CN103525831A - Method for identifying high-pathotype Verticillium dahilae with specific genes and application thereof - Google Patents
Method for identifying high-pathotype Verticillium dahilae with specific genes and application thereof Download PDFInfo
- Publication number
- CN103525831A CN103525831A CN201310524788.1A CN201310524788A CN103525831A CN 103525831 A CN103525831 A CN 103525831A CN 201310524788 A CN201310524788 A CN 201310524788A CN 103525831 A CN103525831 A CN 103525831A
- Authority
- CN
- China
- Prior art keywords
- verticillium dahliae
- seq
- pathotype
- verticillium
- sequence shown
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a high-pathotype Verticillium dahilae gene which is provided with a nucleotide sequence shown by SEQ ID NO: 1. The invention further provides a method for identifying pathotype of Verticillium dahilae. The method comprises the following steps of (1) preparing the sample, to be tested, of whole genome DNA, wherein the sample includes the Verticillium dahilae; (2) carrying out PCR expansion with the whole genome DNA sample to be tested as a template, and detecting whether the nucleotide sequence shown by SEQ ID No.4 exits in an expansion product or not, wherein the sample to be tested is obtained in the step (1); (3) judging the pathotype of the Verticillium dahilae according to the detection result of the step (2). The invention further provides a kit.
Description
Technical field
The present invention relates to crop disease control field, particularly, relate to a kind of high pathotype verticillium dahliae (Verticillium dahliae) gene, a kind of method and test kit of identifying verticillium dahliae pathotype.
Background technology
Verticillium dahliae (Verticillium dahliae) is a kind of phytopathogenic fungi, and it can cause plant (especially farm crop are as cotton, tomato etc.) that verticillium occurs.But, the pathogenic performance difference of the verticillium dahliae bacterial strain of different pathotypes is very large, for example after the strain infection cotton of some high pathotype, can cause cotton to produce serious plant disease and cause that output of cotton declines, and after the strain infection cotton of some low pathotype, only cause the slight disease of cotton and affect less on output of cotton.In addition, verticillium dahliae also shows certain latent, and high pathotype bacterial strain then may be not pathogenic in infection, and serious pathogenic on a large scale in next year.
If can detect the main Strain type of verticillium dahliae in farmland, and its pathotype is made accurately to judgement, just can bound drug control and the generation of the agricultural measure inhibition disease such as crop rotation, thus increase economic benefit and social benefit.
Summary of the invention
The object of the invention is to solve the technical problem that how accurately to judge the pathotype of verticillium dahliae bacterial strain, a kind of high pathotype verticillium dahliae (Verticillium dahliae) gene, a kind of method and test kit of identifying verticillium dahliae pathotype are provided.
Nucleotides sequence shown in SEQ ID NO:1 classify as in the genome sequence of the verticillium dahliae bacterial strain at high pathotype that the inventor finds, occur and in the genome sequence of the verticillium dahliae of low pathotype absent variable sequence.Thereby, for a certain pathotype verticillium dahliae bacterial strain to be measured, as long as whether there is the sequence shown in SEQ ID NO:1 in the genomic sequence of this verticillium dahliae bacterial strain of evaluation, can know whether this verticillium dahliae bacterial strain is high pathotype verticillium dahliae.Particularly, if identified in the genomic sequence of this verticillium dahliae bacterial strain, there is not the sequence shown in SEQ ID NO:1, judge that this verticillium dahliae bacterial strain does not belong to high pathotype; If identify in the genomic sequence of this verticillium dahliae bacterial strain and have the sequence shown in SEQ ID NO:1, judge that this verticillium dahliae bacterial strain belongs to high pathotype.And, if the complete genome DNA sample to be tested of this verticillium dahliae bacterial strain of take does not exist the nucleotide sequence shown in SEQ ID NO:1 in template is carried out the product of pcr amplification, just can fully prove in the genomic sequence of this verticillium dahliae bacterial strain and not have the sequence shown in SEQ ID NO:1.Thus, the present inventor has obtained technical scheme of the present invention.
