CN103451284B

CN103451284B - Group of novel molecular markers of one group of human myocardial cells, and applications of novel molecular markers

Info

Publication number: CN103451284B
Application number: CN201310370253.3A
Authority: CN
Inventors: 刘光慧; 顾颖; 胡安·卡洛斯·伊斯毕华·贝尔蒙特; 曲静; 杨济平; 张维琦; 任若通
Original assignee: Institute of Biophysics of CAS
Current assignee: Institute of Biophysics of CAS
Priority date: 2013-08-22
Filing date: 2013-08-22
Publication date: 2015-03-18
Anticipated expiration: 2033-08-22
Also published as: CN103451284A

Abstract

The invention discloses a group of novel molecular markers of human myocardial cells, and applications of the novel molecular markers. The group of markers comprises the following 29 genes: POPDC2, ALPK2, TRIM55, ASPH, FILIP1, HSPB7, NPPA, KBTBD10, MYL4, CRYAB, LRRN4, MYOZ2, OBSCN, SMPX, NRK, ABLIM1, SYNPO2L, ANKRD1, TNNI1, MYH6, ABRA, TPM1, C15orf52, MYOM1, MASP1, MYBPC3, TNS1, FLNC and F2RL2. The markers play an important role in screening and identifying the myocardial cells, and have potential effect and huge significance on the early development research of human hearts, the construction of heart disease models, treatment of heart diseases, and the development of heart disease medicament targets or in research and development of medicaments.

Description

The New molecular marker thing of lineup's class myocardial cell and application thereof

Technical field

The present invention relates to New molecular marker thing and the application thereof of lineup's class myocardial cell.

Background technology

Heart trouble is the killer threatening human health, having up to ten million people to lose one's life because suffering from all kinds of heart disease every year, bringing great pressure and burden to family and public health service.No matter in developed country or developing country, cardiopathic sickness rate and case fatality rate are all high, but in the face of acid test like this, the treatment of current heart disease but allows of no optimist, pharmacological agent rests on the stage of relief of symptoms, operative treatment is paid wages comparatively large as bypass surgery etc. and be there is certain risk and possible side effect, and interventional therapy is also still in the exploratory stage, rarely has the methods for the treatment of for the treatment of both principal and secondary aspect of disease to come out.Trace it to its cause, very large one side is the deficiency that the mankind are familiar with heart and heart disease.It is the disappearance of myocardial cell or the disorder of function that the cause of disease of heart disease is traced to its source.Thus a thinking of following radical cure heart disease is the molecular basis of the pathogenesis done some research on heart diseases, find the decisive factor affecting cardiac fibrosis or cardiomyocyte proliferation, realize that artificial adjustment is carried out to the myocardial cell of disorder and make its object recovering normal function (1).

In recent years, along with induction type multipotential stem cell (induced Pluripotency Stem Cells, iPSCs) generation of technology, people can obtain iPSCs in vitro and be divided into the special myocardial cell of patient, corrected by gene or other means obtain " health " patient source myocardial cell (1); Utilize the cell type that transdifferentiation (transdifferentiation) technology can be convenient to obtain by other without iPSCs process directly to obtain myocardial cell (2), the cellular transplantation therapy realized in patient body in the future that develops into of these technology provides possibility.

1.Mordwinkin NM,Burridge PW,Wu JC.2013.A review of human pluripotentstem cell-derived cardiomyocytes for high-throughput drug discovery,cardiotoxicity screening,and publication standards.Journal ofcardiovascular translational research6:22-30.

2.Wada R,Muraoka N,Inagawa K,Yamakawa H,Miyamoto K,Sadahiro T,UmeiT,Kaneda R,Suzuki T,Kamiya K,Tohyama S,Yuasa S,Kokaji K,Aeba R,YozuR,Yamagishi H,Kitamura T,Fukuda K,Ieda M.2013.Induction of humancardiomyocyte-like cells from fibroblasts by defined factors.Proceedings ofthe National Academy of Sciences110：12667-12672.

Summary of the invention

The object of this invention is to provide New molecular marker thing and the application thereof of lineup's class myocardial cell.

Provided by the invention one group for the identification of or the marker of assistant identification human myocardium cell, by following 29 kinds of genomic constitutions: POPDC2, ALPK2, TRIM55, ASPH, FILIP1, HSPB7, NPPA, KBTBD10, MYL4, CRYAB, LRRN4, MYOZ2, OBSCN, SMPX, NRK, ABLIM1, SYNPO2L, ANKRD1, TNNI1, MYH6, ABRA, TPM1, C15orf52, MYOM1, MASP1, MYBPC3, TNS1, FLNC, F2RL2.

Described 29 kinds of genes meet following condition: compared with human embryos multipotential stem cell and/or human nerve stem cell, and in human myocardium's cell, CpG island, the promoter region methylation level of these 29 kinds of genes all significantly reduces and the mrna expression amount of these 29 kinds of genes is significantly increased in human myocardium's cell.

In above-mentioned marker, CpG island, the promoter region methylation level of these 29 kinds of genes described all significantly reduces all methylated than the CpG island, promoter region of homologous genes in human embryos multipotential stem cell and/or the human nerve stem cell amount reduction by more than 5% of the methylated amount in CpG island, promoter region referring to often kind of gene in human myocardium's cell.

The mrna expression amount of these 29 kinds of genes described is significantly increased and refers to that the mrna expression amount of often kind of gene in human myocardium's cell is all more than 2 times of homologous genes mrna expression amount in human embryos multipotential stem cell and/or human nerve stem cell.

The application of above-mentioned arbitrary described marker in identifier myocardial cell also belongs to protection scope of the present invention.

In above-mentioned application, described in be applied as non-diseases treatment or diagnostic method.

Above-mentioned arbitrary described marker also belongs to protection scope of the present invention in preparation, exploitation or the application designed in the product of identifier myocardial cell.

Above-mentioned arbitrary described marker also belongs to protection scope of the present invention in the application identified in Human Cardiomyocytes from Human Cardiomyocytes, Human embryo multipotential stem cell and human nerve stem cell.

Above-mentioned arbitrary described marker also belongs to protection scope of the present invention in the application identified in Human Cardiomyocytes from Human Cardiomyocytes and Human embryo multipotential stem cell.

Above-mentioned arbitrary described marker also belongs to protection scope of the present invention in preparation, exploitation or the design application had in the product of following function: from Human Cardiomyocytes, Human embryo multipotential stem cell and human nerve stem cell, identify Human Cardiomyocytes.

Above-mentioned arbitrary described marker also belongs to protection scope of the present invention in preparation, exploitation or the design application had in the product of following function: from Human Cardiomyocytes and Human embryo multipotential stem cell, identify Human Cardiomyocytes.

In above-mentioned arbitrary described application, described Human Cardiomyocytes is by described Human embryo pluripotent stem cell differentiation; Described human nerve stem cell is by described Human embryo pluripotent stem cell differentiation.

The application of material in the test kit of characterization human myocardium cell detecting the material of CpG island, the promoter region methylation level of 29 kinds of genes and the mrna expression amount of detection 29 kinds of genes also belongs to protection scope of the present invention.

Described 29 kinds of genes are POPDC2, ALPK2, TRIM55, ASPH, FILIP1, HSPB7, NPPA, KBTBD10, MYL4, CRYAB, LRRN4, MYOZ2, OBSCN, SMPX, NRK, ABLIM1, SYNPO2L, ANKRD1, TNNI1, MYH6, ABRA, TPM1, C15orf52, MYOM1, MASP1, MYBPC3, TNS1, FLNC, F2RL2.

The material of the material detecting CpG island, the promoter region methylation level of 29 kinds of genes and the mrna expression amount detecting 29 kinds of genes also belongs to protection scope of the present invention in the preparation application had in the test kit of following function: from Human Cardiomyocytes, Human embryo multipotential stem cell and human nerve stem cell, identify Human Cardiomyocytes.

