CN103525830B - Gene capable of enhancing ammonium-secreting ability of nitrogen-fixing bacteria - Google Patents

Abstract

The invention relates to a gene capable of enhancing an ammonium-secreting ability of nitrogen-fixing bacteria. A gene which has a nucleotide sequence as shown in SEQ ID NO:1 is obtained by a mutation experiment, and is transferred into pseudomonas stutzeri A1561 bacteria capable of secreting ammonium to obtain a strain; experiments confirm that the strain has higher nitrogen-fixing and ammonium-secreting abilities than the A1561 strain. The gene provided by the invention can be applied in production of microbial fertilizers for providing nitrogen fertilizers.

Description

A kind ofly strengthen the gene that vinelandii secrete ammonium ability

Technical field:

The present invention relates to and a kind ofly strengthen the gene that vinelandii secrete ammonium ability.

Background technology:

The research of biological nitrogen fixation contributes to producing more food and free from environmental pollution.Secrete ammonium bacterium to born of the same parents' external environment secretion ammonium, for host plant provides a certain amount of nitrogen.

Secrete under ammonium bacterium is confined to laboratory environment for the research of the growth-promoting functions of plant more at present, be applied to land for growing field crops environment and also will improve it from following factor: 1) improve the rhizospere competition secreting ammonium bacterium; 2) combined nitrogen is the principal element suppressing fixing atmospheric nitrogen, improves and secrete the nitrogen fixing capacity of ammonium bacterium and resistance to ammonium ability under high ammonium condition; 3) in soil microorganisms flora, make to secrete ammonium bacterium and become dominant microflora; 4) improve the supply of the fixed nitrogen energy and optimize its composition.

Pseudomonas stanieri A1501(Pseudomonas stutzeri A1501) be a strain combination azotobacter, be located away from south China rice terrace in 1980.Although this bacterial strain has obvious nitrogen fixing capacity, their fixing nitrogens are mainly used to the growth needs meeting self, and the nitrogen being supplied to plant is limited.Particularly when there is ammonium in the external world, the nitrogen fixed just less, even stop fixed nitrogen and secrete ammonium, which limits the exploitation of combination azotobacter and the application in agriculture production.

Chinese patent application 200910236131.9 provides a kind of restructuring and secretes ammonium bacterium, by carrying out genetic modification to pseudomonas stanieri A1501, disappearance ammonium transport vehicle albumen amtB1, amtB2 gene, proceed to nitrogenase positive regulator gene (nif A) simultaneously, this Strain Designation is 1561/pVA3, has certain to secrete ammonium ability.But suddenly change for nitrogenase positive regulator gene (nif A), to improve its fixed nitrogen and to secrete ammonium ability, the ammonium bacterium that secretes obtaining high-efficiency nitrogen-fixing have not been reported.

Alleged herein " pseudomonas stanieri ", also can be described as " Pseudomonas stutzeri ".

Summary of the invention:

The object of the invention is to suddenly change to nitrogenase positive regulator gene (nif A) by the means of gene recombination, and proceeded to pseudomonas stanieri A1561 bacterium, develop the new association nitrogen fixation gene efficiently secreting ammonium, to provide the microbial-bacterial fertilizer with application potential.

The present invention obtains the nif AM gene with the nucleotide sequence shown in SEQ ID NO:1 by mutating experiment, and the gene of sudden change can improve pseudomonas stanieri A1561 and secrete ammonium amount, and is efficiently secreted the combination azotobacter of ammonium, confirms above-mentioned discovery.

Acquisition and the strain construction concrete grammar of nif AM gene are as follows:

1. gene clone

Extract the genome of pseudomonas stanieri A1501, with extracted genome for template, obtain nif A gene by PCR method.With nif A gene for template, fallibility mutagenesis methods nif A gene.

2. vector construction

Clone (New York:Cold Spring Harbor Laboratory Press, 1989) according to a conventional method.Cloned nitrogenase regulatory gene (nif AM), nif AM nucleotide sequence is as shown in SEQ ID NO:1.