To achieve these goals, on the one hand, the invention provides a kind of high pathotype verticillium dahliae (Verticillium dahliae) gene, wherein, this gene has the nucleotide sequence shown in SEQ ID No:1.
On the other hand, the present invention also provides a kind of method of identifying verticillium dahliae pathotype, and the method comprises the following steps:
(1) sample to be tested of the complete genome DNA that preparation contains verticillium dahliae;
(2) take the complete genome DNA sample to be tested obtaining in step (1) carries out pcr amplification as template, detects in amplified production whether have the nucleotide sequence shown in SEQ ID No.4;
(3) according to the pathotype of the detected result judgement verticillium dahliae bacterial strain of step (2), in the situation that there is not the nucleotide sequence shown in SEQ ID No.4 in described amplified production, indicate the bacterial strain of described verticillium dahliae not belong to high pathotype; In the situation that exist and there is the nucleotide sequence shown in SEQ ID NO:4 in described amplified production, indicate the bacterial strain of this verticillium dahliae to belong to high pathotype.
On the other hand, the present invention also provides a kind of test kit, and described test kit contains primer provided by the invention and PCR reagent.
Other features and advantages of the present invention partly in detail are described the embodiment subsequently.
Embodiment
Below the specific embodiment of the present invention is elaborated.Should be understood that, embodiment described herein only, for description and interpretation the present invention, is not limited to the present invention.
The invention provides a kind of high pathotype verticillium dahliae (Verticillium dahliae) gene, wherein, this gene has the nucleotide sequence nucleic acid shown in SEQ ID No:1.
The present invention also provides a kind of method of identifying verticillium dahliae pathotype, and the method comprises the following steps:
(1) sample to be tested of the complete genome DNA that preparation contains verticillium dahliae;
(2) take the complete genome DNA sample to be tested obtaining in step (1) carries out pcr amplification as template, detects in amplified production whether have the nucleotide sequence shown in SEQ ID No.4;
(3) according to the pathotype of the detected result judgement verticillium dahliae bacterial strain of step (2), in the situation that there is not the nucleotide sequence shown in SEQ ID No.4 in described amplified production, indicate the bacterial strain of described verticillium dahliae not belong to high pathotype; In the situation that exist and there is the nucleotide sequence shown in SEQ ID NO:4 in described amplified production, indicate the bacterial strain of this verticillium dahliae to belong to high pathotype.
Wherein, the nucleic acid shown in SEQ ID NO:4 is a fragment of the nucleic acid shown in SEQ ID NO:1, and it can be take the nucleic acid shown in SEQ ID NO:1 by above-mentioned primer pair and obtain as template pcr amplification.
Wherein, preparing the step of sample to be tested can carry out according to the method for the preparation of detecting the sample of nucleic acid of this area routine, the present invention does not have special requirement, for example can gather tissue from cotton plants, and being organized on the substratum that contains resistance of gathering cultivated, and screening, distinguish the bacterium colony with separated verticillium dahliae, then according to (" plant genetic engineering " (what light source work, Science Press, publication in 2007)) method described in is extracted the genomic dna of verticillium dahliae, can prepare sample to be tested.
Wherein, whether detect in amplified production exists the method for the nucleotide sequence shown in SEQ ID NO:1 to carry out according to the method for this area routine and standard, for example can detect by agarose gel electrophoresis, if need to reclaim by the object band that electrophoresis is obtained order-checking, further judge.
The primer of using in described amplification can design according to the feature of nucleotide sequence and the rule of design of primers shown in SEQ ID No.1, under preferable case, described primer comprises the NO:2(F:5'CTGACGACTATAGTCCTCCTGG3' as SEQ ID) as shown in forward primer and as SEQ ID NO:3(R:5'CTTGATAGCAGCGGTAAGATTC3') as shown in reverse primer.
On the other hand, the present invention also provides a kind of test kit, described test kit contains primer and PCR reagent, wherein, described primer comprises the NO:2(F:5'CTGACGACTATAGTCCTCCTGG3' as SEQ ID) as shown in forward primer and as SEQ ID NO:3(R:5'CTTGATAGCAGCGGTAAGATTC3') as shown in reverse primer.
