CN103525830A - Gene capable of enhancing ammonium-secreting ability of nitrogen-fixing bacteria - Google Patents

Abstract

The invention relates to a gene capable of enhancing an ammonium-secreting ability of nitrogen-fixing bacteria. A gene which has a nucleotide sequence as shown in SEQ ID NO:1 is obtained by a mutation experiment, and is transferred into pseudomonas stutzeri A1561 bacteria capable of secreting ammonium to obtain a strain; experiments confirm that the strain has higher nitrogen-fixing and ammonium-secreting abilities than the A1561 strain. The gene provided by the invention can be applied in production of microbial fertilizers for providing nitrogen fertilizers.

Description

A kind ofly strengthen the gene that vinelandii secrete ammonium ability

Technical field:

The present invention relates to a kind of gene that vinelandii secrete ammonium ability that strengthens.

Background technology:

The research of biological nitrogen fixation contributes to produce more food and is free from environmental pollution.Secrete ammonium bacterium to born of the same parents' external environment secretion ammonium, for host plant provides a certain amount of nitrogen.

Secrete at present ammonium bacterium and be confined under laboratory environment more for the research of the growth-promoting functions of plant, be applied to land for growing field crops environment and also will to it, improve from following factor: 1) improve the rhizospere competition of secreting ammonium bacterium; 2) combined nitrogen is to suppress the fixedly principal element of atmospheric nitrogen, improves nitrogen fixing capacity and the resistance to ammonium ability of secreting ammonium bacterium under high ammonium condition; 3) in soil microorganisms flora, make to secrete ammonium bacterium and become dominant microflora; 4) improve the supply of the fixed nitrogen energy and optimize its composition.

Pseudomonas stanieri A1501(Pseudomonas stutzeri A1501) be a strain combination azotobacter, in 1980, be located away from south China rice terrace.Although this bacterial strain has obvious nitrogen fixing capacity, their fixing nitrogens are mainly used to meet the growth needs of self, and it is limited to offer the nitrogen of plant.The in the situation that of particularly having ammonium in the external world, fixing nitrogen just still less, even stops fixed nitrogen and secretes ammonium, and this has just limited the exploitation of combination azotobacter and the application in agriculture production.

Chinese patent application 200910236131.9 provides a kind of restructuring to secrete ammonium bacterium, by pseudomonas stanieri A1501 is carried out to genetic modification, disappearance ammonium transport vehicle albumen amtB1, amtB2 gene, proceed to nitrogenase positive regulator gene (nif A) simultaneously, this bacterial strain called after 1561/pVA3, has certain ammonium ability of secreting.But for nitrogenase positive regulator gene (nif A), suddenly change, to improve its fixed nitrogen and to secrete ammonium ability, the ammonium bacterium that secretes that obtains high-efficiency nitrogen-fixing have not been reported.

Alleged " pseudomonas stanieri ", also can be described as " Pseudomonas stutzeri " herein.

Summary of the invention:

The object of the invention is by the means of gene recombination, nitrogenase positive regulator gene (nif A) to be suddenlyd change, and proceeded to pseudomonas stanieri A1561 bacterium, develop the new association nitrogen fixation gene of efficiently secreting ammonium, so that the microbial-bacterial fertilizer with application potential to be provided.

The present invention obtains having the nif AM gene of the nucleotide sequence shown in SEQ ID NO:1 by mutating experiment, the gene of sudden change can improve pseudomonas stanieri A1561 and secrete ammonium amount, and obtains efficiently secreting the combination azotobacter of ammonium, has confirmed above-mentioned discovery.

Acquisition and the strain construction concrete grammar of nif AM gene are as follows:

1. gene clone

The genome that extracts pseudomonas stanieri A1501, the genome being extracted of take is template, by PCR method, obtains nif A gene.The nif A gene of take is template, fallibility mutation method sudden change nif A gene.

2. vector construction

Clone according to a conventional method (New York:Cold Spring Harbor Laboratory Press, 1989).Cloned nitrogenase regulatory gene (nif AM), nif AM nucleotide sequence is as shown in SEQ ID NO:1.

