CN103451289B - Kit for detecting BRAF (v-raf mourine sarcoma viral oncogene homolog B1) gene mutation - Google Patents

Abstract

The invention discloses a primer, a kit and a method for detecting BRAF (v-raf mourine sarcoma viral oncogene homolog B1) gene mutation. The primer for detecting the BRAF gene mutation comprises a forward amplification primer with a base sequence represented by SEQ ID NO:1, a backward amplification primer with a base sequence represented by SEQ ID NO:2 and a sequencing primer with a base sequence represented by SEQ ID NO:3, wherein the 5' tail end of the forward amplification primer and/or the backward amplification primer is provided with a biotin label. The method and the kit for detecting the BRAF gene mutation have the advantages of simplicity and rapidness for operation, high flux, low detection cost and the like, especially have good specificity, high sensitivity and high accuracy and have wide application prospect.

Description

A kind of test kit detecting BRAF gene mutation

Technical field

The present invention relates to the method detecting BRAF gene mutation, particularly relate to a kind of method and the test kit thereof that utilize pyrosequencing techniques detection BRAF gene mutation.

Background technology

Murine Sarcoma viral carcinogenic autoploid B1(v-raf mourine sarcoma viral oncogene homolog B1, BRAF), belong to RAF family member, be positioned at karyomit(e) 7q34, size is 190kb, containing seven transcriptional domains, comprise 18 exons, the serine/threonine protein kitase of a coding 67KD-99KD, signal is transduceed to MEK1/2 from RAS by this enzyme, thus the increment of participation cell, differentiation and apoptosis (Ikenoue T, CancerRes, 2003,63 (23): 8132-37).Research shows, mainly there are two kinds of sudden changes in BRAF, its sudden change of 89% betides the active region on exons 15, wherein the sudden change of about 92% is positioned at the 1799th Nucleotide (T sports A), the α-amino-isovaleric acid in 600 residues of its protein product is caused to be replaced (V600E) (WangL, et al, CancerRes by L-glutamic acid, 2003,63 (17): 5209-12); The sudden change of other 11% is positioned at the glycine ring (as point mutation such as G463, G465, G468) on exons 11.

V600E sudden change can simulate the Phosphorylation events in T598 and S601 two sites, thus sustained activation BRAF albumen, cause the activation of MEK/ERK after BRAF protein activation, it affects tumour progression by the mode of transcript or non-transcribed thing.Have been found that at present, the sudden change of BRAF gene is all there is in multiple human malignancies, as (Davies H such as thyroid papillary carcinoma, malignant melanoma, colorectal cancer, ovarian cancer, lung cancer, liver cancer, carcinoma of the pancreas, et al, Nature, 2002,417 (6892): 949-54).Therefore, in time detect BRAF gene mutation situation, will important directive significance be had to early screening tumour patient and to the individualized treatment of tumour patient, prognosis.

The BRAF gene mutation detection method generally applied at present mainly comprises: RFLP technology, Sanger sequencing technologies, TaqMan probe technology and pyrosequencing techniques.The principle of RFLP technology (restriction fragment length polymorphism analysis technology) is the appearance that the variation of base can cause the disappearance of existing restriction enzyme site or new restriction enzyme site, thus cause Different Individual when with same digestion with restriction enzyme, there is difference in DNA fragmentation length.But its experiment complex operation, sense cycle is long, with high costs, there is first round enzyme and cuts the false positive not exclusively caused, and is easy to pollute, and is difficult to the requirement meeting clinical detection.

The principle of Sanger sequencing technologies is using single stranded DNA as template, utilize archaeal dna polymerase synthetic DNA complementary strand exactly, this enzyme can with 2 ', 3 '-dideoxyribonucleoside triphosphate is made substrate and is aggregated to 3 ' end of newborn oligonucleotide chain, thus stop its extension, containing template, primer, dATP, dTTP, dGTP, in dCTP and a kind of ddNTP reaction tubes, it take ddNTP as the new chain of the different lengths of 3 ' end that archaeal dna polymerase synthesizes a series of, after electrophoresis and radioautograph, promptly can read DNA sequence dna, but the method cycle is longer, both expensive, flux is not high, crossed contamination may be there is, and sensitivity only has 20%-25%.