Below will describe the present invention by embodiment.In following examples, the bacterial strain of various verticillium dahliaes belongs to the genetic resources obtaining through legitimate channels.
Embodiment 1
The present embodiment is for illustrating the preparation of sample to be tested.Particularly, be the preparation from the genomic dna of 80 different verticillium dahliae bacterial strains (being numbered VDG1 to VDG80).
The stem that cuts cotton plants about 10-35cm place from earth's surface, is cut into 1mm
3the fritter of left and right size, be seeded in and containing microbiotic (penbritin, Rifampin and Streptomycin sulphate, concentration is 100 μ g/ml) PDA substratum (contain potato 200g/L, glucose 20g/L, agar 20g/L) on, at 25 ℃, cultivate 7 days, according to the standard colonial morphology of verticillium dahliae, differentiate the bacterium colony of verticillium dahliae.Obtain the bacterium colony of the verticillium dahliae differentiated as verticillium dahliae bacterial strain sample.
According to the method described above, from 80 different cotton plants, obtain 80 different verticillium dahliae bacterial strains, by above-mentioned 80 different verticillium dahliae bacterial strains, according to " plant genetic engineering ", (what light source is outstanding, Science Press, publication in 2007) method described in, extract respectively genomic dna sample, obtain sample to be tested 1-80.
Embodiment 2
The present embodiment is for illustrating the detected result of the pathotype of above-mentioned 80 different verticillium dahliae bacterial strains.
Reference literature (Zhang Xinghua, Resistance Strain of Cotton is withered, verticillium progress and Resistance Identification method thereof, Agriculture in Jiangxi journal, 2008,20 (3): sick garden, the artificial seedbed method 43-49), the verticillium dahliae bacterial strains different to 80 described in embodiment 1 carry out cotton in seedling stage Pathotypes.Disease index with described 80 different verticillium dahliae bacterial strains after the healthy cotton plants of inoculation characterizes the height of pathotype.
Particularly, verticillium dahliae is being looked into the Bick substratum (NaNO of 2g/L
3, the K of 1g/L
2hPO
4, the KCl of 0.5g/L, the MgSO of 0.5g/L
4, the FeSO of 0.01g/L
4, the sucrose of 30g/L, the agar of 20g/L) on be cultured to generation spore, with spore under aseptic washing, obtain spore suspension, and the spore concentration in spore suspension be adjusted to 2 * 10
6individual/ml.Then, at the hypocotyl place of the cotton 15 age in days seedling of same kind, use the asepsis injector of 1ml specification to inoculate above-mentioned spore suspension, every strain inoculum size is 100 μ l, adds up weekly incidence after inoculation, calculates the disease index of 4th week.
The present embodiment detects the pathotype that has obtained above-mentioned 80 different verticillium dahliae bacterial strains, by above-mentioned judging standard, identify the disease index of 61 verticillium dahliae bacterial strains wherein all higher than 35, belong to high pathotype, and the disease index of other 19 verticillium dahliae bacterial strains is all lower than 20, do not belong to high pathotype.
Above-mentioned 61 verticillium dahliae bacterial strains that belong to high pathotype are respectively: VDG3, VDG63, VDG61, VDG18, VDG35, VDG32, VDG73, VDG31, VDG33, VDG26, VDG55, VDG23, VDG57, VDG36, VDG11, VDG67, VDG47, VDG5, VDG29, VDG59, VDG49, VDG44, VDG21, VDG48, VDG8, VDG50, VDG25, VDG43, VDG37, VDG46, VDG16, VDG4, VDG68, VDG6, VDG52, VDG34, VDG7, VDG45, VDG12, VDG76, VDG27, VDG10, VDG41, VDG64, VDG17, VDG54, VDG39, VDG75, VDG20, VDG13, VDG22, VDG38, VDG19, VDG28, VDG14, VDG9, VDG53, VDG15, VDG42, VDG40 and VDG1.Above-mentioned 19 verticillium dahliae bacterial strains that do not belong to high pathotype are respectively: VDG70, VDG69, VDG71, VDG24, VDG79, VDG65, VDG56, VDG77, VDG74, VDG30, VDG80, VDG60, VDG2, VDG58, VDG66, VDG62, VDG72, VDG80 and VDG51.
