add 20 μ L Protein G on Sepharose, 4 ℃, slowly put upside down, spend the night; 8000rpm, 4 ℃, centrifugal 3min, discards supernatant; With the RIPA lysate washing precipitation a little less than 500 μ L once, then use 0.01M PBS washed twice, each 10min; To precipitation in add 20 μ L1 * SDS-PAGE sample-loading buffers, carry out SDS-PAGE, afterwards by protein delivery to NC film, with reference to above-mentioned experimental technique, the anti-COX-2 polyclonal antibody of take is primary antibodie, and the goat anti-rabbit igg of HRP mark is two anti-, carries out Western-blot experiment.

8.PGE2 horizontal analysis

The centrifugal cells and supernatant of cultivating logarithmic growth in 6 orifice plates of collecting, with reference to PGE2ELISA detection kit specification sheets, application double antibody sandwich method is measured human prostate element E2 (PGE2) level in sample.The coated microwell plate of human prostate element E2 (PGE2) antibody with purifying, make insolubilized antibody, in the micropore of coated monoclonal antibody, add successively prostaglandin E2 (PGE2), again with prostaglandin E2 (PGE2) antibodies of HRP mark, form antibody-antigen-hrp-antibody complex, after thorough washing, add substrate TMB colour developing.TMB changes into blueness under the catalysis of HRP enzyme, and changes into final yellow under sour effect.The depth of color and the prostaglandin E2 in sample (PGE2) are proportionate.By microplate reader, under 450nm wavelength, measure absorbancy (OD value), by human prostate element E2 (PGE2) concentration in typical curve calculation sample.Experiment Plays product concentration is followed successively by 2400pg/ml, 1200pg/ml, 600pg/ml, 300pg/ml, 150pg/ml, 0pg/ml.On the coated plate of enzyme mark, establish standard substance hole, add successively the standard substance 50ul of different concns, on the coated plate of enzyme mark, in testing sample hole, first add corresponding group culture supernatant 40 μ l, and then add biotin labeled anti-PGE2 antibody 10 μ l.Each sample standard deviation is established three multiple holes, and carries out respectively independent experiment 3 times.

Three, results and analysis

The stably express of 1.pERANX-2 in tumour cell

For the expression that detects ERANX2 with and In vitro biological activity, with liposome LipofectameTM2000 mediation recombinant plasmid pERANX-2 and empty map plasmid pcDNA3.1 transfection HepG 2 cell, through G418 resistance screening, obtain the positive cell clone of stable transfection, in order to identify these clones, after enlarged culturing, test as follows.

1.1 RT-PCR detect the expression of ERANX-2

In order to detect the stably express of ERANX-2 in tumour cell, we have extracted respectively the total RNA of stable transfected cells, take P3 and P4 to have carried out RT-PCR analysis as primer, and in experiment, using β-actin gene as internal reference.PCR product is found after 1% agarose gel electrophoresis, at the corresponding primer (P5 with specific amplification β-actin, while P6) carrying out RT-PCR amplification, all samples all can amplify β-actin fragment of 350bp, and the band brightness basically identical (Figure 12) that in every group, each sample amplifies, and when the corresponding primer with specific amplification ERANX-2 carries out RT-PCR amplification, the cell that only has stable transfection pNANX2, just can amplify the product of about 460bp, and take the cell of empty carrier transfection or the RNA of ghost during as template all without the appearance (Figure 12) of this band, this result has proved that in mRNA level the cell clone that we select is the cell strain of stably express ERANX-2, show tentatively to obtain the cell clone HepG2/pERANX-2 cell strain of stably express ERANX-2.

1.2 indirect immunofluorescence experiment analyses

The cell that the RT-PCR result of take is positive is material, and through a series of processing such as cell climbing sheets, the mouse monoclonal antibody of anti-E-tag of take is primary antibodie, and FITC-goat anti-mouse IgG is two anti-, carries out indirect immunofluorescence experiment analysis.Hoechst 33342 is combined with nuclear area, sends blue-fluorescence.Fluorescence microscope is found, bright yellow-green fluorescence is all sent in the tenuigenin region of the HepG2 cell of pERANX-2 stable transfection, and the tenuigenin region of the HepG2 cell of pcDNA3.1 stable transfection and the HepG2 cell of empty map does not have fluorescence (Figure 13), this shows that ERANX-2 gene obtains effective expression in the tumour cell of stable transfection, and its expression product is distributed in tenuigenin region, further verified the positive cell strain that we obtain.

1.3 Western-blot analyze

In order further to detect the expression of ERANX-2 in stable transfected cells strain, we distinguish the HepG2 cell of cracking stable transfection pERANX-2 and stable transfection pcDNA3.1, and compare with ghost, with anti-E-tag mouse monoclonal antibody, carry out Western-blot detection, the expression level of β-actin in each sample of simultaneously take is internal reference.As shown in Figure 14, in each sample, β-actin gene all has expression to result, and expression amount homogeneous.And the expression of ERANX-2 gene in the cell pyrolysis liquid of the HepG2 cell of screened stable transfection pERANX-2, detected, on the position of about 31kD, an object band detected.And the generation of relevant object band in the cell pyrolysis liquid of stable transfection pcDNA3.1 and ghost, do not detected.This result has proved in the HepG2 of stable transfection pERANX-2 cell and has obtained stable expression, has also further verified the positive cell strain that we obtain simultaneously.

Intracellular antibody ERANX-2 can with tumour cell in COX-2 protein binding

Can in order to detect the expression of intracellular antibody ERANX-2 in HepG2 cell and to be combined with COX-2 in cell, we have carried out co-immunoprecipitation experiment.We take the HepG2 cell of stably express ERANX-2 is material, with transfection cell and the ghost of pcDNA3.1 empty carrier contrast, cell is carried out after cracking, the mouse monoclonal antibody that adds anti-E-tag, hatch, add afterwards Protein G-Sepharose to carry out combination, then the anti-COX-2 polyclonal antibody of take is primary antibodie, the goat anti-rabbit igg of HRP mark is two anti-to carry out Western-blot experiment, found that and in the position of about 72kD, can occur an obvious band, be COX-2 albumen in the cell of being combined with ERANX-2.As shown in Figure 15, this explanation intracellular antibody ERANX-2 has obtained expression to result in HepG2 cell, and is combined with antigens c OX-2.

4.ERANX-2 suppresses COX-2 enzymic activity

We adopt ELISA method to measure respectively to organize the PGE2 level that finally generates and be secreted into via COX-2 enzyme catalysis in HepG2 cell in culture supernatant to carry out the enzymic activity of Analysis for CO X-2.Result as shown in Figure 16, is compared with empty carrier pcDNA3.1 transfectional cell group, and the growing amount of pERANX-2 group cell PGE2 significantly reduces, significant difference (P<0.01).These presentation of results, the expression inhibiting of ERANX-2 the enzymic activity of COX-2 in cell.

The anti-COX-2 single-chain antibody of embodiment 5 anti-tumor activity is analyzed

One, experiment material

1. molecular biology related reagent and material

With reference to embodiment 1-4.

2. cell cultures, transfection, active detection reagent and material

DMSO, MTT, bromination the third pyridine (PI), RNase A are purchased from Sigma company; Annexin V apoptosis detection kit is purchased from Nanjing Kai Ji Bioisystech Co., Ltd; All the other are with embodiment 1-4.

3. the preparation of related solution is with reference to < < molecular cloning experiment guide > >.

Two, experimental technique

1. cell cultures

HepG2 ghost and each stably transfected cell line (preparation is with reference to embodiment 4) are incubated at containing in the DMEM nutrient solution of 10% calf serum, in 37 ℃ of saturated humidities, 5%CO2 incubator, cultivate.Wherein in the nutrient solution of each stably transfected cell line, need to add 200 μ g/mL G 418 to maintain screening pressure.Cell attachment growth, every 2-4 days trypsin digestion and cell, the cultivation of going down to posterity.

2.MTT method detects cell-proliferation activity

(1) inoculating cell: with 0.25% tryptic digestion single-layer culturing cell, be made into individual cells suspension with the DMEM nutrient solution containing 10% calf serum, each organizes cell by 7 * 10 ³the density in cells/ hole is seeded in 96 well culture plates, and 10 parallel holes are established for every kind in 200 μ L/ holes, usings 200 μ L/ hole nutrient solutions as negative control simultaneously.(2) culturing cell: culture plate is moved into CO ₂in incubator, at 37 ℃, 5%CO ₂and under saturated humidity condition, after cultivating 4h, 24h, 48h, 72h, 96h, 120h, take out culture plate respectively, every hole adds 5mg/mL MTT solution 20 μ L, puts back to incubator and continues to cultivate.(3) continue to cultivate after 4h, careful suction abandoned nutrient solution in hole.Add DMSO(150 μ L/ hole) dissolve MTT, vibration 10min mixes, and crystallisate is fully dissolved.(4) colorimetric: select 490nm wavelength, set up each hole absorption value on enzyme-linked immunosorbent assay instrument, record result.Using nutrient solution hole absorbance value as negative control, calculate every kind of cell in the average light absorption value at 490nm wavelength place, take the time as transverse axis, 490nm absorbance value is that the longitudinal axis is drawn cell growth curve.

The 3.FACS analysis of cells cycle

Harvested cell also washs 2 times with cold PBS, then with 4 ℃ of 70% cold ethanol, fixedly spend the night, before detecting, with PBS, clean ethanol, be resuspended in the PBS of 200 μ L containing the PI dye liquor of 50 μ g/mL, add RNase A to final concentration 50 μ g/mL, lucifuge is hatched 30min, and upflowing cytoanalyze detects the changing conditions of cell cycle.

4.Annexin V/PI pair is dyed Flow cytometry analysis

(1) the cell of stable transfection is collected in digestion, and cold PBS washed cell 2 times, collects 5 * 10 ⁵individual cell; (2) draw 2 * Binding Buffer of 250 μ L and the sterilizing deionized water of 250 μ L mixes; (3) use 1 * Binding Buffer suspension cell of above-mentioned 500 μ L; (4) add 1 μ L Annexin V-EGFP to mix, add 5 μ L PI, mix; (5) lucifuge is reacted 10min; (6) with flow cytometer, detect the apoptosis situation of cell.

Three, results and analysis

The growth of 1.ERANX-2 inhibition tumor cell

We adopt MTT colorimetric method for determining respectively to organize the interior Formazan content of HepG2 viable cell plastosome to detect tumour cell colony multiplication capacity.Result as shown in Figure 17, is compared with ghost group with pcDNA3.1 transfectional cell group, and the prolongation in time of the growing amount of pERANX-2 group cell Formazan significantly reduces, significant difference (P<0.01).These presentation of results, the expression of ERANX-2 is played significant restraining effect to the growth of transfectional cell.

2.ERANX-2 causes the cell-cycle arrest of tumour cell

For the expression that the detects ERANX-2 gene impact on the tumour cell cell cycle, we are by DNA content in cells were tested by flow cytometry cell, thereby obtain the per-cent of each Cell Cycle.Result as shown in Figure 18, expressing the positive cell strain of ERANX-2 gene compares with control group, the cell proportion of G0-G1 phase increases, G0-G1 phase cell is increased to 63.78 ± 2.41% by 45.01 ± 1.01%, and S phase cell reduces to 25.37 ± 1.98% by 42.72 ± 2.0%, compare significant difference (P<0.01) with control group.The result shows, the expression of ERANX-2 gene can cause that the tumour cell G1 phase blocks, inhibition tumor cell by the G1 phase to S phase transition, thereby inhibition tumor cell propagation.

3.ERANX-2 can inducing apoptosis of tumour cell

Sample after treatment, with flow cytometer, detect, take Annexin V as X-coordinate, PI is that ordinate zou is made graph discovery, the natural apoptosis rate of HepG2 ghost is 5.05 ± 0.32%, and the apoptosis rate of expressing the positive cell strain of ERANX-2 gene is 21.35 ± 1.23%(Figure 19).Epidemiological Analysis, compares with control group by statistics, and significant difference (P<0.01) (Figure 19).The remarkable inducing apoptosis of tumour cell of expression of this presentation of results ERANX-2 gene.

Claims (4)

1. an anti-cyclooxygenase human single chain variable fragments antibody, is characterized in that: be specific binding the human single chain variable fragments antibody that suppresses people's COX-2, its nucleotide sequence is as described in Sequence No.1.

2. anti-cyclooxygenase human single chain variable fragments antibody according to claim 1, is characterized in that: also comprise ER retention signal peptide KDEL, E-tag labelled peptide gene coded sequence, its nucleotide sequence is as described in Sequence No.2.

3. anti-cyclooxygenase human single chain variable fragments antibody as claimed in claim 1 or 2 has the application in the medicine that suppresses cyclooxygenase-2 activity effect in preparation.

4. anti-cyclooxygenase human single chain variable fragments antibody as claimed in claim 1 or 2 has the application in the medicine of antitumor action in preparation.

Images