TaqMan probe technology is a kind of comparatively conventional BRAF gene mutation detection method, and the Chinese invention patent being CN102161990A, CN102220422A, CN102242207A, CN102816851A as publication number all adopts this technology to detect the sudden change of BRAF gene.This method is in Standard PCR reaction system, add a fluorescence labeling probe, 5 ' end and the 3 ' end of this probe mark a reporter fluorescence group and a quenching fluorescence group respectively, when probe is complete, the fluorescent signal that reporter group is launched is quenched group absorptions; When carrying out pcr amplification, if probe can annealing complete with template, then probe enzyme is cut degraded by the 5'-3' 5 prime excision enzyme activity of Taq enzyme, reporter fluorescence group is separated with quenching fluorescence group, thus fluorescence monitoring system can receive fluorescent signal.

Pyrosequencing techniques is by the enzyme cascade chemiluminescence reaction in four kinds of enzymatic same reaction systems, it first makes sequencing primer be combined with single stranded PCR products template, then add enzyme mixture and (comprise four kinds of enzymes, archaeal dna polymerase, ATP sulfurylase, luciferase and apyrase) and substrate mixture (comprising adenosine-5'-phosphosulfate (APS) and fluorescein), add dNTPs(again and only add a kind of dNTP at every turn, comprise dATP, dTTP, dCTP or dGTP), if this dNTP can just with template base pairing, then it can under the effect of archaeal dna polymerase, add 3 ' end of sequencing primer to, discharge the tetra-sodium (PPi) of equimolecular quantity simultaneously, under the effect of ATP sulfurylase, the PPi generated can combine with APS and form ATP, under the catalysis of luciferase, the ATP generated can combine with fluorescein again and form oxyluciferin, produce visible ray simultaneously, a special detected peaks can be obtained by ccd video camera, the height of peak value is directly proportional to the nucleotide base number of synthesis, the ATP of unconjugated dNTPs and generation in reaction system degrades under the effect of bisphosphatase, when degraded completes, another kind of dNTP just can be added in reaction system, along with program continue carry out, synthesize complementary DNA chain and can DNA nucleotide sequence be determined according to the peak value figure obtained.

As the publication number Chinese invention patent that is CN102925555A disclose a kind of adopt the sequencing primer of pyrosequencing techniques qualitative detection mankind BRAFV600E transgenation to and test kit, described test kit comprises uracil dna glycosylase, Taq polysaccharase, PCR reaction solution, pcr amplification primer, Pyrosequencing primer and positive reference substance, but the detection sensitivity of this test kit and limited specificity.

Summary of the invention

Primary and foremost purpose of the present invention be for above-mentioned prior art Problems existing provide a kind of highly sensitive, specificity good, accuracy is high for detecting the primer of BRAF gene mutation, test kit and method, the inventive method is simple to operate fast, testing cost is low, has broad application prospects.

In order to achieve the above object, one aspect of the present invention provides a kind of primer for detecting BRAF gene mutation, comprise the forward amplimer of base sequence as shown in SEQ ID NO:1, the reverse amplimer of base sequence as shown in SEQ ID NO:2 and the sequencing primer of base sequence as shown in SEQ ID NO:3.

Wherein, 5 ' end of described forward amplimer and/or oppositely amplimer, with biotin labeling, is preferably 5 ' end of forward amplimer with biotin labeling.

The source of BRAF gene of the present invention is unrestricted in theory, preferred source is tumor tissues, preferably originate as formalin fixes paraffin-embedded tumor tissues or freezing tumor tissues further, described tumour includes but not limited to thyroid papillary carcinoma, malignant melanoma, colorectal cancer, ovarian cancer, lung cancer, liver cancer, carcinoma of the pancreas.BRAF gene mutation of the present invention is specially BRAF gene 1799T>A sudden change.

The present invention provides a kind of test kit for detecting BRAF gene mutation on the other hand, comprise the forward amplimer of base sequence as shown in SEQ ID NO:1, the reverse amplimer of base sequence as shown in SEQ ID NO:2 and the sequencing primer of base sequence as shown in SEQ ID NO:3.