Embodiment 3
According to the method for regulation in the specification sheets (Solexa technology) of the sequenator Genome Analyzer of Illumina company, measure the whole genome sequence of verticillium dahliae bacterial strain (being numbered VDG1 and VDG2).
The present embodiment has obtained the whole genome sequence of above-mentioned 2 different verticillium dahliae bacterial strains, by sequence alignment, identifies in the whole genome sequence of VDG1 and does not contain the sequence shown in SEQ ID NO:1; And in the whole genome sequence of VDG2, contain the sequence shown in SEQ ID NO:1.
By above-mentioned identical method, 61 that identify in above-mentioned 80 different verticillium dahliae bacterial strains (are respectively VDG3, VDG63, VDG61, VDG18, VDG35, VDG32, VDG73, VDG31, VDG33, VDG26, VDG55, VDG23, VDG57, VDG36, VDG11, VDG67, VDG47, VDG5, VDG29, VDG59, VDG49, VDG44, VDG21, VDG48, VDG8, VDG50, VDG25, VDG43, VDG37, VDG46, VDG16, VDG4, VDG68, VDG6, VDG52, VDG34, VDG7, VDG45, VDG12, VDG76, VDG27, VDG10, VDG41, VDG64, VDG17, VDG54, VDG39, VDG75, VDG20, VDG13, VDG22, VDG38, VDG19, VDG28, VDG14, VDG9, VDG53, VDG15, VDG42, VDG40 and VDG1) genomic sequence in all contain the sequence shown in SEQ ID NO:1, and, in the whole genome sequence of 19 verticillium dahliae bacterial strains (being respectively VDG70, VDG69, VDG71, VDG24, VDG79, VDG65, VDG56, VDG77, VDG74, VDG30, VDG80, VDG60, VDG2, VDG58, VDG66, VDG62, VDG72, VDG80 and VDG51) in addition, do not contain the sequence shown in SEQ ID NO:1.
According to the result of embodiment 2 and embodiment 3, can determine, if identified in the genomic sequence of verticillium dahliae bacterial strain, have the sequence shown in SEQ ID NO:1, this verticillium dahliae bacterial strain belongs to high pathotype; If identify in the genomic sequence of verticillium dahliae bacterial strain and do not have the sequence shown in SEQ ID NO:1, this verticillium dahliae bacterial strain does not belong to high pathotype.
Embodiment 4
The detection sample DNA making respectively in embodiment 1 of usining carries out pcr amplification as template, and primer comprises the NO:2(F:5'CTGACGACTATAGTCCTCCTGG3' as SEQ ID) as shown in forward primer and as SEQ ID NO:3(R:5'CTTGATAGCAGCGGTAAGATTC3') as shown in reverse primer.
Concrete amplification condition comprises: 94 ℃, and 10 minutes; (94 ℃, 30 seconds, 54 ℃, 45 seconds, 72 ℃, 1 minute) 35 circulations; 72 ℃, 10 minutes, amplified production is carried out to agarose gel electrophoresis detection.