DNA fragmentation containing complete nif AM is connected to pVK100, constructs constitutive expression plasmid pVKAM.

3. three parents engage

Engage can not import in recipient bacterium by the self-plasmid shifted by three parents.

4. the screening of recon and qualification

Choose after the bacterium colony that grows of part turns three flat boards continuously, carry out bacterium colony PCR qualification.Afterwards, identify secreting ammonium situation.

The test of survey ammonium is carried out through adopting indophenol blue colorimetry, and compared with strains A 1561,1561/pVA3 (see embodiment 3), the combination azotobacter strain capable of high-efficiency that confirmation the present invention builds secretes ammonium, and then can be farm crop and provide nitrogenous fertilizer, is a kind of potential microbial fertilizer.

Accompanying drawing illustrates:

Fig. 1 is the amplification of nif AM DNA homolog fragment;

Fig. 2 is the physical map of intestinal bacteria recombinant vectors pVKAM;

Fig. 3 is that engineering bacteria 1561/pVA3, A1561,1561/pVKAM secrete ammonium and compare.X-coordinate is cultivated days, and ordinate zou is ammonium concentration.

Sequence table explanation

1, the Nucleotide of SEQ ID NO:1nifAM;

2, SEQ ID NO:2 is the aminoacid sequence that the nif AM derived from SEQ ID NO:1 encodes.

Embodiment

Experiment material below used in experiment illustrates and originates as follows:

Bacterial strain and carrier:

Coli strain E.coli JM109 is purchased from Novagen company;

Pseudomonas stanieri A1561: obtain after lacking amtB1, amtB2 gene by wild pseudomonas stanieri A1501, derive from biotechnology institute of the Chinese Academy of Agricultural Sciences;

1561/pVA3 bacterial strain: be proceed to nif A gene (see Chinese patent application 200910236131.9) in 1561 bacterial strains, derive from biotechnology institute of the Chinese Academy of Agricultural Sciences;

PVK100 carrier: by people such as Knauf in structure, is shown in magazine Plasmid1982,8:45-54, and following experiment carrier derives from biotechnology institute of the Chinese Academy of Agricultural Sciences.

Enzyme and test kit:

Restriction enzyme, ligase enzyme, Taq enzyme is NEB Products.

It is Tian Gen biochemical corp product that genome extracts test kit.

Biochemical reagents: the reagent such as IPTG, X-Gal, SDS are Sigma Products.

Substratum: Escherichia coli culture medium is LB(1% peptone, 0.5% yeast extract, 1%NaCl, pH7.0).The restricted substratum of A15: potassium primary phosphate 0.4g, dipotassium hydrogen phosphate 0.1g, sodium-chlor 0.1g, magnesium sulfate heptahydrate 0.2g, manganese sulfate monohydrate 0.01g, sulfuric acid monohydrate iron 0.01g, Sodium orthomolybdate 0.01g, Sodium.alpha.-hydroxypropionate 6ml, ammonium sulfate 0.4g is settled to 1000ml, adjusts pH6.8.For liquid culture, 28 DEG C of shaking tables, 180-200rpm, cultivates 16 ~ 18h.Ammonium sulfate is removed in the restricted substratum of A15 nitrogen-free agar: A15.

The experimental technique of other unreceipted actual conditions in embodiment, conventionally carry out, as the method for the people such as Sambrook, molecular cloning is by (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in laboratory manual, or according to the condition that manufacturer advises.

The acquisition of embodiment 1nifAM gene

Extract the genome of pseudomonas stanieri A1501.With extracted genome for template, carry out pcr amplification.The primer used according to 5 ' of nifA gene and 3 ' terminal sequence synthesis, 2 primer sequences are respectively:

5 ' CCGAAGCTTTCAGATCTTGCGCATATGA3 ' and

5’CCGAAGCTTACGGTGCATATCGATAGC3’，

Obtain complete nifA gene by PCR method, and comprise one section of nucleotide sequence that upstream, nifA gene coding region is about 70bp, the long object fragment for 1.6kb.With nifA gene for template, use Labest fallibility PCR mutagenesis kit, sudden change nifA gene.Obtain the rear gene (Fig. 1) of sudden change, name nifAM.

Embodiment 2 nifAM builds genetic engineering bacterium 1561/pVKAM and checking

Reclaim nifAM fragment by Hind III digestion, the shuttle vectors pVK100 cut with same enzyme connects.Tc ^skm ^rresistance screening, extract plasmid, Hind III and EcoR I enzyme cut qualification, and Fig. 2 is shown in by recombinant plasmid pVKAM collection of illustrative plates.

Respectively by donor bacterium pVKAM, recipient bacterium 1561, helps bacterium pRK2013 to mix according to the ratio of 1:1:1, and the method combined by three parents, is proceeded in 1561 by recombinant plasmid pVKAM, then carry out kantlex (Km), tsiklomitsin (Tc) resistance screening.Whether random selecting 3 three close zygotes, extract plasmid checking pVKAM and proceed in 1561.Recipient bacterium 1561 is the mutant strain obtained early stage, has lacked amtB gene.

After extracting plasmid, take plasmid DNA as template, carry out PCR checking, obtain the fragment of 1.6kb, to extract the empty plasmid of 1561 for negative control; Plasmid is verified by EcoR I and Hind III digestion simultaneously, cut out two bands respectively, thus obtain the engineering bacteria of restructuring, called after 1561/pVKAM.

Embodiment 3nif AM secretes ammonium effect comparison

1, experiment purpose

The transformation bacterial strain proceeding to nif AM gene by quantitative comparison secretes ammonium effect with set out bacterium A1561,1561/pVA3's, the function of checking nif AM gene;

2, experimental subjects

Experimental strain: the engineering bacteria 1561/pVKAM(embodiment 2 proceeding to nif AM gene obtains);

2 kinds of control strains: the bacterium A1561 that sets out, proceed to the engineering bacteria A1561/pVA3 of nif A gene.

3, experimental technique

3.1NH ₄ ⁺the mensuration of concentration is according to indophenol blue colorimetry (Bender et al.1977), and concrete operations are as follows:

1) solution A, B solution is prepared

Solution A (100ml): 5g phenol; 0.025g Na-nitroprusside (Na ₂fe [CN] ₅nO2H ₂o);

B solution (100ml): 62.5ml1M NaOH; 3.3ml NaOCl (available chlorine 5.25%).

2) NH4+ concentration standard curve is drawn

Preparation NH ₄ ⁺the serial dilutions (NH of serial dilution 1M ₄ ⁺be 0.1,0.2,0.4,0.6,0.8,1.0,1.5,2.0mM; After adding A, B solution reaction 20min, at OD ₆₂₅colorimetric)

3) get respectively 100 μ l experimental bacteria and two kinds contrast bacterium microbial culture supernatant liquor, add 100 μ l B solution after adding 100 μ l solution A again, observing response liquid color after 20min, by with NH ₄ ⁺the shade of concentration standard curve is compared, and judges whether there is NH ₄ ⁺and concentration.

4) experimental bacteria 1561/pVKAM and two kind of contrast bacterium is inoculated in semi-solid without nitrogen restricted substratum (1000ml, KH respectively ₂pO ₄0.4g, K ₂hPO40.1g, NaCl0.1g, MgSO ₄.7H ₂o0.2g, MnSO4.H ₂o0.01g, Fe ₂(S0 ₄) ₃.H2O0.01g, Na ₂moO ₄.H ₂o0.01g, C ₃h ₅naO ₃6ml, adds the agar of 0.1%-0.2%, pH6.8) in, be full of N ₂, 0.5%O ₂, cultivate after 15 days under 30 DEG C of conditions, the nitrogenase adopting acetylene reduction method to measure two kinds of bacterium is respectively lived, and with secreting ammonium amount and pH value in ammonia-nitrogen respectively test experience bacterial strain and two kinds of contrast bacterium culture mediums.

More than test and all repeat more than 3 times.

3.2 nitrogenase activities measure, and adopt acetylene reduction method to measure, concrete operations are as follows:

Use SP-2305 type gas chromatograph for determination.Each bacterial strain to be measured is activated simultaneously, keeps growth conditions consistent; By each bacterial strain access after activation containing corresponding antibiotic liquid A 15 substratum, 30 DEG C of shaking culture 20h.Measure the OD600 value of each bacterial strain.From each test tube, take out appropriate bacterium liquid, 4,000g, 4 DEG C of centrifugal 10min, collect thalline.

With brine thalline twice, be fully suspended in without in nitrogen A15 liquid nutrient medium, make OD600=1.0; Each little triangular flask adds 9ml without nitrogen A15 liquid nutrient medium, and access 1ml bacterium liquid, makes bacterium liquid final concentration be OD600=0.1; Each little triangular form bottle stopper is entered plug, injects pure argon, simultaneously exhausted air.Then inject the oxygen of 0.5% volume and the acetylene of 10% volume brand-new, 30 DEG C of thermal agitations are cultivated, and coerce 4h.From each little serum bottle, take out 0.25ml gas gas chromatography determination ethylene content with microsyringe every 1h, compare its nitrogenase activity height according to the height at each sample ethene peak.More than test and all repeat more than 3 times.

Area × (test tube gaseous phase volume/sample size)/(area × reaction times at 1nmol standard ethene peak) at ethene peak on nitrogenase work=registering instrument

4, experimental result

1) nitrogenase is lived

Under fixed nitrogen condition, nitrogenase containing the transformation bacterium 1561/pVKAM of nif AM gene is lived as 19.06U/mg, the nitrogenase of the nitrogenase 14.24U/mg alive of contrast bacterium 1561/pVA3, contrast bacterium A1561 is lived as 7.41U/mg, 1561/pVKAM are 2.57 times that A1561 nitrogenase is lived.

2) medium pH

Cultivate after 20 days, find that contrast bacterium A1561 substratum is not aobvious blue, namely do not secrete ammonium, ammonium concentration is 0, pH value 7.10; And the substratum of 1561/pVKAM is aobvious blue, and secretes ammonium amount and reach 6.96mM, its substratum is weakly alkaline (pH value=7.48); The substratum of 1561/pVA3 is aobvious blue, and secretes ammonium amount and reach 5.15mM, and its substratum is weakly alkaline (pH value=7.42).Result of study shows that 1561/pVKAM has stronger nitrogen fixation activity compared with 1561/pVA3, and can to the more ammonium of cell exocrine.

Result is as shown in Fig. 3, table 1.

Table 1 three kinds of bacterium secrete ammonium effect and compare

Above result of study shows: the nitrogen fixation activity of 1561/pVKAM and to the ability of cell exocrine ammonium higher than A1561, also higher than 1561/pVA3, and have significant difference.

5, experiment conclusion

The sudden change nitrogenase positive regulator gene nif AM gene that the present invention obtains has stronger nitrogen fixation activity and efficiently secretes ammonium effect, and the ammonium effect of secreting of engineering strain 1561/pVKAM therefrom is higher than the 1561/pVA3 bacterial strain proceeding to the nif A gene do not suddenlyd change in 1561 bacterial strains.

Claims (9)

1. can strengthen the gene that vinelandii secrete ammonium ability, its nucleotide sequence is as shown in SEQ ID NO:1.

2. containing the recombinant plasmid of gene described in claim 1.

3. plasmid according to claim 2 is producing the application had in fixed nitrogen function bacterial manure.

4. containing the carrier of gene described in claim 1.

5. with the host cell of vector according to claim 4.

6., containing the recombinant strain of gene described in claim 1, feature gene described in claim 1 is proceeded to pseudomonas stanieri A1561 bacterium to obtain.

7. bacterial strain described in claim 6 is producing the application had in fixed nitrogen function bacterial manure.

8. the albumen of genes encoding described in claim 1, its aminoacid sequence is as shown in SEQ ID NO:2.

9. albumen described in claim 9 is producing the application had in fixed nitrogen function bacterial manure.