The DNA fragmentation that contains complete nif AM is connected to pVK100, has built constitutive expression plasmid pVKAM.

3. three parents engage

By three parents, engage and can not import in recipient bacterium by the self-plasmid shifting.

4. the screening of recon and evaluation

Choose the bacterium colony partly growing and turn continuously after three flat boards, carry out bacterium colony PCR evaluation.Afterwards, to secreting ammonium situation, identify.

Through adopting indophenol blue colorimetry, survey ammonium test, and compare with strains A 1561,1561/pVA3 (seeing embodiment 3), confirmation is secreted ammonium with the combination azotobacter strain capable of high-efficiency that the present invention builds, and then can be farm crop nitrogenous fertilizer is provided, and is a kind of potential microbial fertilizer.

Accompanying drawing explanation:

Fig. 1 is the amplification of nif AM DNA homolog fragment;

Fig. 2 is the physical map of intestinal bacteria recombinant vectors pVKAM;

Fig. 3 is that engineering bacteria 1561/pVA3, A1561,1561/pVKAM secrete ammonium comparison.X-coordinate is cultivated days, and ordinate zou is ammonium concentration.

Sequence table explanation

1, the Nucleotide of SEQ ID NO:1nifAM;

2, SEQ ID NO:2 is the aminoacid sequence of the nif AM coding derived from SEQ ID NO:1.

Embodiment

Below in experiment, experiment material used illustrates and originates as follows:

Bacterial strain and carrier:

Coli strain E.coli JM109 is purchased from Novagen company;

Pseudomonas stanieri A1561: by obtaining after wild pseudomonas stanieri A1501 disappearance amtB1, amtB2 gene, derive from biotechnology institute of the Chinese Academy of Agricultural Sciences;

1561/pVA3 bacterial strain: be to proceed to nif A gene (seeing Chinese patent application 200910236131.9) in 1561 bacterial strains, derive from biotechnology institute of the Chinese Academy of Agricultural Sciences;

PVK100 carrier: by people such as Knauf, in structure, see magazine Plasmid1982,8:45-54, below experiment derives from biotechnology institute of the Chinese Academy of Agricultural Sciences with carrier.

Enzyme and test kit:

Restriction enzyme, ligase enzyme ，TaqMei Wei NEB company product.

Genome extracts test kit Wei Tiangen biochemical corp product.

The reagent such as biochemical reagents: IPTG, X-Gal, SDS are Sigma company product.

Substratum: Escherichia coli culture medium is LB(1% peptone, 0.5% yeast extract, 1%NaCl, pH7.0).The restricted substratum of A15: potassium primary phosphate 0.4g, dipotassium hydrogen phosphate 0.1g, sodium-chlor 0.1g, magnesium sulfate heptahydrate 0.2g, manganese sulfate monohydrate 0.01g, sulfuric acid monohydrate iron 0.01g, Sodium orthomolybdate 0.01g, Sodium.alpha.-hydroxypropionate 6ml, ammonium sulfate 0.4g is settled to 1000ml, adjusts pH6.8.For liquid culture, 28 ℃ of shaking tables, 180-200rpm, cultivates 16～18h.In the restricted substratum of A15 nitrogen-free agar: A15, remove ammonium sulfate.

The experimental technique of other unreceipted actual conditions in embodiment, according to ordinary method, carry out, as the people's such as Sambrook method, molecular cloning is by (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in laboratory manual, or the condition of advising according to manufacturer.

The acquisition of embodiment 1nifAM gene

Extract the genome of pseudomonas stanieri A1501.The genome being extracted of take is template, carries out pcr amplification.The primer using is synthetic according to 5 ' and 3 ' terminal sequence of nifA gene, and 2 primer sequences are respectively:

5 ' CCGAAGCTTTCAGATCTTGCGCATATGA3 ' and

5’CCGAAGCTTACGGTGCATATCGATAGC3’，

By PCR method, obtain complete nifA gene, and the one section of nucleotide sequence that comprises the nifA gene coding region about 70bp in upstream, length is the object fragment of 1.6kb.Take nifA gene as template, use Labest fallibility PCR sudden change test kit, sudden change nifA gene.Obtain the rear gene (Fig. 1) of sudden change, name nifAM.

Embodiment 2 use nifAM build genetic engineering bacterium 1561/pVKAM and checking

With Hind III enzyme, cut and reclaim nifAM fragment, the shuttle vectors pVK100 cutting with same enzyme is connected.Tc ^skm ^rresistance screening, extracts plasmid, and Hind III and EcoR I enzyme are cut evaluation, and Fig. 2 is shown in by recombinant plasmid pVKAM collection of illustrative plates.

By donor bacterium pVKAM, recipient bacterium 1561, helps bacterium pRK2013 to mix according to the ratio of 1:1:1, by the method for three close combinations, recombinant plasmid pVKAM is proceeded in 1561, then carries out kantlex (Km), tsiklomitsin (Tc) resistance screening respectively.Choose at random 3 three close zygotes, extract plasmid checking pVKAM and whether proceed in 1561.Recipient bacterium 1561 is the mutant strain obtaining early stage, has lacked amtB gene.

Extract after plasmid, take plasmid DNA as template, carry out PCR checking, obtain the fragment of 1.6kb, to extract 1561 the negative contrast of empty plasmid; Plasmid is cut to checking by EcoR I and Hind III enzyme simultaneously, cut out respectively two bands, thereby obtained the engineering bacteria of restructuring, called after 1561/pVKAM.

Embodiment 3nif AM secretes ammonium effect comparison

1, experiment purpose

By quantitative comparison, proceed to the ammonium effect of secreting of transformation bacterial strain with set out bacterium A1561, the 1561/pVA3 of nif AM gene, the function of checking nif AM gene;

2, experimental subjects

Experimental strain: proceed to that the engineering bacteria 1561/pVKAM(embodiment 2 of nif AM gene obtains);

2 kinds of control strains: the bacterium A1561 that sets out, proceed to the engineering bacteria A1561/pVA3 of nif A gene.

3, experimental technique

3.1NH ₄ ⁺the mensuration of concentration is according to indophenol blue colorimetry (Bender et al.1977), and concrete operations are as follows:

1) preparation A solution, B solution

A solution (100ml): 5g phenol; 0.025g Na-nitroprusside (Na ₂fe[CN] ₅nO2H ₂o);

B solution (100ml): 62.5ml1M NaOH; 3.3ml NaOCl (available chlorine 5.25%).

2) draw NH4+ concentration standard curve

Preparation NH ₄ ⁺the serial dilutions (NH of serial dilution 1M ₄ ⁺be 0.1,0.2,0.4,0.6,0.8,1.0,1.5,2.0mM; Add after A, B solution reaction 20min, at OD ₆₂₅colorimetric)

3) get respectively the microbial culture supernatant liquors of 100 μ l experimental bacteria and two kinds contrast bacterium, add again 100 μ l B solution after adding 100 μ l A solution, observing response liquid color after 20min, by with NH ₄ ⁺the shade of concentration standard curve is compared, and judges whether to have NH ₄ ⁺and concentration.

4) experimental bacteria 1561/pVKAM and two kinds of contrast bacterium are inoculated in respectively semi-solid without the restricted substratum of nitrogen (1000ml, KH ₂pO ₄0.4g, K ₂hPO40.1g, NaCl0.1g, MgSO ₄.7H ₂o0.2g, MnSO4.H ₂o0.01g, Fe ₂(S0 ₄) ₃.H2O0.01g, Na ₂moO ₄.H ₂o0.01g, C ₃h ₅naO ₃6ml, adds 0.1%-0.2% agar, pH6.8) in, be full of N ₂, 0.5%O ₂, under 30 ℃ of conditions, to cultivate after 15 days, the nitrogenase that adopts Acetylene Reduction method to measure respectively two kinds of bacterium is lived, and by the ammonia-nitrogen ammonium amount of secreting and pH values in test experience bacterial strain and two kinds of contrast bacterium culture mediums respectively.

More than experiment all repeats more than 3 times.