Detected result explanation: 61 in above-mentioned 80 different verticillium dahliae bacterial strains (are respectively VDG3, VDG63, VDG61, VDG18, VDG35, VDG32, VDG73, VDG31, VDG33, VDG26, VDG55, VDG23, VDG57, VDG36, VDG11, VDG67, VDG47, VDG5, VDG29, VDG59, VDG49, VDG44, VDG21, VDG48, VDG8, VDG50, VDG25, VDG43, VDG37, VDG46, VDG16, VDG4, VDG68, VDG6, VDG52, VDG34, VDG7, VDG45, VDG12, VDG76, VDG27, VDG10, VDG41, VDG64, VDG17, VDG54, VDG39, VDG75, VDG20, VDG13, VDG22, VDG38, VDG19, VDG28, VDG14, VDG9, VDG53, VDG15, VDG42, VDG40 and VDG1) genomic sequence in all there is the sequence shown in SEQ ID NO:4, prove that these verticillium dahliae bacterial strains all exist the nucleic acid with the sequence shown in SEQ ID NO:1, judge that accordingly these verticillium dahliae bacterial strains belong to high pathotype.And, in the genomic sequence of 19 verticillium dahliae bacterial strains (being respectively VDG70, VDG69, VDG71, VDG24, VDG79, VDG65, VDG56, VDG77, VDG74, VDG30, VDG80, VDG60, VDG2, VDG58, VDG66, VDG62, VDG72, VDG80 and VDG51) in addition, there is not the sequence shown in described SEQ ID NO:4; Prove that these verticillium dahliae bacterial strains all do not exist the nucleic acid with the sequence shown in SEQ ID NO:1, judge that accordingly these verticillium dahliae bacterial strains do not belong to high pathotype.
According to the result of embodiment 2 and embodiment 4, can determine, if identified in the genomic sequence of verticillium dahliae bacterial strain, do not have the nucleotide sequence shown in SEQ ID NO:1, this verticillium dahliae bacterial strain does not belong to high pathotype; If identify in the genomic sequence of verticillium dahliae bacterial strain and have the nucleotide sequence shown in SEQ ID NO:1, this verticillium dahliae bacterial strain belongs to high pathotype.
Claims (4)
1. high pathotype verticillium dahliae (Verticillium dahliae) gene, is characterized in that, this gene has the nucleotide sequence shown in SEQ ID No:1.
2. a method of identifying verticillium dahliae pathotype, the method comprises the following steps:
(1) sample to be tested of the complete genome DNA that preparation contains verticillium dahliae;
(2) take the complete genome DNA sample to be tested obtaining in step (1) carries out pcr amplification as template, detects in amplified production whether have the nucleotide sequence shown in SEQ ID No.4;
(3) according to the pathotype of the detected result judgement verticillium dahliae bacterial strain of step (2), in the situation that there is not the nucleotide sequence shown in SEQ ID No.4 in described amplified production, indicate the bacterial strain of described verticillium dahliae not belong to high pathotype; In the situation that exist and there is the nucleotide sequence shown in SEQ ID NO:4 in described amplified production, indicate the bacterial strain of this verticillium dahliae to belong to high pathotype.
3. method according to claim 2, wherein, described step (2) pcr amplification primer used comprises forward primer and the reverse primer as shown in SEQ ID NO:3 as shown in SEQ ID NO:2.
4. a test kit, described test kit is containing primer and PCR reagent in good grounds claim 3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310524788.1A CN103525831B (en) | 2013-10-30 | 2013-10-30 | Specific gene is utilized to identify method and the application thereof of high pathotype verticillium dahliae |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310524788.1A CN103525831B (en) | 2013-10-30 | 2013-10-30 | Specific gene is utilized to identify method and the application thereof of high pathotype verticillium dahliae |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103525831A true CN103525831A (en) | 2014-01-22 |
| CN103525831B CN103525831B (en) | 2016-01-13 |
Family
ID=49928180
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310524788.1A Active CN103525831B (en) | 2013-10-30 | 2013-10-30 | Specific gene is utilized to identify method and the application thereof of high pathotype verticillium dahliae |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103525831B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103243093A (en) * | 2012-03-01 | 2013-08-14 | 中国农业科学院作物科学研究所 | Nucleic acid, method for identifying pathotype of fungus strain and kit |