Particularly, test kit of the present invention can further include for the reagent needed for Manganic pyrophosphate complex initiation reaction; Described reagent can comprise enzyme mixture and substrate mixture, and wherein said enzyme mixture comprises archaeal dna polymerase, ATP sulfurylase, luciferase and apyrase, and described substrate mixture comprises adenosine-5'-phosphosulfate and fluorescein.

Especially, test kit of the present invention can further include for the reagent needed for pcr amplification reaction and/or makes double-stranded DNA change reagent needed for single stranded DNA into.

Further aspect of the present invention provides a kind of described test kit detecting the application in BRAF gene mutation.

Further aspect of the present invention provides a kind of method detecting BRAF gene mutation, comprises the steps:

(A) use the forward amplimer of base sequence as shown in SEQ ID NO:1 and the base sequence reverse amplimer amplification BRAF gene as shown in SEQ ID NO:2, obtain amplified production;

(B) described amplified production is carried out the separation and purification of strand, obtain single stranded DNA;

(C) use the sequencing primer of base sequence as shown in SEQ ID NO:3 to as described in single stranded DNA carry out Manganic pyrophosphate complex initiation, judge whether BRAF gene undergos mutation by sequencing result.

Wherein, 5 ' end of forward amplimer described in step (A) and/or reverse amplimer is with biotin labeling; The system of described amplification comprises: final concentration is the forward amplimer of 0.2uM, and final concentration is the reverse amplimer of 0.2uM, and 2 × PyroMark PCR Master Mix 12.5uL, 10 × CoralLoad Concentrate 2.5uL, sample DNA 2uL, adds ddH ₂o complements to cumulative volume 25uL; Wherein said sample DNA is the genomic dna adopting ordinary method to extract from tumor tissues.

Particularly, described in step (A), the condition of amplification is: 95 DEG C of denaturation 15min; 94 DEG C of sex change 30s, 60 DEG C of annealing 30s, 72 DEG C extend 30s, totally 45 circulations; 72 DEG C extend 10min.

Wherein, described step (B) specifically comprises: in binding buffer liquid, described amplified production is contacted for some time with the magnetic bead of Streptavidin bag quilt, amplified production is combined with magnetic bead, more successively the magnetic bead in conjunction with amplified production is washed, sex change, wash-out process, obtain single stranded DNA.

Particularly, described in step (B), binding buffer liquid is 40uL, and amplified production is 40uL, and the magnetic bead of Streptavidin bag quilt is 3uL, and described contact at room temperature carries out 15 seconds; Described washing is that the ethanolic soln magnetic bead in conjunction with amplified production being placed in 70% washs 5 seconds; Described sex change be by washing after magnetic bead be placed in sex change liquid and hatch 5 seconds; Described wash-out be by sex change after magnetic bead be placed in washings and hatch 10 seconds.

Wherein, described step (C) specifically comprises: carry out Manganic pyrophosphate complex initiation after described sequencing primer and single stranded DNA being hatched for some time under certain temperature in annealing buffer, judge whether BRAF gene undergos mutation by sequencing result.Particularly, described certain temperature is 80 DEG C, and described for some time is 2 minutes.

Particularly, base allocation order when carrying out described Manganic pyrophosphate complex initiation is: CGAATAAGATCTCGATGAGTG.

The present invention utilizes pcr amplification and pyrosequencing techniques, BRAF gene 1799T>A sudden change in biological specimen is detected, wherein the present invention devises specificity amplification primer and Pyrosequencing primer, this amplimer can increase BRAF gene nucleic acid fragment specifically from the genomic dna of biological specimen, the Pyrosequencing primer of application the present invention design can make BRAF gene 1799T>A abrupt climatic change more simple and quick, and has higher specificity, sensitivity and accuracy.In addition, method of the present invention and test kit simple to operate, quick, detect flux high, testing cost is low, have broad application prospects.