The material of the material detecting CpG island, the promoter region methylation level of 29 kinds of genes and the mrna expression amount detecting 29 kinds of genes also belongs to protection scope of the present invention in the preparation application had in the test kit of following function: from Human Cardiomyocytes and Human embryo multipotential stem cell, identify Human Cardiomyocytes.

In above-mentioned arbitrary described application, in the described Human Cardiomyocytes come by Human embryo pluripotent stem cell differentiation and in the described human nerve stem cell come by Human embryo pluripotent stem cell differentiation, described Human embryo multipotential stem cell is the Human embryo multipotential stem cell of same strain.

Because H9-ESC, H9-NSC and H9-CM have identical genotype and genetic background, by H9-ESC or H9-NSC in contrast, transcript profile is carried out and complete genome DNA methylation analysis has strict without prejudice.By comparing H9-ESC on a large scale, the gene expression profile of H9-NSC and H9-CM and complete genome DNA methylome, filter out 29 kinds of New molecular marker things.The New molecular marker thing that the present invention relates to has vital role on the screening and identification of myocardial cell, and builds in cardiac disease model, all has potential effect and great meaning in the treatment of heart disease and the exploitation of heart disease drug target or medicament research and development.

Accompanying drawing explanation

Fig. 1 is the qualification of mankind myocardial cell.

Fig. 2 is mankind's embryonic pleuripotent stem cell, human nerve stem cell and human myocardium's cellular gene expression thermal map and qPCR checking.

Fig. 3 is CpG island, full-length genome promoter region methylation level thermal map in mankind's embryonic pleuripotent stem cell, human nerve stem cell and human myocardium's cell.

Fig. 4 is DNA demethylation and the analysis of gene expression dose positive correlation of the gene of coding myocardial structural albumen and cardiac transcription factor.

Fig. 5 is that double-core stablizes regulated and control network.

Fig. 6 is functional dependency network analysis.

Fig. 7 is gene-disease network analysis.

Embodiment

The experimental technique used in following embodiment if no special instructions, is ordinary method.

Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.

Human embryos multipotential stem cell system H9 purchased from American WiCell Research Institute, article No. is WA09 (H9)-DL-7;

Mitomycin purchased from American Sigma company, article No. is M0503;

Mouse embryo fibroblasts purchased from American Millipore company, article No. is PMEF-CFL;

Extracellular matrix (qualified-Matrigel) purchased from American BD Biosciences, article No. is 354277;

DMEM/F12 substratum is purchased from Invitrogen company, and article No. is 11320-033;

CDF12 culture medium prescription is as follows:

DMEM/F12 is (purchased from Invitrogen, article No. is 11320-033), 0.1mM non-essential amino acid is (purchased from Invitrogen, article No. is 11140-050), 1mM GlutaMAXTM dipeptides is (purchased from Invitrogen, article No. is 35050-061), 20%Knockout serum substitute is (purchased from Invitrogen, article No. is N10828-028), 1% penicillin/streptomycin is (purchased from Invitrogen, article No. is 15070-063), 55 μMs of beta-mercaptoethanols are (purchased from Invitrogen, article No. is 21985-023) and 10ng/ml Human FGF2 (purchased from Joint Protein Central),

RPMI1640 substratum is purchased from Invitrogen company, and article No. is 11875119;

B27 additive is purchased from Invitrogen company, and article No. is 0080085SA;

B27(is not containing Insulin) additive is purchased from Invitrogen company, and article No. is 0050129SA;

MTeSR substratum purchased from American StemCell Technologies;

ROCK inhibitor Y-27632 is purchased from Sigma-Aldrich, and article No. is Y0503;

CHIR99021 is purchased from Selleck;

Wnt inhibitor IWP4 is purchased from Stemgent;

Triton X-100 purchased from Sigma, article No. T-8787;

Mouse-anti cTnT is purchased from Lab Vision;

Mouse-anti MF20 is purchased from Developmental Studies Hybridoma Bank;

The anti-MLC2v of rabbit is purchased from ProteinTech Group;

Mouse-anti α-Actinin is purchased from Sigma-Aldrich;

Two anti-Alex Fluor488goat anti-mouse IgG are purchased from Life Technologies;

Two anti-Alex Fluor568goat anti-rabbit IgG are purchased from Life Technologies;

The neural stem cell (hNSCs) that human embryos multipotential stem cell system H9 originates and differentiation scheme are at document " Liu GH, Qu J, Suzuki K, Nivet E, Li M, Montserrat N, Yi F, Xu X, Ruiz S, Zhang W, WagnerU, Kim A, Ren B, Li Y, Goebl A, Kim J, Soligalla RD, Dubova I, Thompson J, YatesJ, 3rd, Esteban CR, Sancho-Martinez I, Izpisua Belmonte JC.2012.Progressivedegeneration of human neural stem cells caused by pathogenic LRRK2.Nature491:603-607. " in be disclosed, the public can obtain the neural stem cell (hNSCs) in human embryos multipotential stem cell source from Institute of Biophysics, Academia Sinica,

RNeasy Mini Kit is purchased from QIAGEN;

AffymetrixGeneChipPrimeView Human Gene Expression Arrays is purchased from Affymetrix, and article No. is 901837.

The cultivation of embodiment 1, human embryos multipotential stem cell

Human embryos multipotential stem cell system H9 profit is cultivated with the following method:

One, H9 cell is seeded to has cultivated in advance in the culture plate of the mouse embryo fibroblasts of mitomycin deactivation, use human pluripotent stem cell substratum (CDF12 substratum) and mouse embryo fibroblasts co-cultivation.

Two, with DMEM/F12 substratum, extracellular matrix is diluted to the concentration that volume fraction is 1%, and with the extracellular matrix bag after dilution by culture plate.

Three, it is in the culture plate of extracellular matrix bag quilt of 1% by volume fraction in advance that H9 cell step one cultivated is seeded to, and uses mTeSR culture medium culturing.

Embodiment 2, human embryos multipotential stem cell are to human myocardium's cytodifferentiation

Human embryos multipotential stem cell system H9 to human myocardium's cytodifferentiation scheme based on Palecek scheme (Lian X, Hsiao C, Wilson G, Zhu K, Hazeltine LB, Azarin SM, Raval KK, Zhang J, Kamp TJ, Palecek SP.2012.Robust cardiomyocyte differentiation from human pluripotentstem cells via temporal modulation of canonical Wnt signaling.Proceedings ofthe National Academy of Sciences of the United States of America109:E1848-1857.) improve, scheme after improvement further increases the purity of human myocardium's cell, the concrete steps of the program are as follows:

One, with DMEM/F12 substratum, extracellular matrix is diluted to the concentration that volume fraction is 1%, with the extracellular matrix bag after dilution by culture plate.

Two, human embryos multipotential stem cell system H9 is digested for single cell suspension, with 10 ⁵individual cell/cm ²density be inoculated into through volume fraction to be in the culture plate of extracellular matrix bag quilt of 1%, to add containing the mTeSR substratum of 10 μMs of ROCK inhibitor Y-27632.37 DEG C, cultivate 24 hours under 5% carbon dioxide conditions, then use mTeSR substratum instead and continue cultivation 48 hours.

Three, the differentiation of initial myocardial cell.

(1) used RPMI/B27-insulin culture medium culturing containing 12 μMs of CHIR99021 instead at the 1st day 24 hours, be replaced by RPMI/B27-insulin substratum after 24 hours and continue to cultivate.

Within (two) the 3rd days, use the RPMI/B27-insulin culture medium culturing 48h containing 5 μMs of Wnt inhibitor IWP4 instead, period does not change liquid.

(3) from the 5th day, changed RPMI/B27 substratum every 2-3 days to continue to cultivate.

(4) the 15th days, can human myocardium's cell sheet of spontaneous contractions or agglomerate be collected macroscopic by machine sorting or artificial picking.