| CN103243092A (en) * | 2012-03-01 | 2013-08-14 | 中国农业科学院作物科学研究所 | Nucleic acid, method for identifying pathotype of fungus strain and kit |
| CN103333969A (en) * | 2013-07-29 | 2013-10-02 | 中国农业科学院植物保护研究所 | Method and kit for quickly detecting verticillium dahliae through PCR (polymerase chain reaction) |
-
2013
- 2013-10-30 CN CN201310524788.1A patent/CN103525831B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103243093A (en) * | 2012-03-01 | 2013-08-14 | 中国农业科学院作物科学研究所 | Nucleic acid, method for identifying pathotype of fungus strain and kit |
| CN103243092A (en) * | 2012-03-01 | 2013-08-14 | 中国农业科学院作物科学研究所 | Nucleic acid, method for identifying pathotype of fungus strain and kit |
| CN103333969A (en) * | 2013-07-29 | 2013-10-02 | 中国农业科学院植物保护研究所 | Method and kit for quickly detecting verticillium dahliae through PCR (polymerase chain reaction) |
Non-Patent Citations (1)
| Title |
|---|
| 田李 等: "大丽轮枝菌（Verticillium dahliae VdLs.17）分泌组预测及分析", 《中国农业科学》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103525831B (en) | 2016-01-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103243093B (en) | Nucleic acid, method for identifying pathotype of fungus strain and kit | |
| Yang et al. | Anastomosis group and pathogenicity of Rhizoctonia solani associated with stem canker and black scurf of potato in Heilongjiang province of China | |
| CN105063761A (en) | Method for identifying predator nematophagous hyphomycete arthrobotrys through DNA bar codes | |
| Zhao et al. | Phylogeny and pathogenicity of Fusarium spp. isolated from greenhouse melon soil in Liaoning Province | |
| CN112626249A (en) | SCAR marker for identifying X9 strain of Tremella aurantialba or Tremella aurantialba strain comprising X9 strain | |
| CN108588249B (en) | Primer pair for detecting sweet potato stem rot bacteria and detection method thereof | |
| CN103243092B (en) | Nucleic acid, method for identifying pathotype of fungus strain and kit | |
| Liu et al. | Colletotrichum species associated with cassava anthracnose in China | |
| CN103255136B (en) | Nucleic acid, and method and kit used for identifying fungal strain pathogenic type | |
| CN104962639A (en) | LAMP primer group and detection method for rapidly detecting corynespora cassiicola | |
| CN108342505B (en) | Chromosome segment related to leaf rust resistance and application thereof | |
| CN103397099A (en) | Method for detecting quantity of pseudomonas fluorescens in rhizospheric soil during growth period of transgenic wheat by virtue of fluorescent quantitative PCR (Polymerase Chain Reaction) | |
| CN104232748B (en) | Whether a kind of red bayberry nursery stock carries the rapid molecular detection method of wilting germ | |
| Avan et al. | Characterization and pathogenicity of Rhizoctonia species causing root rot and damping-off on sugar beet in Turkey | |
| CN104099408A (en) | Qualitative detection method for potato scab germs | |
| CN103525833B (en) | Gene, method used for identifying pathogenicity of Verticillium dahliae and kit | |
| CN105602948A (en) | Genes and method for identifying gossypium hirsutum linn. variety verticillium wilt resistance by fluorescence quantitative PCR technique | |
| CN109825604A (en) | With the molecular labeling of peach aphid resistance shape close linkage, for detecting the primer, kit, method and its application of peach aphid resistance shape | |
| Kumari et al. | Distribution and diversity of Fusarium oxysporum f. sp. cubense TR4 causing banana wilt in Sub-tropics of India and comparative analysis of TR4 specific molecular detection methods | |
| CN103525831B (en) | Specific gene is utilized to identify method and the application thereof of high pathotype verticillium dahliae | |
| CN104212896B (en) | The Molecular Identification primer of a kind of Tobacco Angular Leaf Spot Disease bacterium and authentication method | |
| CN103602676B (en) | The method of nucleic acid and primer pair and qualification verticillium dahliae pathotype and test kit | |
| CN103571834B (en) | The method of qualification verticillium dahliae pathotype and test kit and the nucleic acid contained and primer pair | |
| CN103525832B (en) | The test kit of qualification verticillium dahliae pathotype and gene and method thereof | |
| Hidayat et al. | Endophytic fungal diversity from Cinchona calisaya based on phylogenetic analysis of the ITS ribosomal DNA sequence data |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |