CN103540606B - Express the colibacillus engineering of lignin peroxidase, preparation method and application thereof - Google Patents

Express the colibacillus engineering of lignin peroxidase, preparation method and application thereof Download PDF

Info

Publication number
CN103540606B
CN103540606B CN201310544399.5A CN201310544399A CN103540606B CN 103540606 B CN103540606 B CN 103540606B CN 201310544399 A CN201310544399 A CN 201310544399A CN 103540606 B CN103540606 B CN 103540606B
Authority
CN
China
Prior art keywords
lignin peroxidase
lip
colibacillus engineering
pcold
expression
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201310544399.5A
Other languages
Chinese (zh)
Other versions
CN103540606A (en
Inventor
陈明
晏铭
曾光明
杜长青
张嘉超
鲁伦慧
朱艺
赖萃
许飘
武海鹏
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hunan University
Original Assignee
Hunan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hunan University filed Critical Hunan University
Priority to CN201310544399.5A priority Critical patent/CN103540606B/en
Publication of CN103540606A publication Critical patent/CN103540606A/en
Application granted granted Critical
Publication of CN103540606B publication Critical patent/CN103540606B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Landscapes

  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The present invention relates to a kind of colibacillus engineering, the present invention also provides a kind of preparation method of colibacillus engineering, step is the cDNA of the gene of clone's Phanerochaete chrysosporium, the above-mentioned cDNA of double digestion, endonuclease bamhi is connected pCold-TF carrier, identify the plasmid pCold-TF-LiP that obtains whether positive expression, positive plasmid pCold-TF-LiP is directed in e. coli bl21 competent cell, obtain the colibacillus engineering of expressing lignin peroxidase, the present invention also provides the application of colibacillus engineering, method is that colibacillus engineering is inoculated in liquid nutrient medium, penbritin is added in liquid nutrient medium, be cultured to OD 600be 0.58 ~ 0.62, add protein induced dose of IPTG, induction expression of recombinant proteins, colibacillus engineering expression amount of the present invention is high, and active extremely strong, enzyme work is 3528 U/L.

Description

Express the colibacillus engineering of lignin peroxidase, preparation method and application thereof
Technical field
The present invention relates to a kind of colibacillus engineering, specifically a kind of express lignin peroxidase colibacillus engineering, preparation method and application thereof.
Background technology
Xylogen is known second a large amount of biopolymer on the earth, structure is very complicated, be not easy (the Martinez that degrades, A. T., et al.2005. " Biodegradation of lignocellulosics:microbial; chemical, and enzymatic aspects of the fungal attack of lignin. " Int Microbiol 8:195-204).Owing to lacking suitable process, many xylogen become refuse, have caused various environmental problem.Along with the growing tension of the energy, existing domestic and international researchist attempts by changing xylogen producing and ethanol in the next life energy obtain certain progress as an alternative.Lignocellulose be also used to manufacture paper starting material, cultivate edible mushrooms and animal-feed (Sanchez, C.2009. " Lignocellulosic residues:biodegradation and bioconversion by fungi. " Biotechnol Adv 27:185-194).The annual lignin waste output of China is huge, and pile up like a mountain, and thereupon derivative lignin changes and recycling has broad application prospects.Although the purposes of xylogen is various, but owing to lacking strong Liginon Resource conversion techniques, greatly constrain its recycling.So far, the utilization ratio of xylogen is still low-down.The method of decomposing xylogen is various.Especially, microbiological deterioration xylogen is current generally acknowledged not only economy but also friendly mode.Microorganism, can lignin degrading effectively by secretion lignin-degrading enzymes.Lignin peroxidase is exactly a kind of important lignin-degrading enzymes, (Choinowski is formed by the glycoprotein comprising heme, T., et al.1999. " The crystal structure of lignin peroxidase at 1.70 resolution reveals a hydroxy group on the cbeta of tryptophan 171:a novel radical site formed during the redox cycle. " J Mol Biol 286:809-827), primarily of microorganism secretions such as fungies, of a great variety, comprise Ligninase H2, Ligninase H8, Ligninase A, Ligninase B, Ligninase C, Ligninase LG2, Ligninase LG3, Ligninase LG5, Ligninase LG6, Lignin peroxidase lipJ, Lignin peroxidase isoform A, Lignin peroxidase isoform lipB, Lignin peroxidase isoform lipD, Lignin peroxidase isoform lipE, Lignin peroxidase isoform lipG etc. (http://www.uniprot.org/).
The many microorganisms of occurring in nature such as white-rot fungi can secrete lignin peroxidase.Therefore, white-rot fungi has been widely used in the biological degradation of xylogen.The lignin peroxidase that such as Phanerochaete chrysosporium (a kind of white-rot fungi) secretes has stronger lignin degradation ability.Although white-rot fungi relies on its powerful lignin degradation ability and is widely used in lignin degradation research, when comparing with pre biooxidation, its reproduction speed, generally lower than bacterium, causes it in the promoting the use of of reality, receive certain restriction.In addition, the quantity of the lignin peroxidase of white rot fungus secretion is limited, be difficult to be applied on a large scale the association with pulp bleaching in the biological degradation of lignin waste and industrial production, it is unpractical that a small amount of lignin peroxidase only relying on existing microorganism secretion carries out degraded.
Summary of the invention
The object of the invention is bacterium that fecundity and the powerful lignin degradation ability of white-rot fungi lignin peroxidase combine fast, obtain a kind of colibacillus engineering expressing lignin peroxidase by the method for gene clone and restructuring, the preparation method and application of colibacillus engineering are provided in addition.
The intestinal bacteria expressing lignin peroxidase of the present invention, the step built needed for it is as follows:
(1) clone the cDNA of the gene of Phanerochaete chrysosporium, described lignin peroxidase is Ligninase LG3, and protein sequence is SEQ ID NO:01; By the cDNA sequence of its gene of sequence construct of lignin peroxidase, suitably adjust, the cDNA sequence obtaining described gene is SEQ ID NO:02.
(2) use bamh I and xhothe above-mentioned cDNA of I double digestion clone, obtains corresponding endonuclease bamhi, endonuclease bamhi T4 DNA ligase is connected pCold-TF carrier, obtain recombined pronucleus expression plasmid pCold-TF- liP.
(3) recombined pronucleus expression plasmid pCold-TF-is identified liPwhether positive expression, obtains positive recombinant plasmid pCold-TF- liP.
(4) by positive recombinant plasmid pCold-TF- liPbe directed in e. coli bl21 competent cell, obtain the colibacillus engineering of expressing lignin peroxidase.
Qualification recombined pronucleus expression plasmid pCold-TF- liPthe method of positive expression is:
(1) thermal shock method is by recombined pronucleus expression plasmid pCold-TF- liPbe directed in DH5 α competent cell.
(2) bacterium liquid pcr amplification qualification, obtains the DH5 α of positive colony; The forward primer that described pcr amplification uses is 5 ’ – aactcgagatggcatttaaacagctttttgcgg – 3 ', sequence is SEQ ID NO:03, reverse primer is 5 ’ – aaggatcccgctcccggaggcggtgg – 3 ', and sequence is SEQ ID NO:04.
(3) alkaline lysis extracts recombinant plasmid to the DH5 α of above-mentioned positive colony.
(4) recombinant plasmid carries out bamh I and xhoi double digestion is identified, check order to object fragment, the correct recombinant plasmid that checks order is positive recombinant plasmid pCold-TF- liP.
The present invention also provides a kind of colibacillus engineering expressing the application in lignin peroxidase, and step is:
The colibacillus engineering of expressing lignin peroxidase is inoculated in LB liquid nutrient medium, and add penbritin 80 ~ 120mg/L in LB liquid nutrient medium, 35 ~ 37 DEG C, 180 ~ 220 rpm, are cultured to OD 600for 0.58-0.62, add protein induced dose of IPTG, 16 DEG C, 200rpm, induction expression of recombinant proteins 12 ~ 16h.The formula of described LB liquid nutrient medium is: peptone 0.5g, yeast extract 0.25g, sodium-chlor 0.5g, and add water 50ml.
Loaded in centrifuge tube by colibacillus engineering after abduction delivering, centrifugal, abandon supernatant liquor, it is resuspended to add damping fluid, and ultrasonication, adds nickel post, carries out purifying.
The invention has the beneficial effects as follows:
1. the lignin peroxidase of the present invention's synthesis derives from Phanerochaete chrysosporium, and white-rot fungi belongs to Mycophyta Basidiomycetes, and shape is thread, and Phanerochaete chrysosporium is the Typical Representative in white-rot fungi, has stronger lignin degradation ability.
2. e. coli bl21 used in the present invention has very fast fecundity, ensure that recombinate the colibacillus engineering that obtains can in the very short time lignin peroxidase of production some amount, the degraded of xylogen solid waste and the bleaching of Pulp industry can be used for.
3. a kind of colibacillus engineering volume little Yi that can express the Lignin Peroxidases-lips Gene of synthesis that the present invention obtains cultivates, and is applicable to large-scale industrial production lignin peroxidase.
4. the full length protein sequence of Ligninase LG3 that the present invention chooses is known, and other Lignin Peroxidases-lips Gene is much fragment, cloned sequence or non-full-length gene order are difficult to the repertoire obtaining gene, and the lignin peroxidase of its engineering bacterium expression built may be caused not have activity.
5. the present invention chooses Ligninase LG3 compared to other xylogen peroxidase protein sequence moderate length and protein full-length sequence is known, is convenient to gene clone, saves time and cost.
6. the Ligninase LG3 chosen is built in prokaryotic vector pCold-TF by the present invention, obtains recombinant prokaryotic expression vector pCold-TF- liP.TF in prokaryotic vector pCold-TF can increase the solubility of foreign protein, therefore, it is possible to increase the solubility of Ligninase LG3 albumen.The colibacillus engineering expression amount containing Ligninase LG3 that the present invention obtains is large, and protein yield is high, has and meets industrial great potential, is expected large-scale application in the degraded of solid waste and environmental pollution improvement.
7. lignin peroxidase of the present invention is Ligninase LG3, and we find, the lignin peroxidase expressed by it has activity, and enzymic activity is very high, and enzyme work is 3528 U/L.The technology of the superoxide kinase inactive of engineering bacterium expression is compared to existing technology compared, and has huge effect and significant progress.
Accompanying drawing explanation
Fig. 1 is prokaryotic expression carrier pCold-TF- liPagarose gel electrophoresis figure after double digestion;
Wherein, M is Marker, and 1 represents sampling 1,2 represents sampling 2.
Fig. 2 is the agarose gel electrophoresis figure of bacterium liquid pcr amplification product;
Wherein, M is Marker, and 1,2,3,4,5 is the pcr amplification products that are template with bacterium liquid, and band 6 is negative controls, and band 7 is positive controls.
Fig. 3 is the SDS-PAGE figure of soluble analysis;
Wherein, M is Protein Marker, and 1 is total protein, and 2 is supernatant, and 3 is precipitation.
Embodiment
Embodiment 1
1, the cDNA of Lignin Peroxidases-lips Gene is cloned
The protein sequence (P21764) that obtains lignin peroxidase from database UniProtKB screening is SEQ ID:NO:01,For Met, Ala, Phe, Lys, Gln, Leu, Phe, Ala, Ala, Ile, Ser, Leu, Ala, Leu, Ser, Leu, Ser, Ala, Ala, Asn, Ala, Ala, Ala, Val, Ile, Glu, Lys, Arg, Ala, Thr, Cys, Ser, Asn, Gly, Lys, Thr, Val, Gly, Asp, Ala, Ser, Ser, Cys, Ala, Trp, Phe, Asp, Val, Leu, Asp, Asp, Ile, Gln, Gln, Asn, Leu, Phe, His, Gly, Gly, Gln, Cys, Gly, Ala, Glu, Ala, His, Glu, Ser, Ile, Arg, Leu, Val, Phe, His, Asp, Ser, Ile, Ala, Ile, Ser, Pro, Ala, Met, Glu, Ala, Gln, Gly, Lys, Phe, Gly, Gly, Gly, Gly, Ala, Asp, Gly, Ser, Ile, Met, Ile, Phe, Asp, Asp, Ile, Glu, Thr, Ala, Phe, His, Pro, Asn, Ile, Gly, Leu, Asp, Glu, Ile, Val, Lys, Leu, Gln, Lys, Pro, Phe, Val, Gln, Lys, His, Gly, Cys, Thr, Pro, Gly, Asp, Phe, Ile, Ala, Phe, Ala, Gly, Ala, Val, Ala, Leu, Ser, Asn, Cys, Pro, Gly, Ala, Pro, Gln, Met, Asn, Phe, Phe, Thr, Gly, Arg, Ala, Pro, Ala, Thr, Gln, Ala, Ala, Pro, Asp, Gly, Leu, Val, Pro, Glu, Pro, Phe, His, Thr, Val, Asp, Gln, Ile, Ile, Asn, Arg, Val, Asn, Asp, Ala, Gly, Glu, Phe, Asp, Glu, Leu, Glu, Leu, Val, Trp, Met, Leu, Ser, Ala, His, Ser, Val, Ala, Ala, Val, Asn, Asp, Val, Asp, Pro, Thr, Val, Gln, Gly, Leu, Pro, Phe, Asp, Ser, Thr, Pro, Gly, Ile, Phe, Asp, Ser, Gln, Phe, Phe, Val, Glu, Thr, Gln, Leu, Arg, Gly, Thr, Ala, Phe, Pro, Gly, Ser, Gly, Gly, Asn, GlnGly Glu Val Glu Ser Pro Leu Pro Gly Glu Ile Arg Ile Gln Ser Asp His Thr Ile Ala Arg Asp Ser Arg Thr Ala Cys Glu Trp Gln Ser Phe Val Asn Asn Gln Ser Lys Leu Val Asp Asp Phe Gln Phe Ile Phe Leu Ala Leu Thr Gln Leu Gly Gln Asp Pro Asn Ala Met Thr Asp Cys Ser Asp Val Ile Pro Gln Ser Lys Pro Ile Pro Gly Asn Leu Pro Phe Ser Phe Phe Pro Ala Gly Lys Thr Ile Lys Asp Val Glu Gln Ala Cys Ala Glu Thr Pro Phe Pro Thr Leu Thr Thr Leu Pro Gly Pro Glu Thr Ser Val Gln Arg Ile Pro Pro Pro Pro Gly Ala.
In order to make this albumen mass-energy express efficiently in prokaryotic expression carrier, the cDNA of this protein sequence (P21764) being carried out some and has modified and transformation, having with the addition of at cloning primer sequence 5 ' two ends bamHi and xhoi double enzyme site, the gene fragment warp of acquisition bamHi and xhoi double digestion method merges into prokaryotic expression carrier pCold-TF, obtains recombined pronucleus expression plasmid pCold-TF- liP, the fusion rotein of this expression of recombinant plasmid adds histidine-tagged, is conducive to qualification and the purifying of fusion rotein.Described cDNA sequence of SEQ ID NO: 02, SEQ ID NO: 02atggcatttaaacagctttttgcggcgattagcctggcgctgagcctgagcgcggctaatgctgcggcggtgattgaaaaacgtgcgacctgcagcaatggcaaaaccgtgggcgatgcgagcagctgtgcgtggtttgatgtgctggatgatattcagcagaatctgtttcatggcggccagtgcggtgcggaggcgcacgaaagcattcgtctggtgtttcatgatagcattgcgattagtcccgcgatggaagcgcagggaaaattcggcggtggtggggccgatggcagcattatgatttttgatgatattgaaaccgcgtttcatccgaatattggcctggacgaaattgtgaaactgcagaaaccgtttgtgcagaaacatggctgcacgccgggtgattttatcgcgtttgcaggggcagtcgcgctgagcaattgtccgggtgctccgcagatgaatttctttaccggccgtgcaccggcaacccaagccgcaccggatggcctggtgccggaaccctttcataccgtggatcagattatcaatcgtgtgaatgatgcgggcgaatttgatgaactggaactggtgtggatgctgagcgcgcatagcgtggcggcagtaaatgacgtggacccgaccgtgcagggcctgccttttgatagcaccccgggtatttttgattctcagttttttgttgaaacccagctgcgtggcaccgcgtttccgggctcaggcggcaatcagggcgaagtggaaagtccgctgcctggcgaaattcgtattcagagtgatcataccattgcgcgtgatagccgtaccgcgtgcgaatggcagagctttgtgaataatcagagcaaactggtggatgattttcagtttatctttctggcgctgacccaattaggccaggaccctaatgcgatgactgattgcagcgatgtgattccgcagagcaaacccattccgggcaacctgccgtttagcttttttccggcaggcaaaaccattaaggatgtggagcaggcgtgtgcggaaaccccttttccgaccctgaccaccctgcctggtccagagaccagcgtgcagcgtattccaccgcctccgggagcgtaa。
2, recombinant expression vector pCold-TF-is built liP
With bamh I and xhothe Lignin Peroxidases-lips Gene fragment of I double digestion clone.Double digestion system is: 1.5 μ L bamh I, 1.5 μ L xhoi, 2 μ L 10 × buffer, 5 μ L enzymes cut material, 10 μ L PCR water.37 DEG C, enzyme cuts 90min.Reclaim test kit with reference to glue and carry out digestion products recovery, obtain corresponding double digestion gene fragment.
T4 DNA ligase connects pCold-TF empty carrier.Linked system is: 1.5 μ L T4 DNA ligases, 2 μ L 10 × T4 DNA ligase buffer, the polyoxyethylene glycol (PEG) of 1.5 μ L 50%, the carrier of 5 μ L double digestions, the above-mentioned double digestion gene fragment of 10 μ L, room temperature connects, and obtains containing recombined pronucleus expression plasmid pCold-TF- liPlinked system product.
3, positive recombinant plasmid pCold-TF-is obtained liP
(1) get 10 μ L and contain recombined pronucleus expression plasmid pCold-TF- liPlinked system product add 100 μ L DH5 α competent cells, mixing, ice bath 20min, proceeds to 42 DEG C of heat shock 90s.
(2) product after above-mentioned heat shock is added 1mL LB liquid nutrient medium, be placed in 37 DEG C of constant-temperature shaking incubators and cultivate 1h.Therefrom get on culture dish that 200 μ L are coated on containing the LB solid medium of penbritin, use rubber belt sealing.Be placed in 37 DEG C of constant incubators and be inverted cultivation 12 ~ 16h.Picking 7 ~ 8 single bacterium colonies are to 5mL containing in the LB liquid nutrient medium of 100mg/L penbritin, and 37 DEG C of concussion cultivation 12 ~ 16h, described LB solid culture formula is, peptone 0.5g, yeast extract 0.25g, sodium-chlor 0.5g, 0.75g agar powder, add water 50ml.
Carry out pcr amplification preliminary identification positive strain with bacterium liquid for template, obtain the DH5 α of positive colony.
Pcr amplification primer is: forward primer: 5 ' – aactcgagatggcatttaaacagctttttgcgg – 3 ', reverse primer: 5 ' – aaggatcccgctcccggaggcggtgg – 3 '.The system of described pcr amplification is 50 μ L systems: 10 × buffer 5 μ L, dNTP 2.5 μ L, forward primer 0.75 μ L, reverse primer 0.75 μ L, and enzyme 0.75 μ L, template 5 μ L, adds water and complement to 50 μ L.
The program that described PCR runs: denaturation temperature is 94 DEG C, and the time is 5min; Denaturation temperature is 94 DEG C, and the time is 30 s; Annealing temperature is 56 DEG C, and the time is 30s; Elongating temperature is 72 DEG C, and the time is 70s; Circulate 34 times; Rear elongating temperature is 72 DEG C, and the time is 5 min; 12 DEG C of cryopreservation.
The confirmation of described PCR primer is by 1% agarose gel electrophoresis: measure 0.4 g agarose in Erlenmeyer flask, adds 40 mL TBE electrophoretic buffers, is placed in microwave oven, is adjusted to high fire, boils about 2min, to transparent, takes out.After glue makes, point sample, builds electrophoresis chamber, power-on, about 10 min, observes electrophoresis result.
(3) alkaline lysis extracts recombinant plasmid to the DH5 α of above-mentioned positive colony.
(4) recombinant plasmid carries out bamh I and xhoi double digestion is identified, qualification result as shown in Figure 1.Marine life engineering corporation is served to object fragment and carries out sequence verification, obtain positive recombinant plasmid pCold-TF- liP.
4, by positive recombinant plasmid pCold-TF- liPbe transformed in e. coli bl21 competent cell, coat on the solid LB media containing 100 mg/L penbritins and screen positive engineering bacteria, obtain the colibacillus engineering of expressing lignin peroxidase.Detect recombinant expression vector pCold-TF- liPwhether successfully construct, detected result as shown in Figure 2.
Embodiment 2
Above-mentioned colibacillus engineering is expressing the application in lignin peroxidase
Colibacillus engineering prepared by embodiment 1 is inoculated in LB liquid nutrient medium, and containing penbritin 100mg/L, 37 DEG C, 200 rpm, are cultured to OD 600be about about 0.6, add protein induced dose of IPTG, 16 DEG C, 200 rpm, induction expression of recombinant proteins 12 ~ 16 h.The formula of described LB liquid nutrient medium is: peptone 0.5g, yeast extract 0.25g, sodium-chlor 0.5g, and add water 50ml.
Embodiment 3
The separating-purifying of lignin peroxidase
By after embodiment 2 inducing culture colibacillus engineering load in centrifuge tube, the centrifugal 1min of 12000rpm, abandons supernatant liquor, and it is resuspended to add PBS damping fluid, and ultrasonication, adds 1mL nickel post, carry out purifying.
By after embodiment 2 inducing culture colibacillus engineering, the centrifugal 5min of 10000rpm, collected by centrifugation analyzing proteins solubility, ultrasonication, get total protein, supernatant liquor and precipitation respectively and carry out the analysis of SDS-PAGE protein electrophoresis, concrete outcome as shown in Figure 3, show this lignin peroxidase protein can in e. coli bl21 high expression.
Embodiment 4
The mensuration that the lignin peroxidase enzyme that colibacillus engineering is secreted is lived
The mensuration that lignin peroxidase enzyme is lived adopts the method that VA (veratryl alcohol) is substrate:
Get 10 mmol/L veratryl alcohol solution 0.6 mL, 250 mmol/L tartaric acid buffer (pH=3.0) 1.2 mL, enzyme liquid that 10 μ L embodiments 3 obtain and 10 μ L FeSO 4solution (0.01g/mL) mixes.At room temperature, in above-mentioned system, 20 mmol/L H are added 2o 2solution 60 μ L.Simultaneously not add H 2o 2the above-mentioned system of solution is reference, in 310nm place, uses ultraviolet spectrophotometer to measure the changing conditions of reaction system absorbancy before and after 3min.Enzyme activity unit (U): per minute catalysis veratryl alcohol forms the enzyme amount needed for 1 μm of ol veratryl aldehyde.ε in calculating 310=9300 mol -1.cm -1.The enzyme work recorded by aforesaid method is 3528 U/L.