(5) by the cell renewed vaccination of collection to through volume fraction be 1% the culture plate of extracellular matrix bag quilt in, cultivate with RPMI/B27 substratum.

The qualification of embodiment 3, human myocardium's cell

Human myocardium's cell in human embryos multipotential stem cell source not only morphologically shows the distinctive contractile function of myocardial cell, and can identify by the biological marker to cardiac myocytespecific further by immunofluorescence and flow cytometry.

One, identified by immunofluorescence

(1) human myocardium's cell that embodiment 2 obtains is divided into four groups, each group is fixed through 4% paraformaldehyde respectively, and 0.3%Triton X-100/PBS is penetrating.Then Four composition not with four kinds of primary antibodies (mouse-anti cTnT, mouse-anti MF20, the anti-MLC2v of rabbit, mouse-anti α-Actinin), 4 DEG C of overnight incubation.Anti-1 hour is hatched by carrying out two in room temperature after a resistant to washing, wherein two of first group of use resist for Alex Fluor488goat anti-mouse IgG, two of second group of use resists for Alex Fluor488goat anti-mouse IgG, and the 3rd group uses two anti-Alex Fluor488goatanti-mouse IgG and two anti-Alex Fluor568goat anti-rabbit IgG to hatch simultaneously.

(2) nucleus DAPI carries out negative staining.Laser confocal microscope gathers image and analyzes.

CTnT is serum cardiac troponin T (cardiac troponin T);

MF20 is myoglobulin heavy chain;

MLC2v is myosin light chain 2v (myosin light chain2V);

α-Actinin is Actin muscle.

Result as shown in Figure 1A.

In Figure 1A, 1(a-c) represent the coloration result of cTnT under different enlargement ratio, 2(a-c) represent the coloration result of MF20 under different enlargement ratio, 3a represents the coloration result of α-Actinin, 3b represents the coloration result of MCL2v, and 3c is the result of 3a and 3b overlap.

Result shows, human myocardium's cell in human embryos multipotential stem cell source can express the special marker serum cardiac troponin T (cardiac troponin T) of cardiac muscle and myosin, by can be observed cardiac muscle fibre structure to the immunofluorescence dyeing of myosin and Actin muscle.

Two, flow cytometry qualification

Result as shown in Figure 1B.

Figure 1B shows, breaking up in human myocardium's cell mass of obtaining about 96% is cTnT positive cell, and about 91% is the cell of the MF20 positive.

Embodiment 4, transcriptome analysis

One, three groups of samples are set: human embryos multipotential stem cell (hESCs) H9(is hereinafter referred to as H9-ESC), human myocardium's cell (hCMs) (hereinafter referred to as H9-CM) that neural stem cell (hNSCs) (hereinafter referred to as H9-NSC) that human embryos multipotential stem cell system H9 originates and the human embryos multipotential stem cell system H9 that identifies of embodiment 3 originate, often organize cell sample establish altogether three parallel.

Two, use Trizol method to extract the total serum IgE of each group of cell each sample, and use RNeasy Mini Kit to be further purified.

Three, by " AffymetrixGeneChipPrimeView Human Gene ExpressionArrays " the gene chip process of the sample of three groups of cells.

Four, differential expression compares

Com-parison and analysis respectively organizes the expression of different genes in H9-ESC, H9-NSC and H9-CM in cell.By the expression signal of AffymetrixGeneChip Scanner30007G cdna collection chip.Utilize R/Bioconductor process expression signal, according to being converted to corresponding gene expression values after the normalization method of RMA algorithm, and draw the expression thermal map (heatmap) of each 3 increment product of H9-ESC, H9-NSC and H9-CM tri-kinds of cells, result as shown in Figure 2 A.

In Fig. 2 A,

HESC#1, hESC#2 and hESC#3 are respectively three parallel sample of H9-ESC;

HNSC#1, hNSC#2 and hNSC#3 are respectively three parallel sample of H9-NSC;

HCM#1, hCM#2 and hCM#3 are respectively three parallel sample of H9-CM;

1/4x represents that the expression level of gene is lowered to 4 times;

1/2x represents that the expression level of gene is lowered to 2 times;

1x represents that the expression level of gene is without noticeable change;

The expression level that 2x represents gene is transferred to 2 times;

The expression level that 4x represents gene is transferred to 4 times.