Accompanying drawing explanation

Fig. 1 is the detected through gel electrophoresis figure of the various plasmid PCR amplified productions in embodiment 1; Wherein: A: wild plasmid; B: mutant plasmids; C: the first mixing plasmid; D: the second mixing plasmid; M:Mark;

Fig. 2 is the Manganic pyrophosphate complex initiation figure of the wild plasmid amplified production in embodiment 1;

Fig. 3 is the Manganic pyrophosphate complex initiation figure of the mutant plasmids amplified production in embodiment 1;

Fig. 4 is the Manganic pyrophosphate complex initiation figure of the first mixing plasmid amplified production in embodiment 1;

Fig. 5 is the Manganic pyrophosphate complex initiation figure of the second mixing plasmid amplified production in embodiment 1;

Fig. 6 is the Manganic pyrophosphate complex initiation figure that in embodiment 2, paraffin-embedded people's tumor tissues sample 1 fixed by formalin;

Fig. 7 is the Manganic pyrophosphate complex initiation figure that in embodiment 2, paraffin-embedded people's tumor tissues sample 2 fixed by formalin;

Fig. 8 is the Manganic pyrophosphate complex initiation figure that in embodiment 2, paraffin-embedded people's tumor tissues sample 3 fixed by formalin;

Fig. 9 is the Manganic pyrophosphate complex initiation figure of the freezing tumor tissues sample 4 of people in embodiment 3;

Figure 10 is the Manganic pyrophosphate complex initiation figure of the freezing tumor tissues sample 5 of people in embodiment 3;

Figure 11 is the Manganic pyrophosphate complex initiation figure of the freezing tumor tissues sample 6 of people in embodiment 3.

Figure 12 is the detected through gel electrophoresis figure of the primer pair 1 ~ 3PCR amplified production in reference examples 1;

Figure 13 is the detected through gel electrophoresis figure of the primer pair 4 ~ 6PCR amplified production in reference examples 1;

Figure 14 is the detected through gel electrophoresis figure of the primer pair 7 ~ 10PCR amplified production in reference examples 1;

Figure 15 is the Manganic pyrophosphate complex initiation figure of primer pair 1 amplified production of employing sequencing primer S1 in reference examples 1.

Embodiment

Further describe the present invention below in conjunction with specific embodiment, advantage and disadvantage of the present invention will be more clear along with description.But these embodiments are only exemplary, do not form any restriction to scope of the present invention.It will be understood by those skilled in the art that and can modify to the details of technical solution of the present invention and form or replace down without departing from the spirit and scope of the present invention, but these amendments and replacement all fall within the scope of protection of the present invention.

Experiment material:

PMD18-T carrier: purchased from TAKARA, article No. D101A;

QIAGEN Plasmid Mini Kit(article No. 12123), PyroMark PCR Kit(article No. 978703), PyroMarkQ96Vaccum Station:: all purchased from QIAGEN;

Binding buffer liquid, sex change liquid, elutriant, annealing buffer: all purchased from QIAGEN, article No. is followed successively by 979006,979007,979008,979009;

The magnetic bead of Streptavidin bag quilt: purchased from GE Healthcare, article No. 17-5113-01;

Adopt test kit-Pyromark GoldQ96Reagents: purchased from QIAGEN company, article No. 972804;

QIAamp DNA FFPE Tissue Kit: purchased from QIAGEN, article No. 56404;

Paraffin-embedded people's tumor tissues sample 1-3 fixed by formalin: from clinical acquisitions sample;

People's freezing tumor tissues sample 4-6: from clinical acquisitions sample.

The investigation of embodiment 1BRAF detection method of gene mutation

1, the structure of wild plasmid and mutant plasmids

The carrier that plasmid construction adopts is pMD18-T carrier, its insertion sequence is the tract in BRAF gene (NCBI Reference Sequence:NG_007873) 171241-171660 site, wherein wild plasmid is containing BRAF gene 1799 site T sequence, and mutant plasmids is containing BRAF gene 1799A sequence; The construction work of plasmid is completed by TaKaRa company;

The wild plasmid built and mutant plasmids are proceeded in intestinal bacteria respectively, after cultivating, preserves corresponding bacterium liquid;

2, the extraction of plasmid

Employing QIAGEN Plasmid Mini Kit extracts wild plasmid and mutant plasmids from containing the bacterium liquid of above-mentioned wild plasmid and mutant plasmids after cultivation respectively, and the specification sheets in concrete operation step reference reagent box carries out.

3, BRAF gene amplification

PyroMark PCR Kit is adopted to exist pCR System 9700(AB) on mix plasmid (mol ratio of wild plasmid and mutant plasmids is for 8:2) and, for template amplification BRAF gene, obtain amplified production with wild plasmid, mutant plasmids, the first mixing plasmid (mol ratio of wild plasmid and mutant plasmids is for 9:1) and second respectively; The forward primer adopted that wherein increases is synthesized by Life-Tech company with reaction primer, and base sequence is as follows:

Forward primer: 5'-AACTCTTCATAATGCTTGCTCTGATAGGAAAATGA-3'(SEQ ID No.1);

Reverse primer: 5'-CAATTCTTACCATCCACAAAATGGATCCAGA-3'(SEQ ID No.2), its 5' holds mark vitamin H;

Amplification system is: final concentration is the forward primer F of 0.2uM, and final concentration is the reverse primer R of 0.2uM, 2 × PyroMark PCR Master Mix12.5uL, and 10 × CoralLoad Concentrate2.5uL, plasmid 2uL, adds ddH ₂o complements to cumulative volume 25uL;

Amplification program is: 95 DEG C of denaturation 15min; 45 circulations (72 DEG C extend 30s for 94 DEG C of sex change 30s, 60 DEG C of annealing 30s); 72 DEG C extend 10min;

Amplified production is carried out detected through gel electrophoresis, and detected result as shown in Figure 1; Fig. 1 result shows: all obtain single object band in four PCR amplification system of wild plasmid, mutant plasmids, the first mixing plasmid and the second mixing plasmid, and specific amplification products nothing but, therefore meet Manganic pyrophosphate complex initiation requirement.

4, the preparation of single stranded DNA

With PyroMark Q96 Vaccum Station, amplified production is carried out to the separation and purification of strand, concrete operations are carried out to specifications, the recommendation consumption of the consumption by specification of all reagent, and concrete steps are:

Get the amplified production 15uL of wild plasmid, mutant plasmids, the first mixing plasmid and the second mixing plasmid respectively, join in 40uL binding buffer solution together with the magnetic bead of 3uL Streptavidin bag quilt, at room temperature hatch 15 seconds, amplified production is combined with the magnetic bead of Streptavidin bag quilt by the vitamin H of mark; With the magnetic bead 5 second of the ethanolic soln of 110mL70% washing in conjunction with amplified production, the magnetic bead after washing is placed in 90mL sex change liquid and hatches 5 seconds, then be placed in 110mL elutriant and hatch 10 seconds, obtain single stranded DNA.

5, Manganic pyrophosphate complex initiation

Described single stranded DNA is proceeded to 40uL to be contained in the annealing buffer of sequencing primer, hatches 2 minutes at 80 DEG C, is cooled to room temperature and obtains strand sequencing template; The concentration of wherein said sequencing primer in annealing buffer is 0.4uM, and sequencing primer is synthesized by Life-Tech company, and base sequence is as follows:

Sequencing primer: 5'-GTAAAAATAGGTGATTTTGGTCTAGCTACA-3'(SEQ ID No.3)

Open PYROMARK ID software, click Simple Entries, the primer catalogue of this experiment of preserving in primer-design software is introduced, program can generate the tetra-sodium sequence chart (Pyrogram) of a Dispensation Order and expection automatically, determines that base allocation order is CGAATAAGATCTCGATGAGTG;

Sequencing reaction is at PYROMARK Q96 ID(QIAGEN) adopt test kit-Pyromark Gold Q96 Reagents to carry out under the AQ pattern of instrument; The enzyme mixture, substrate mixture and the dNTPs that are reacted by Manganic pyrophosphate complex initiation used add reagent cabin, and above-mentioned strand sequencing template is put into Manganic pyrophosphate complex initiation instrument, Manganic pyrophosphate complex initiation reaction is carried out according to the above-mentioned base allocation order determined, primer strand extended along with different adding of dNTPs, with the carrying out of enzymatic reaction, ccd video camera detects the fluorescent signal sent, and Manganic pyrophosphate complex initiation collection of illustrative plates is shown in Fig. 2-5 respectively; Instrument shows according to peak figure result of determination: BRAF gene 1799 loci gene type of wild plasmid is T(100%, Fig. 2); BRAF gene 1799 loci gene type of mutant plasmids is A(100%, Fig. 3); BRAF gene 1799 loci gene type of the first mixing plasmid is 11%A(Fig. 4); BRAF gene 1799 loci gene type of the second mixing plasmid is 20%A(Fig. 5), each plasmid is consistent with its expection sequencing result, illustrates that method of the present invention is highly sensitive, specificity good, accuracy is good.

The detection of paraffin-embedded people's tumor tissues sample fixed by embodiment 2 formalin

Adopt QIAamp DNA FFPE Tissue Kit to fix paraffin-embedded people's tumor tissues sample 1-3 to formalin respectively and carry out extracting genome DNA, concrete operation step reference reagent box specification sheets, obtains DNA extraction liquid 1-3;

Carry out BRAF gene amplification (namely replacing the plasmid in amplification system with DNA extraction liquid), the preparation of single stranded DNA and Manganic pyrophosphate complex initiation reaction to described DNA extraction liquid 1-3 respectively according to the method described in embodiment 1, sequencing result as shown in figs 6-8; Instrument shows according to peak figure result of determination: BRAF gene 1799 site of sample 1 is pure and mild wild-type (100%T base); BRAF gene 1799 site of sample 2 is heterozygous mutant (13%A base); BRAF gene 1799 site of sample 3 is heterozygous mutant (42%A base).

The detection of the freezing tumor tissues sample of embodiment 3 people

With QIAamp DNA FFPE Tissue Kit to the extracting genome DNA of people's freezing tumor tissues sample 4-6, concrete operations reference reagent box specification sheets, obtains DNA extraction liquid 4-6;

Carry out BRAF gene amplification, the preparation of single stranded DNA and Manganic pyrophosphate complex initiation reaction to described DNA extraction liquid 4-6 respectively according to the method described in embodiment 1, sequencing result as shown in figs. 9-11; Instrument shows according to peak figure result of determination: BRAF gene 1799 site of sample 4 is pure and mild wild-type (100%T base); BRAF gene 1799 site of sample 5 is heterozygous mutant (21%A base); BRAF gene 1799 site of sample 6 is heterozygous mutant (85%A base).

The comparison of reference examples 110 kinds contrast primer amplification performance

One, the preliminary screening of amplimer

10 kinds of primers for BRAF gene amplification, synthesized by Life-Tech company, its base sequence is as follows:

Primer pair 1: i.e. primer used in the present invention

Forward primer: 5'-AACTCTTCATAATGCTTGCTCTGATAGGAAAATGA-3'(SEQ ID No.1);

Reverse primer: 5'-CAATTCTTACCATCCACAAAATGGATCCAGA-3'(SEQ ID No.2);

Primer pair 2:

Forward primer: 5'-TAGGTGATTTTGGTCTAGCTACAG-3'(SEQ ID No.5);

Reverse primer: 5'-CTAGTAACTCAGCAGATTCTCAGG-3'(SEQ ID No.6);

Primer pair 3:

Forward primer: 5'-TCATGAAGACCTCACAGTAAAAA-3'(SEQ ID No.7);

Reverse primer: 5'-TTCAAACTGATGGGACCCACT-3'(SEQ ID No.8);

Primer pair 4:

Forward primer: 5'-TACCTAAACTCTTCATAATGCTTGCTCTGA-3'(SEQ ID No.9);

Reverse primer: 5'-TACCATCCACAAAATGGATCCAGACAACTG-3'(SEQ ID No.10);

Primer pair 5:

Forward primer: 5'-TATAGAAATTAGATCTCTTA-3'(SEQ ID No.11);

Reverse primer: 5'-TGGATCCAGACAACTGTTCAAAC-3'(SEQ ID No.12);

Primer pair 6:

Forward primer: 5'-ACTTACTACACCTCAGATA-3'(SEQ ID No.13);

Reverse primer: 5'-TAACTCAGCAGCATCTCAG-3'(SEQ ID No.14);

Primer pair 7:

Forward primer: 5'-AGAAATTAGATCTCTTACCTA-3'(SEQ ID No.15);

Reverse primer: 5'-TCCAGACAACTGTTCAAACT-3'(SEQ ID No.16);

Primer pair 8:

Forward primer: 5'-ATGAGATCTACTGTTTTC-3'(SEQ ID No.17);

Reverse primer: 5'-TCCACAAAATGGATCCAGACA-3'(SEQ ID No.18);

Primer pair 9:

Forward primer: 5'-CATAATGCTTGCTCTGATA-3'(SEQ ID No.19);

Reverse primer: 5'-TCAAACTGATGGGACCCACTC-3'(SEQ ID No.20);

Primer pair 10:

Forward primer: 5'-ATTTCTTCATGAAGACCTCA-3'(SEQ ID No.19);

Reverse primer: 5'-TGGATCCAGACAACTGTTCA-3'(SEQ ID No.20);

Use gDNA(human gene group DNA, from clinical sample) above-mentioned primer pair (1-10) is screened.

Amplification system is: final concentration is the forward primer F of 0.2uM, and final concentration is the reverse primer R of 0.2uM, 2 × PyroMark PCR Master Mix 12.5uL, and 10 × CoralLoad Concentrate 2.5uL, gDNA adds 1uL, adds ddH ₂o complements to cumulative volume 25uL;

Amplification program is: 95 DEG C of denaturation 15min; 45 circulations (72 DEG C extend 30s for 94 DEG C of sex change 30s, 60 DEG C of annealing 30s); 72 DEG C extend 10min;

Amplified production is carried out detected through gel electrophoresis, and detected result is as shown in Figure 12, Figure 13, Figure 14 and table 1, table 2, table 3, and primers F 1/R1, F2/R2 can obtain the single band of BRAF gene clearly, and amplification is better.

Table 1

?	Sample ID	Primer pair	Amplification
				1	gDNA1	F1/R1	Have
2	gDNA1	F2/R2	Have
				3	gDNA1	F3/R3	Weak
4	gDNA2	F1/R1	Have
				5	gDNA2	F2/R2	Have
6	gDNA2	F3/R3	Nothing
				7	gDNA3	F1/R1	Have
8	gDNA3	F2/R2	Have
				9	gDNA3	F3/R3	Weak

Table 2

?	Sample ID	Primer pair	Amplification
				1	gDNA1	F4/R4	Nothing
2	gDNA2	F4/R4	Nothing
				3	gDNA3	F4/R4	Nothing
4	gDNA1	F5/R5	Nothing
				5	gDNA2	F5/R5	Nothing
6	gDNA3	F5/R5	Nothing
				7	gDNA1	F6/R6	Weak
8	gDNA2	F6/R6	Weak
				9	gDNA3	F6/R6	Weak

Table 3

?	Sample ID	Primer pair	Amplification
				1	gDNA1	F7/R7	Nothing

[0123]?

2	gDNA2	F7/R7	Nothing
				3	gDNA3	F7/R7	Nothing
4	gDNA1	F8/R8	Nothing
				5	gDNA2	F8/R8	Nothing
6	gDNA3	F8/R8	Nothing
				7	gDNA1	F9/R9	Non-specific
8	gDNA2	F9/R9	Non-specific
				9	gDNA3	F9/R9	Non-specific
10	gDNA1	F10/R10	Non-specific
				11	gDNA2	F10/R10	Non-specific
12	gDNA3	F10/R10	Non-specific

Two, the Manganic pyrophosphate complex initiation of the amplified production of primer pair 1 and primer pair 2

According to the result of the preliminary screening of amplimer, the sequence according to primer pair 1, primer pair 2 carries out primer synthesis again, and carries out biotin labeling, and synthesized by Life-Tech company, its base sequence is as follows,

Primer pair 1-1:

Forward primer: 5'-AACTCTTCATAATGCTTGCTCTGATAGGAAAATGA-3'(SEQ ID No.1);

Reverse primer: 5'-CAATTCTTACCATCCACAAAATGGATCCAGA-3'(SEQ ID No.2), its 5' holds mark vitamin H;

Primer pair 1-2:

Forward primer: 5'-AACTCTTCATAATGCTTGCTCTGATAGGAAAATGA-3'(SEQ ID No.1), its 5' holds mark vitamin H;

Reverse primer: 5'-CAATTCTTACCATCCACAAAATGGATCCAGA-3'(SEQ ID No.2);

Primer pair 2-1:

Forward primer: 5'-TAGGTGATTTTGGTCTAGCTACAG-3'(SEQ ID No.5), its 5' holds mark vitamin H;

Reverse primer: 5'-CTAGTAACTCAGCAGATTCTCAGG-3'(SEQ ID No.6);

Primer pair 2-2:

Forward primer: 5'-TAGGTGATTTTGGTCTAGCTACAG-3'(SEQ ID No.5);

Reverse primer: 5'-CTAGTAACTCAGCAGATTCTCAGG-3'(SEQ ID No.6), its 5' holds mark vitamin H;

Above-mentioned four kinds of primer pairs and 10 kinds of sequencing primers are arranged in pairs or groups, carries out Manganic pyrophosphate complex initiation.Wherein, 10 kinds of sequencing primers, are synthesized by Life-Tech company, and its base sequence is as follows:

Sequencing primer 1: i.e. sequencing primer used in the present invention

5'-GTAAAAATAGGTGATTTTGGTCTAGCTACA-3'（SEQ?ID?No.3）；

Sequencing primer 2:

5'-GGTGATTTTGGTCTAGC-3'（SEQ?ID?No.23）；

Sequencing primer 3:

5'-GGTGATTTTGGTCTAGCT-3'（SEQ?ID?No.24）；

Sequencing primer 4:

5'-AGGTGATTTTGGTCTAGCTACA-3'（SEQ?ID?No.25）；

Sequencing primer 5:

5'-GATTTTGGTCTAGCTACAG-3'（SEQ?ID?No.26）；

Sequencing primer 6:

5'-ATGGGACCCACTCCATCGAGA-3'（SEQ?ID?No.27）；

Sequencing primer 7:

5'-ACTGATGGGACCCACTCCATCGAGATT-3'（SEQ?ID?No.28）；

Sequencing primer 8:

5'-ACCCACTCCATCGAGATTTC-3'（SEQ?ID?No.29）；

Sequencing primer 9:

5'-GATGGGACCCACTCCATCGA-3'（SEQ?ID?No.30）；

Sequencing primer 10:

5'-ACCCACTCCATCGAGATTT-3'（SEQ?ID?No.31）；

According to the method in embodiment 1, carry out Manganic pyrophosphate complex initiation, detected result shows, only have sequencing primer used in the present invention to be effective for the abrupt climatic change in BRAF1799 site, detected result as shown in figure 15.

Table 4

Claims (6)

1. one kind for detecting the test kit of BRAF gene mutation, it is characterized in that, comprise the forward amplimer of base sequence as shown in SEQ ID NO:1, the reverse amplimer of base sequence as shown in SEQ ID NO:2 and the sequencing primer of base sequence as shown in SEQ ID NO:3, wherein

Described forward amplimer and reverse amplimer, for the BRAF gene that increases, obtain amplified production;

Described sequencing primer is used for carrying out Manganic pyrophosphate complex initiation to the single stranded DNA that described amplified production separation and purification obtains;

Base allocation order when carrying out described Manganic pyrophosphate complex initiation is: CGAATAAGATCTCGATGAGTG.

2. test kit as claimed in claim 1, is characterized in that, 5 ' end of described forward amplimer and/or oppositely amplimer is with biotin labeling.

3. test kit as claimed in claim 1 or 2, it is characterized in that, described BRAF gene derives from formalin and fixes paraffin-embedded tumor tissues or freezing tumor tissues, and described BRAF gene mutation is BRAF gene 1799T>A sudden change.

4. test kit as claimed in claim 1, it is characterized in that, the condition of described amplification is: 95 DEG C of denaturation 15min; 94 DEG C of sex change 30s, 60 DEG C of annealing 30s, 72 DEG C extend 30s, totally 45 circulations; 72 DEG C extend 10min.

5. test kit as claimed in claim 1, it is characterized in that, described separation and purification specifically comprises: in binding buffer liquid, described amplified production is contacted for some time with the magnetic bead of Streptavidin bag quilt, amplified production is combined with magnetic bead, again the magnetic bead in conjunction with amplified production is washed successively, sex change, wash-out process, obtain single stranded DNA.

6. test kit as claimed in claim 1, it is characterized in that, described Manganic pyrophosphate complex initiation specifically comprises: carry out Manganic pyrophosphate complex initiation after described sequencing primer and single stranded DNA being hatched for some time under certain temperature in annealing buffer, judge whether BRAF gene undergos mutation by sequencing result.