Claims (5)

1. express a preparation method for the colibacillus engineering of lignin peroxidase, it is characterized in that,
(1) clone the cDNA of the gene of Phanerochaete chrysosporium, described lignin peroxidase is Ligninase LG3, and protein sequence is SEQ ID NO:01;
(2) use bamh I and xhothe above-mentioned cDNA of I double digestion clone, obtains corresponding endonuclease bamhi, endonuclease bamhi T4 DNA ligase is connected pCold-TF carrier, obtain recombined pronucleus expression plasmid pCold-TF- liP;
(3) recombined pronucleus expression plasmid pCold-TF-is identified liPwhether positive expression, obtains positive recombinant plasmid pCold-TF- liP;
(4) by positive recombinant plasmid pCold-TF- liPbe directed in e. coli bl21 competent cell, obtain the colibacillus engineering of expressing lignin peroxidase;
Described cDNA sequence is SEQ ID NO:02;
Qualification recombined pronucleus expression plasmid pCold-TF- liPthe method of positive expression is:
(1) thermal shock method is by recombined pronucleus expression plasmid pCold-TF- liPbe directed in DH5 α competent cell;
(2) bacterium liquid pcr amplification qualification, obtains the DH5 α of positive colony;
(3) alkaline lysis extracts recombinant plasmid to the DH5 α of above-mentioned positive colony;
(4) recombinant plasmid carries out bamh I and xhoi double digestion is identified, check order to object fragment, the correct recombinant plasmid that checks order is positive recombinant plasmid pCold-TF- liP;
The bacterium liquid pcr amplification of step (two) identifies that the forward primer of use is 5 ’ – aactcgagatggcatttaaacagctttttgcgg – 3 ', and reverse primer is 5 ’ – aaggatcccgctcccggaggcggtgg – 3 '.
2. the colibacillus engineering of expression lignin peroxidase that preparation method prepares as claimed in claim 1 is expressing the application in lignin peroxidase.
3. colibacillus engineering of expressing lignin peroxidase as claimed in claim 2 is expressing the application in lignin peroxidase, it is characterized in that, the colibacillus engineering of expressing lignin peroxidase is inoculated in the liquid nutrient medium containing penbritin, cultivate, add protein induced dose of IPTG, separating-purifying, obtains the lignin peroxidase of expressing.
4. apply as claimed in claim 3, it is characterized in that, liquid nutrient medium is LB liquid nutrient medium, and the concentration of penbritin is 80 ~ 120mg/L, and culture temperature is 35 ~ 37 DEG C.
5. apply as claimed in claim 3, it is characterized in that, be cultured to OD 600protein induced dose of IPTG is added, 16 DEG C of cultivations when being 0.58 ~ 0.62.
CN201310544399.5A 2013-11-06 2013-11-06 Express the colibacillus engineering of lignin peroxidase, preparation method and application thereof Expired - Fee Related CN103540606B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201310544399.5A CN103540606B (en) 2013-11-06 2013-11-06 Express the colibacillus engineering of lignin peroxidase, preparation method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201310544399.5A CN103540606B (en) 2013-11-06 2013-11-06 Express the colibacillus engineering of lignin peroxidase, preparation method and application thereof

Publications (2)

Publication Number Publication Date
CN103540606A CN103540606A (en) 2014-01-29
CN103540606B true CN103540606B (en) 2015-09-23

Family

ID=49964459

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201310544399.5A Expired - Fee Related CN103540606B (en) 2013-11-06 2013-11-06 Express the colibacillus engineering of lignin peroxidase, preparation method and application thereof

Country Status (1)

Country Link
CN (1) CN103540606B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104232556A (en) * 2014-09-12 2014-12-24 上海交通大学 Engineering bacterium based on lignin peroxidase and implementation method of engineering bacterium
CN118685380A (en) * 2024-08-26 2024-09-24 天津科技大学 Lignin peroxidase mutant, gene and engineering bacterium thereof, preparation method and application

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101148644A (en) * 2007-11-02 2008-03-26 清华大学 Pichia pastoris gene engineering bacterial strain and use thereof
CN103275912A (en) * 2012-03-15 2013-09-04 江苏省农业科学院 Enterohemorrhagic Escherichia coli (EHEC) O157:H7 multivalent fliC-hcpA-tir-eae recombinant bacteria and vaccines

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101148644A (en) * 2007-11-02 2008-03-26 清华大学 Pichia pastoris gene engineering bacterial strain and use thereof
CN103275912A (en) * 2012-03-15 2013-09-04 江苏省农业科学院 Enterohemorrhagic Escherichia coli (EHEC) O157:H7 multivalent fliC-hcpA-tir-eae recombinant bacteria and vaccines

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Expression of the Lignin Peroxidase H2 Gene from Phanerochaete chrysosporium in Escherichia coli;Guojun Nie,等;《BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS》;19981231;第249卷;146–150页，参见摘要、材料与方法 *
P21764.1 GI:126283;NAIDU, P.S. ET AL;《NCBI GENBANK》;20131016 *
木质素过氧化物酶基因lipH2 的克隆与异源表达特性研究;王玮;《中国博士学位论文全文数据库》;20100929;1-156 *

Also Published As

Publication number Publication date
CN103540606A (en) 2014-01-29

Similar Documents

Publication Publication Date Title
JP5498642B2 (en) Method for producing cellulose-degradable and hemicellulose-degradable enzymes using distillation residues from ethanol fermentation of hydrolysates by enzymes of (ligno) cellulose materials
da Silva Delabona et al. Using Amazon forest fungi and agricultural residues as a strategy to produce cellulolytic enzymes
Liu et al. Thermostable cellulase production of Aspergillus fumigatus Z5 under solid-state fermentation and its application in degradation of agricultural wastes
CN107142225B (en) A kind of pichia yeast recombinant bacterium of the source overexpression Streptomyces sp.FA1 zytase
JP2010536390A (en) Method for producing cellulase
CN104975039B (en) A kind of recombinant plasmid and its application in degraded cellulose raw material
JP2008538914A (en) Wood decay basidiomycetes for the production of lignin degrading enzymes
US10457925B2 (en) Process for the production of cellulolytic and/or hemicellulolytic enzymes
Xie et al. Saccharomycopsis fibuligera in liquor production: A review
Li et al. Efficient preparation of soluble inducer for cellulase production and saccharification of corn stover using in-house generated crude enzymes
Choi et al. Purification and Characterization of an Extracellular ${\beta} $-Glucosidase Produced by Phoma sp. KCTC11825BP Isolated from Rotten Mandarin Peel
CN103540606B (en) Express the colibacillus engineering of lignin peroxidase, preparation method and application thereof
US8753844B2 (en) Overproduction of ligninolytic enzymes
CN1766098A (en) A kind of mannase and encoding gene thereof and application
CN104726388B (en) A kind of Pullulanase bacterium producing multi enzyme preparation and the method for improving its enzymatic productivity
Zeng et al. Culturable fungal diversity and cellulase production by mixed culture Aspergillus fungi from Sanya mangrove
CN110184291A (en) A kind of building and its application of the non-methanol induction of Pichia pastoris expression vector of sequestered
CN105274112A (en) Promoter in induced expression under acidic condition
CN105820966B (en) Efficient chitosanase producing strain and fermentation method thereof
CN105543250B (en) Armilariella tabescens laccase gene and its recombinant yeast pichia pastoris engineering bacteria and application
CN112646797A (en) Method for heterogeneously expressing stropharia rugoso-annulata beta-glucosidase gene
KR101371416B1 (en) Optimized medium and fermentation conditions for xylanase mass production by recombinant Pichia pastoris
KR101350955B1 (en) Novel exoglucanase and the Use thereof
CN111893107A (en) Pichia pastoris engineering strain for heterologous expression of cellulase gene EG IV and application
CN1485431A (en) Gene engineering yeast strain of expressing beta-1,3-1,4-glucanase

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20150923

Termination date: 20181106