3.2 nitrogenase activities are measured, and adopt Acetylene Reduction method to measure, and concrete operations are as follows:

Use SP-2305 type gas chromatograph for determination.Each bacterial strain to be measured is activated simultaneously, keep growth conditions consistent; Each bacterial strain access after activation is contained to corresponding antibiotic liquid A 15 substratum, 30 ℃ of shaking culture 20h.Measure the OD600 value of each bacterial strain.From each test tube, take out appropriate bacterium liquid, 4,000g, 4 ℃ of centrifugal 10min, collect thalline.

With physiological saline washing thalline twice, be fully suspended in without in nitrogen A15 liquid nutrient medium, make OD600=1.0; Each little triangular flask adds 9ml without nitrogen A15 liquid nutrient medium, access 1ml bacterium liquid, and making bacterium liquid final concentration is OD600=0.1; Each little triangular form bottle stopper is entered to plug, inject pure argon, simultaneously exhausted air.Then inject the oxygen of 0.5% volume and the acetylene of 10% volume new system, 30 ℃ of thermal agitations are cultivated, and coerce 4h.Every 1h, from each, little serum bottle, with microsyringe, take out 0.25ml gas gas chromatography determination ethylene content, according to the height at each sample ethene peak, carry out its nitrogenase activity height of comparison.More than experiment all repeats more than 3 times.

The area at ethene peak on nitrogenase work=registering instrument * (test tube gaseous phase volume/sample size)/(area * reaction times at 1nmol standard ethene peak)

4, experimental result

1) nitrogenase is lived

Under fixed nitrogen condition, the nitrogenase that contains the transformation bacterium 1561/pVKAM of nif AM gene is lived as 19.06U/mg, the nitrogenase 14.24U/mg alive of contrast bacterium 1561/pVA3, the nitrogenase of contrast bacterium A1561 is lived as 7.41U/mg, and 1561/pVKAM is 2.57 times that A1561 nitrogenase is lived.

2) medium pH

Cultivate after 20 days, find that contrast bacterium A1561 substratum is not aobvious blue, do not secrete ammonium, ammonium concentration is 0, pH value 7.10; And the substratum of 1561/pVKAM is aobvious blue, and secretes ammonium amount and reach 6.96mM, its substratum is weakly alkaline (pH value=7.48); The substratum of 1561/pVA3 is aobvious blue, and secretes ammonium amount and reach 5.15mM, and its substratum is weakly alkaline (pH value=7.42).Result of study shows that 1561/pVKAM has stronger nitrogen fixation activity compared with 1561/pVA3, and can be to the more ammonium of cell exocrine.

Result is as shown in Fig. 3, table 1.

Three kinds of bacterium of table 1 secrete ammonium effect comparison

Above result of study shows: the nitrogen fixation activity of 1561/pVKAM and to the ability of cell exocrine ammonium higher than A1561, also higher than 1561/pVA3, and have significant difference.

5, experiment conclusion

The sudden change nitrogenase positive regulator gene nif AM gene that the present invention obtains has stronger nitrogen fixation activity and efficiently secretes ammonium effect, and the ammonium effect of secreting of engineering strain 1561/pVKAM therefrom is higher than proceeding to the not 1561/pVA3 bacterial strain of the nif A gene of sudden change in 1561 bacterial strains.

Claims (10)

1. can strengthen the gene that vinelandii secrete ammonium ability, its nucleotide sequence is as shown in SEQ ID NO:1.

2. containing the recombinant plasmid of gene described in claim 1.

3. plasmid claimed in claim 2 has the application in fixed nitrogen function bacterial manure in production.

4. containing the carrier of gene described in claim 1.

5. the host cell transforming with carrier claimed in claim 4.

6. containing the recombinant strain of gene described in claim 1.

7. bacterial strain claimed in claim 6, is gene described in claim 1 to be proceeded to pseudomonas stanieri A1561 bacterium obtain.

8. described in claim 6 or 7, bacterial strain has the application in fixed nitrogen function bacterial manure in production.

9. the albumen of genes encoding described in claim 1, has the aminoacid sequence shown in SEQ ID NO:2.

10. described in claim 9, albumen has the application in fixed nitrogen function bacterial manure in production.

Images