CN103540612A - Slow virus recombinant plasmid for inhibiting epithelial-mesenchymal transition of breast tumor - Google Patents

Abstract

The invention relates to a slow virus recombinant plasmid for inhibiting epithelial-mesenchymal transition of breast tumor, belonging to the field of biotechnology. The nucleotide sequence of the slow virus recombinant plasmid is as shown in SEQ ID NO: 1. Through the local injection of the recombinant plasmid for treating breast carcinoma, the activity of tumor-associated protein in the matrix beside the tumor carcinoma can be obviously inhibited. The epithelial-mesenchymal transition can be obviously inhibited through local injection of the FuGW-CSD recombinant plasmid for treating the breast carcinoma, and the transfer of the breast carcinoma is inhibited.

Description

A kind of slow virus recombinant plasmid transforming for suppressing breast tumor Epithelial and stromal

Technical field

The invention belongs to biological technical field, be specially a kind of recombinant plasmid, by expressing object peptide section, interact with tumor metastasis related protein, reach the inhibition object that breast tumor Epithelial and stromal is transformed.

Background technology

Epithelial and stromal transforms (Epithelial-mesenchymal transition, EMT), being that epithelial cell is converted into the cell with interstitial phenotype by specific program, is the core link of the malignant cell acquisition migration and invasion ability in epithelial cell source.

Matrix metalloproteinase (MMP) and transforming growth factor TGF-β are the key protein matter of current known participation EMT.MMP is the ability with degradation of cell epimatrix composition, is the enzyme of current known unique energy degrade collagen fiber, and its activity has certain effect to the inactivation of cell adhesion system.It plays a role in vascularization and metastases at tumor growth; TGF-β mainly promotes the generation of EMT by each integrin signaling pathway, promote the cell transcription process that Smad3 molecule relies on, the signal transduction pathway of the P38MAP kinase pathways that also can rely on by non-Smad molecule and the mediation of GTP enzyme promotes that EMT develops, in the invasion and attack and transfer process of tumour, TGF-β impels cell-cycle arrest, accelerate apoptosis, can also induce the EMT state that maintains.

Cav-1 is combined with TGF-β I kinase activation district by scaffolding district (CSD district), suppresses phosphorylation and downstream activity thereof that TGF regulates Smad-2, plays the effect of kinase inhibitor; CAV gene level is eliminated the expression and secretion of MMP2 and 9, and CAV crosses the secretion of expressing the remarkable MMP of reduction.

Summary of the invention

The invention provides a kind of recombinant plasmid that suppresses breast tumor transfer that is used for the treatment of.

The technical scheme that the present invention takes is: a kind of slow virus recombinant plasmid transforming for suppressing breast tumor Epithelial and stromal, its nucleotide sequence is as described in SEQ ID NO:1.

The slow virus recombinant plasmid transforming for suppressing breast tumor Epithelial and stromal of the present invention, the series connection of caveolin scaffolding district CAV-1 CSD expressed sequence repeats 3 times, this caveolin scaffolding district CAV-1 CSD coding nucleotide sequence as described in SEQ ID NO:3, aminoacid sequence is as described in SEQ ID NO:5, in FuGW slow virus plasmid, under ubiquitination promotor, by BamH I, be connected with Bgl II restriction enzyme site.

The slow virus recombinant plasmid transforming for suppressing breast tumor Epithelial and stromal of the present invention, CAV-1 CSD coding nucleotide sequence in caveolin scaffolding district is as described in SEQ ID NO:2.

The slow virus recombinant plasmid transforming for suppressing breast tumor Epithelial and stromal of the present invention, CAV-1 CSD encoding amino acid sequence in caveolin scaffolding district is as described in SEQ ID NO:4.

Of the present invention as follows for suppressing the construction process of the slow virus recombinant plasmid that breast tumor Epithelial and stromal transforms:

(1) design of the Express Sequence Tags of caveolin scaffolding district CAV-1 CSD: from the expressed sequence in NCBI acquisition CAV-1 CSD district, by this section of sequence series connection in triplicate, at two ends, introduce BamH I and Bgl II isocaudarner restriction enzyme site, according to this section of sequences Design, be used for overlapping the primer of PCR:

primer1-5’:

CAAATATTGGTTTTATCGCGATGGCATTTGGAAAGCGAGCTTTACCACCTTTACCGTGACCAAATATTG；

primer1-3’:

GTCACGGTAAAGGTGGTAAAGCTCGCTTTCCAAATGCCATCGCGATAAAACCAATATTTGGTCACGGTA；

primer2-5’:

GGATCCCGCAGCGATGGCATTTGGAAAGCGAGCTTTACCACCTTTACCGTGACCAAATATTGGTTTTATCG；

primer2-3’: AGATCTGCTGCCGCGATAAAACCAATATTTGGTCACGGTAAAGGTGGTA；

(2) acquisition of the Express Sequence Tags of caveolin scaffolding district CAV-1 CSD: the sequence that obtains tri-series connection of CAV-1 CSD by the method for overlap joint PCR, PCR process is used TaqDNA polysaccharase, single base A is contained at these PCR product two ends, it is connected under the effect of T4 ligase enzyme in T carrier, obtain the T vector plasmid that contains tri-series connection of CAV-1 CSD;

(3) structure of recombinant plasmid FuGW-CSD: the T vector plasmid that step (two) is obtained carries out BamH I and Bgl II double digestion, BamH I and Bgl II are isocaudarners, FUGW slow virus plasmid is carried out to BamH I single endonuclease digestion, and PCR product is cloned under FUGW slow virus plasmid ubiquitination promotor by BamH I restriction enzyme site.

Beneficial effect of the present invention: by the repetition of connecting of CAV-1 CSD region sequence, the method by subclone enters slow virus plasmid, is configured to a recombinant expression plasmid FuGW-CSD; This recombinant plasmid local injection mammary cancer can obviously suppress the activity of tumor correlated albumen in the other matrix of tumour cancer.FuGW-CSD recombinant plasmid local injection mammary cancer can obviously suppress its Epithelial and stromal and transform, and suppresses its transfer.Fill up the blank that does not have at present local injection to suppress the recombinant plasmid of breast tumor transfer, development.

Accompanying drawing explanation

Fig. 1 is the FuGW-CSD plasmid map of invention;

Fig. 2 is the spirogram that contains that FuGW-CSD plasmid reduces EMT marker protein;

Fig. 3 is that FuGW-CSD plasmid suppresses tumor growth and transferring picture.

Embodiment

Suppress the slow virus recombinant plasmid that breast tumor Epithelial and stromal transforms, its nucleotide sequence is as described in SEQ ID NO:1.

The slow virus recombinant plasmid transforming for suppressing breast tumor Epithelial and stromal of the present invention, the series connection of caveolin scaffolding district CAV-1 CSD expressed sequence repeats 3 times, this caveolin scaffolding district CAV-1 CSD coding nucleotide sequence as described in SEQ ID NO:3, aminoacid sequence is as described in SEQ ID NO:5, in FuGW slow virus plasmid, under ubiquitination promotor, by BamH I, be connected with Bgl II restriction enzyme site.

The slow virus recombinant plasmid transforming for suppressing breast tumor Epithelial and stromal of the present invention, CAV-1 CSD coding nucleotide sequence in caveolin scaffolding district is as described in SEQ ID NO:2.

The slow virus recombinant plasmid transforming for suppressing breast tumor Epithelial and stromal of the present invention, CAV-1 CSD encoding amino acid sequence in caveolin scaffolding district is as described in SEQ ID NO:4.

Of the present invention as follows for suppressing the construction process of the slow virus recombinant plasmid that breast tumor Epithelial and stromal transforms:

(1) design of the Express Sequence Tags of caveolin scaffolding district CAV-1 CSD: from the expressed sequence in NCBI acquisition CAV-1 CSD district, by this section of sequence series connection in triplicate, at two ends, introduce BamH I and Bgl II isocaudarner restriction enzyme site, according to this section of sequences Design, be used for overlapping the primer of PCR:

primer1-5’:

CAAATATTGGTTTTATCGCGATGGCATTTGGAAAGCGAGCTTTACCACCTTTACCGTGACCAAATATTG；

primer1-3’:

GTCACGGTAAAGGTGGTAAAGCTCGCTTTCCAAATGCCATCGCGATAAAACCAATATTTGGTCACGGTA；

primer2-5’:

GGATCCCGCAGCGATGGCATTTGGAAAGCGAGCTTTACCACCTTTACCGTGACCAAATATTGGTTTTATCG；

primer2-3’: AGATCTGCTGCCGCGATAAAACCAATATTTGGTCACGGTAAAGGTGGTA；

(2) acquisition of the Express Sequence Tags of caveolin scaffolding district CAV-1 CSD: the sequence that obtains tri-series connection of CAV-1 CSD by the method for overlap joint PCR, PCR process is used TaqDNA polysaccharase, single base A is contained at these PCR product two ends, it is connected under the effect of T4 ligase enzyme in T carrier, obtain the T vector plasmid that contains tri-series connection of CAV-1 CSD;

(3) structure of recombinant plasmid FuGW-CSD: the T vector plasmid that step (two) is obtained carries out BamH I and Bgl II double digestion, BamH I and Bgl II are isocaudarners, FUGW slow virus plasmid is carried out to BamH I single endonuclease digestion, and PCR product is cloned under FUGW slow virus plasmid ubiquitination promotor by BamH I restriction enzyme site.

Test example 1, FuGW-CSD plasmid reduces the content of EMT marker protein

Set up mouse tumor animal model, after tumor growth, tumour is taken out in Mice Body, in tumour surrounding tissue, inject FuGW-CSD, set up injecting normal saline group simultaneously.Get cancer beside organism and detect EMT mark MMP and the variation of TGF-β protein expression.Find that these two kinds of protein contents of tumor group are all higher than Normal group, in FuGW-CSD treatment group, MMP, TGF-β protein content comparison of tumor group significantly reduce, and see Fig. 1.

Test example 2, FuGW-CSD plasmid suppresses tumor growth and transfer

Set up mouse tumor animal model, after tumor growth, in tumour surrounding tissue, inject FuGW-CSD, observe tumor growth situation.Find that tumor group has other position metastatic tumour lumps, and FuGW-CSD treatment group mouse does not have metastases sign except other positions, tumour affected part, and gross tumor volume has and obviously dwindle, see Fig. 2.

SEQUENCE LISTING

<110> Jilin University

<120> slow virus recombinant plasmid transforming for suppressing breast tumor Epithelial and stromal

<130> jlusw2013-1

<160> 5

<170> PatentIn version 3.3

<210> 1

<211> 9939

<212> DNA

<213> synthetic

<400> 1

gtcgacggat cgggagatct cccgatcccc tatggtgcac tctcagtaca atctgctctg 60

atgccgcata gttaagccag tatctgctcc ctgcttgtgt gttggaggtc gctgagtagt 120

gcgcgagcaa aatttaagct acaacaaggc aaggcttgac cgacaattgc atgaagaatc 180

tgcttagggt taggcgtttt gcgctgcttc gcgatgtacg ggccagatat acgcgttgac 240

attgattatt gactagttat taatagtaat caattacggg gtcattagtt catagcccat 300

atatggagtt ccgcgttaca taacttacgg taaatggccc gcctggctga ccgcccaacg 360

acccccgccc attgacgtca ataatgacgt atgttcccat agtaacgcca atagggactt 420

tccattgacg tcaatgggtg gagtatttac ggtaaactgc ccacttggca gtacatcaag 480

tgtatcatat gccaagtacg ccccctattg acgtcaatga cggtaaatgg cccgcctggc 540

attatgccca gtacatgacc ttatgggact ttcctacttg gcagtacatc tacgtattag 600

tcatcgctat taccatggtg atgcggtttt ggcagtacat caatgggcgt ggatagcggt 660

ttgactcacg gggatttcca agtctccacc ccattgacgt caatgggagt ttgttttggc 720

accaaaatca acgggacttt ccaaaatgtc gtaacaactc cgccccattg acgcaaatgg 780

gcggtaggcg tgtacggtgg gaggtctata taagcagcgc gttttgcctg tactgggtct 840

ctctggttag accagatctg agcctgggag ctctctggct aactagggaa cccactgctt 900

aagcctcaat aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac 960

tctggtaact agagatccct cagacccttt tagtcagtgt ggaaaatctc tagcagtggc 1020

gcccgaacag ggacttgaaa gcgaaaggga aaccagagga gctctctcga cgcaggactc 1080

ggcttgctga agcgcgcacg gcaagaggcg aggggcggcg actggtgagt acgccaaaaa 1140

ttttgactag cggaggctag aaggagagag atgggtgcga gagcgtcagt attaagcggg 1200

ggagaattag atcgcgatgg gaaaaaattc ggttaaggcc agggggaaag aaaaaatata 1260

aattaaaaca tatagtatgg gcaagcaggg agctagaacg attcgcagtt aatcctggcc 1320

tgttagaaac atcagaaggc tgtagacaaa tactgggaca gctacaacca tcccttcaga 1380

caggatcaga agaacttaga tcattatata atacagtagc aaccctctat tgtgtgcatc 1440

aaaggataga gataaaagac accaaggaag ctttagacaa gatagaggaa gagcaaaaca 1500

aaagtaagac caccgcacag caagcggccg ctgatcttca gacctggagg aggagatatg 1560

agggacaatt ggagaagtga attatataaa tataaagtag taaaaattga accattagga 1620

gtagcaccca ccaaggcaaa gagaagagtg gtgcagagag aaaaaagagc agtgggaata 1680

ggagctttgt tccttgggtt cttgggagca gcaggaagca ctatgggcgc agcgtcaatg 1740

acgctgacgg tacaggccag acaattattg tctggtatag tgcagcagca gaacaatttg 1800

ctgagggcta ttgaggcgca acagcatctg ttgcaactca cagtctgggg catcaagcag 1860

ctccaggcaa gaatcctggc tgtggaaaga tacctaaagg atcaacagct cctggggatt 1920

tggggttgct ctggaaaact catttgcacc actgctgtgc cttggaatgc tagttggagt 1980

aataaatctc tggaacagat ttggaatcac acgacctgga tggagtggga cagagaaatt 2040

aacaattaca caagcttaat acactcctta attgaagaat cgcaaaacca gcaagaaaag 2100

aatgaacaag aattattgga attagataaa tgggcaagtt tgtggaattg gtttaacata 2160

acaaattggc tgtggtatat aaaattattc ataatgatag taggaggctt ggtaggttta 2220

agaatagttt ttgctgtact ttctatagtg aatagagtta ggcagggata ttcaccatta 2280

tcgtttcaga cccacctccc aaccccgagg ggacccgaca ggcccgaagg aatagaagaa 2340

gaaggtggag agagagacag agacagatcc attcgattag tgaacggatc ggcactgcgt 2400

gcgccaattc tgcagacaaa tggcagtatt catccacaat tttaaaagaa aaggggggat 2460

tggggggtac agtgcagggg aaagaatagt agacataata gcaacagaca tacaaactaa 2520

agaattacaa aaacaaatta caaaaattca aaattttcgg gtttattaca gggacagcag 2580

agatccagtt tggttaatta agggtgcagc ggcctccgcg ccgggttttg gcgcctcccg 2640

cgggcgcccc cctcctcacg gcgagcgctg ccacgtcaga cgaagggcgc aggagcgttc 2700

ctgatccttc cgcccggacg ctcaggacag cggcccgctg ctcataagac tcggccttag 2760

aaccccagta tcagcagaag gacattttag gacgggactt gggtgactct agggcactgg 2820

ttttctttcc agagagcgga acaggcgagg aaaagtagtc ccttctcggc gattctgcgg 2880

agggatctcc gtggggcggt gaacgccgat gattatataa ggacgcgccg ggtgtggcac 2940

agctagttcc gtcgcagccg ggatttgggt cgcggttctt gtttgtggat cgctgtgatc 3000

gtcacttggt gagttgcggg ctgctgggct ggccggggct ttcgtggccg ccgggccgct 3060

cggtgggacg gaagcgtgtg gagagaccgc caagggctgt agtctgggtc cgcgagcaag 3120

gttgccctga actgggggtt ggggggagcg cacaaaatgg cggctgttcc cgagtcttga 3180

atggaagacg cttgtaaggc gggctgtgag gtcgttgaaa caaggtgggg ggcatggtgg 3240

gcggcaagaa cccaaggtct tgaggccttc gctaatgcgg gaaagctctt attcgggtga 3300

gatgggctgg ggcaccatct ggggaccctg acgtgaagtt tgtcactgac tggagaactc 3360

gggtttgtcg tctggttgcg ggggcggcag ttatgcggtg ccgttgggca gtgcacccgt 3420

acctttggga gcgcgcgcct cgtcgtgtcg tgacgtcacc cgttctgttg gcttataatg 3480

cagggtgggg ccacctgccg gtaggtgtgc ggtaggcttt tctccgtcgc aggacgcagg 3540

gttcgggcct agggtaggct ctcctgaatc gacaggcgcc ggacctctgg tgaggggagg 3600

gataagtgag gcgtcagttt ctttggtcgg ttttatgtac ctatcttctt aagtagctga 3660

agctccggtt ttgaactatg cgctcggggt tggcgagtgt gttttgtgaa gttttttagg 3720

caccttttga aatgtaatca tttgggtcaa tatgtaattt tcagtgttag actagtaaag 3780

cttctgcagg tcgactctag aaaattgtcc gctaaattct ggccgttttt ggcttttttg 3840

ttagacggat ccccgggtac cggtcgccac catggtgagc aagggcgagg agctgttcac 3900

cggggtggtg cccatcctgg tcgagctgga cggcgacgta aacggccaca agttcagcgt 3960

gtccggcgag ggcgagggcg atgccaccta cggcaagctg accctgaagt tcatctgcac 4020

caccggcaag ctgcccgtgc cctggcccac cctcgtgacc accctgacct acggcgtgca 4080

gtgcttcagc cgctaccccg accacatgaa gcagcacgac ttcttcaagt ccgccatgcc 4140

cgaaggctac gtccaggagc gcaccatctt cttcaaggac gacggcaact acaagacccg 4200

cgccgaggtg aagttcgagg gcgacaccct ggtgaaccgc atcgagctga agggcatcga 4260

cttcaaggag gacggcaaca tcctggggca caagctggag tacaactaca acagccacaa 4320

cgtctatatc atggccgaca agcagaagaa cggcatcaag gtgaacttca agatccgcca 4380

caacatcgag gacggcagcg tgcagctcgc cgaccactac cagcagaaca cccccatcgg 4440

cgacggcccc gtgctgctgc ccgacaacca ctacctgagc acccagtccg ccctgagcaa 4500

agaccccaac gagaagcgcg atcacatggt cctgctggag ttcgtgaccg ccgccgggat 4560

cactctcggc atggacgagc tgtacaagta aagcggccgc gactctagaa ttcgatatca 4620

agcttatcga taatcaacct ctggattaca aaatttgtga aagattgact ggtattctta 4680

actatgttgc tccttttacg ctatgtggat acgctgcttt aatgcctttg tatcatgcta 4740

ttgcttcccg tatggctttc attttctcct ccttgtataa atcctggttg ctgtctcttt 4800

atgaggagtt gtggcccgtt gtcaggcaac gtggcgtggt gtgcactgtg tttgctgacg 4860

caacccccac tggttggggc attgccacca cctgtcagct cctttccggg actttcgctt 4920

tccccctccc tattgccacg gcggaactca tcgccgcctg ccttgcccgc tgctggacag 4980

gggctcggct gttgggcact gacaattccg tggtgttgtc ggggaaatca tcgtcctttc 5040

cttggctgct cgcctgtgtt gccacctgga ttctgcgcgg gacgtccttc tgctacgtcc 5100

cttcggccct caatccagcg gaccttcctt cccgcggcct gctgccggct ctgcggcctc 5160

ttccgcgtct tcgccttcgc cctcagacga gtcggatctc cctttgggcc gcctccccgc 5220

atcgataccg tcgacctcga gacctagaaa aacatggagc aatcacaagt agcaatacag 5280

cagctaccaa tgctgattgt gcctggctag aagcacaaga ggaggaggag gtgggttttc 5340

cagtcacacc tcaggtacct ttaagaccaa tgacttacaa ggcagctgta gatcttagcc 5400

actttttaaa agaaaagggg ggactggaag ggctaattca ctcccaacga agacaagata 5460

tccttgatct gtggatctac cacacacaag gctacttccc tgattggcag aactacacac 5520

cagggccagg gatcagatat ccactgacct ttggatggtg ctacaagcta gtaccagttg 5580

agcaagagaa ggtagaagaa gccaatgaag gagagaacac ccgcttgtta caccctgtga 5640

gcctgcatgg gatggatgac ccggagagag aagtattaga gtggaggttt gacagccgcc 5700

tagcatttca tcacatggcc cgagagctgc atccggactg tactgggtct ctctggttag 5760

accagatctg agcctgggag ctctctggct aactagggaa cccactgctt aagcctcaat 5820

aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac tctggtaact 5880

agagatccct cagacccttt tagtcagtgt ggaaaatctc tagcagggcc cgtttaaacc 5940

cgctgatcag cctcgactgt gccttctagt tgccagccat ctgttgtttg cccctccccc 6000

gtgccttcct tgaccctgga aggtgccact cccactgtcc tttcctaata aaatgaggaa 6060

attgcatcgc attgtctgag taggtgtcat tctattctgg ggggtggggt ggggcaggac 6120

agcaaggggg aggattggga agacaatagc aggcatgctg gggatgcggt gggctctatg 6180

gcttctgagg cggaaagaac cagctggggc tctagggggt atccccacgc gccctgtagc 6240

ggcgcattaa gcgcggcggg tgtggtggtt acgcgcagcg tgaccgctac acttgccagc 6300

gccctagcgc ccgctccttt cgctttcttc ccttcctttc tcgccacgtt cgccggcttt 6360

ccccgtcaag ctctaaatcg ggggctccct ttagggttcc gatttagtgc tttacggcac 6420

ctcgacccca aaaaacttga ttagggtgat ggttcacgta gtgggccatc gccctgatag 6480

acggtttttc gccctttgac gttggagtcc acgttcttta atagtggact cttgttccaa 6540

actggaacaa cactcaaccc tatctcggtc tattcttttg atttataagg gattttgccg 6600

atttcggcct attggttaaa aaatgagctg atttaacaaa aatttaacgc gaattaattc 6660

tgtggaatgt gtgtcagtta gggtgtggaa agtccccagg ctccccagca ggcagaagta 6720

tgcaaagcat gcatctcaat tagtcagcaa ccaggtgtgg aaagtcccca ggctccccag 6780

caggcagaag tatgcaaagc atgcatctca attagtcagc aaccatagtc ccgcccctaa 6840

ctccgcccat cccgccccta actccgccca gttccgccca ttctccgccc catggctgac 6900

taattttttt tatttatgca gaggccgagg ccgcctctgc ctctgagcta ttccagaagt 6960

agtgaggagg cttttttgga ggcctaggct tttgcaaaaa gctcccggga gcttgtatat 7020

ccattttcgg atctgatcag cacgtgttga caattaatca tcggcatagt atatcggcat 7080

agtataatac gacaaggtga ggaactaaac catggccaag ttgaccagtg ccgttccggt 7140

gctcaccgcg cgcgacgtcg ccggagcggt cgagttctgg accgaccggc tcgggttctc 7200

ccgggacttc gtggaggacg acttcgccgg tgtggtccgg gacgacgtga ccctgttcat 7260

cagcgcggtc caggaccagg tggtgccgga caacaccctg gcctgggtgt gggtgcgcgg 7320

cctggacgag ctgtacgccg agtggtcgga ggtcgtgtcc acgaacttcc gggacgcctc 7380

cgggccggcc atgaccgaga tcggcgagca gccgtggggg cgggagttcg ccctgcgcga 7440

cccggccggc aactgcgtgc acttcgtggc cgaggagcag gactgacacg tgctacgaga 7500

tttcgattcc accgccgcct tctatgaaag gttgggcttc ggaatcgttt tccgggacgc 7560

cggctggatg atcctccagc gcggggatct catgctggag ttcttcgccc accccaactt 7620

gtttattgca gcttataatg gttacaaata aagcaatagc atcacaaatt tcacaaataa 7680

agcatttttt tcactgcatt ctagttgtgg tttgtccaaa ctcatcaatg tatcttatca 7740

tgtctgtata ccgtcgacct ctagctagag cttggcgtaa tcatggtcat agctgtttcc 7800

tgtgtgaaat tgttatccgc tcacaattcc acacaacata cgagccggaa gcataaagtg 7860

taaagcctgg ggtgcctaat gagtgagcta actcacatta attgcgttgc gctcactgcc 7920

cgctttccag tcgggaaacc tgtcgtgcca gctgcattaa tgaatcggcc aacgcgcggg 7980

gagaggcggt ttgcgtattg ggcgctcttc cgcttcctcg ctcactgact cgctgcgctc 8040

ggtcgttcgg ctgcggcgag cggtatcagc tcactcaaag gcggtaatac ggttatccac 8100

agaatcaggg gataacgcag gaaagaacat gtgagcaaaa ggccagcaaa aggccaggaa 8160

ccgtaaaaag gccgcgttgc tggcgttttt ccataggctc cgcccccctg acgagcatca 8220

caaaaatcga cgctcaagtc agaggtggcg aaacccgaca ggactataaa gataccaggc 8280

gtttccccct ggaagctccc tcgtgcgctc tcctgttccg accctgccgc ttaccggata 8340

cctgtccgcc tttctccctt cgggaagcgt ggcgctttct catagctcac gctgtaggta 8400

tctcagttcg gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac cccccgttca 8460

gcccgaccgc tgcgccttat ccggtaacta tcgtcttgag tccaacccgg taagacacga 8520

cttatcgcca ctggcagcag ccactggtaa caggattagc agagcgaggt atgtaggcgg 8580

tgctacagag ttcttgaagt ggtggcctaa ctacggctac actagaagaa cagtatttgg 8640

tatctgcgct ctgctgaagc cagttacctt cggaaaaaga gttggtagct cttgatccgg 8700

caaacaaacc accgctggta gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag 8760

aaaaaaagga tctcaagaag atcctttgat cttttctacg gggtctgacg ctcagtggaa 8820

cgaaaactca cgttaaggga ttttggtcat gagattatca aaaaggatct tcacctagat 8880

ccttttaaat taaaaatgaa gttttaaatc aatctaaagt atatatgagt aaacttggtc 8940

tgacagttac caatgcttaa tcagtgaggc acctatctca gcgatctgtc tatttcgttc 9000

atccatagtt gcctgactcc ccgtcgtgta gataactacg atacgggagg gcttaccatc 9060

tggccccagt gctgcaatga taccgcgaga cccacgctca ccggctccag atttatcagc 9120

aataaaccag ccagccggaa gggccgagcg cagaagtggt cctgcaactt tatccgcctc 9180

catccagtct attaattgtt gccgggaagc tagagtaagt agttcgccag ttaatagttt 9240

gcgcaacgtt gttgccattg ctacaggcat cgtggtgtca cgctcgtcgt ttggtatggc 9300

ttcattcagc tccggttccc aacgatcaag gcgagttaca tgatccccca tgttgtgcaa 9360

aaaagcggtt agctccttcg gtcctccgat cgttgtcaga agtaagttgg ccgcagtgtt 9420

atcactcatg gttatggcag cactgcataa ttctcttact gtcatgccat ccgtaagatg 9480

cttttctgtg actggtgagt actcaaccaa gtcattctga gaatagtgta tgcggcgacc 9540

gagttgctct tgcccggcgt caatacggga taataccgcg ccacatagca gaactttaaa 9600

agtgctcatc attggaaaac gttcttcggg gcgaaaactc tcaaggatct taccgctgtt 9660

gagatccagt tcgatgtaac ccactcgtgc acccaactga tcttcagcat cttttacttt 9720

caccagcgtt tctgggtgag caaaaacagg aaggcaaaat gccgcaaaaa agggaataag 9780

ggcgacacgg aaatgttgaa tactcatact cttccttttt caatattatt gaagcattta 9840

tcagggttat tgtctcatga gcggatacat atttgaatgt atttagaaaa ataaacaaat 9900

aggggttccg cgcacatttc cccgaaaagt gccacctga 9939

<210> 2

<211> 60

<212> DNA

<213> people

<400> 2

gatggcattt ggaaagcgag ctttaccacc tttaccgtga ccaaatattg gttttatcgc 60

<210> 3

<211> 192

<212> DNA

<213> synthetic

<400> 3

cgcagcgatg gcatttggaa agcgagcttt accaccttta ccgtgaccaa atattggttt 60

tatcgcgatg gcatttggaa agcgagcttt accaccttta ccgtgaccaa atattggttt 120

tatcgcgatg gcatttggaa agcgagcttt accaccttta ccgtgaccaa atattggttt 180

tatcgcggca gc 192

<210> 4

<211> 20

<212> PRT

<213> people

<400> 4

Asp Gly Ile Trp Lys Ala Ser Phe Thr Thr Phe Thr Val Thr Lys Tyr

1 5 10 15

Trp Phe Tyr Arg

20

<210> 5

<211> 64

<212> PRT

<213> synthetic

<400> 5

Arg Ser Asp Gly Ile Trp Lys Ala Ser Phe Thr Thr Phe Thr Val Thr

1 5 10 15

Lys Tyr Trp Phe Tyr Arg Asp Gly Ile Trp Lys Ala Ser Phe Thr Thr

20 25 30

Phe Thr Val Thr Lys Tyr Trp Phe Tyr Arg Asp Gly Ile Trp Lys Ala

35 40 45

Ser Phe Thr Thr Phe Thr Val Thr Lys Tyr Trp Phe Tyr Arg Gly Ser

50 55 60

Claims (5)

1. the slow virus recombinant plasmid transforming for suppressing breast tumor Epithelial and stromal, is characterized in that: its nucleotide sequence is as described in SEQ ID NO:1.

2. according to claim 1 for suppressing the slow virus recombinant plasmid of breast tumor Epithelial and stromal conversion, it is characterized in that: the series connection of caveolin scaffolding district CAV-1 CSD expressed sequence repeats 3 times, this caveolin scaffolding district CAV-1 CSD coding nucleotide sequence as described in SEQ ID NO:3, aminoacid sequence is as described in SEQ ID NO:5, in FuGW slow virus plasmid, under ubiquitination promotor, by BamH I, be connected with Bgl II restriction enzyme site.

3. the slow virus recombinant plasmid transforming for suppressing breast tumor Epithelial and stromal according to claim 1, is characterized in that: CAV-1 CSD coding nucleotide sequence in caveolin scaffolding district is as described in SEQ ID NO:2.

4. the slow virus recombinant plasmid transforming for suppressing breast tumor Epithelial and stromal according to claim 1, is characterized in that: CAV-1 CSD encoding amino acid sequence in caveolin scaffolding district is as described in SEQ ID NO:4.

5. as claimed in claim 1 as follows for suppressing the construction process of the slow virus recombinant plasmid that breast tumor Epithelial and stromal transforms:

(1) design of the Express Sequence Tags of caveolin scaffolding district CAV-1 CSD: from the expressed sequence in NCBI acquisition CAV-1 CSD district, by this section of sequence series connection in triplicate, at two ends, introduce BamH I and Bgl II isocaudarner restriction enzyme site, according to this section of sequences Design, be used for overlapping the primer of PCR:

primer1-5’:

CAAATATTGGTTTTATCGCGATGGCATTTGGAAAGCGAGCTTTACCACCTTTACCGTGACCAAATATTG；

primer1-3’:

GTCACGGTAAAGGTGGTAAAGCTCGCTTTCCAAATGCCATCGCGATAAAACCAATATTTGGTCACGGTA；

primer2-5’:

GGATCCCGCAGCGATGGCATTTGGAAAGCGAGCTTTACCACCTTTACCGTGACCAAATATTGGTTTTATCG；

primer2-3’: AGATCTGCTGCCGCGATAAAACCAATATTTGGTCACGGTAAAGGTGGTA；

(2) acquisition of the Express Sequence Tags of caveolin scaffolding district CAV-1 CSD: the sequence that obtains tri-series connection of CAV-1 CSD by the method for overlap joint PCR, PCR process is used TaqDNA polysaccharase, single base A is contained at these PCR product two ends, it is connected under the effect of T4 ligase enzyme in T carrier, obtain the T vector plasmid that contains tri-series connection of CAV-1 CSD;

(3) structure of recombinant plasmid FuGW-CSD: the T vector plasmid that step (two) is obtained carries out BamH I and Bgl II double digestion, BamH I and Bgl II are isocaudarners, FUGW slow virus plasmid is carried out to BamH I single endonuclease digestion, and PCR product is cloned under FUGW slow virus plasmid ubiquitination promotor by BamH I restriction enzyme site.

Images