It is the standard using human embryo stem cell H9-ESC as gene upregulation and downward in figure.

By analysis, as compared to the expression amount of gene in H9-ESC with H9-NSC, have more than 2 times that the expression amount of 695 genes in H9-CM is the expression amount in H9-ESC and H9-NSC simultaneously, have the equal half less than the expression amount in H9-ESC and H9-NSC of the expression amount of 401 genes in H9-CM.

Five, the expression of results of real-time fluorescence quantitative PCR checking key gene, table 1 is the primer of each key gene.Wherein partial results as shown in Figure 2 B, and the result that the result and chip analysis obtain is consistent.

Primer verified by table 1

Gene	Forward primer sequence (5 '-3 ')	Reverse primer sequences (5 '-3 ')
			ACTA2	GTGTTGCCCCTGAAGAGCAT	GCTGGGACATTGAAAGTCTCA
CASQ2	GGCAGAAGAGGGGCTTAATTT	GAAGACACCGGCTCATGGTAG
			CREM	ACACCACCTAGTATTGCTACCA	GGATTGTTCCACCTTGGGCTAT
CSRP3	CCTGTGAAAAGACCGTCTACC	GTCGTGCTGTCAAGAGCCT
			DTNA	TACCCACGGAAGTTTTGGAGG	GGATCTGACATAAGCGTGTCC
EYA4	CTTCTTGCAGTCAAAACAGAGC	GTGGATAGGGCTTGGAAGGAT
			FBXO32	GCCTTTGTGCCTACAACTGAA	CTGCCCTTTGTCTGACAGAAT
GATA4	CGACACCCCAATCTCGATATG	GTTGCACAGATAGTGACCCGT
			GATA5	CTTCGTGTCCGACTTCTTGGA	CCGAGGCATTCCTTGTGGA
GATA6	CTCAGTTCCTACGCTTCGCAT	GTCGAGGTCAGTGAACAGCA
			HAND2	CGCCGACACCAAACTCTCC	TCGCCATTCTGGTCGTCCT
HECW2	AAATCCCCAGATGCGGTACAC	CGGCTCTCAGAAGTCACCA
			ISL1	GCGGAGTGTAATCAGTATTTGGA	GCATTTGATCCCGTACAACCT
KCNA5	CGCGTCCACATCAACATCTC	GGTAGAAGCGTATCTCGTCCG
			LBH	GCCCCGACTATCTGAGATCG	GCGGTCAAAATCTGACGGGT
LDB3	CTATCTCCCGGATCACACCAG	GTGAGGCTCAAGTTGTAGCTG
			leftY2	TGGACCTCAGGGACTATGGAG	CCGAGGCGATACACTGTCG
MARCH11	CCGGGGAGAGTCTTCCACA	GCCTCATCCGATTGAACAGGT
			MEF2A	ACTACAGACCTCACAGTGCCA	GCCTAAGCTATTTGCACCAGT
MEF2C	CCAACTTCGAGATGCCAGTCT	GTCGATGTGTTACACCAGGAG

MIR21	CTGCCTGACTGTCTGCTTGTTT	AGATTCAACAGTCAACATCAGTCTGA
			MITF	CAGTCCGAATCGGGGATCG	TGCTCTTCAGCGGTTGACTTT
MYBPC3	CCATGACGCTGAGGTCAAATG	GCTTGGCACCGATGGACTC
			MYOCD	ACGGATGCTTTTGCCTTTGAA	AACCTGTCGAAGGGGTATCTG
MYOZ2	CCAGGCTATTTAAGATGCGTCA	CCTTCCAAGTTACTTCCATCCAC
			NEXN	ACTGTGAAGGGTAGATTTGCTG	TTCTGCGTTTTCGTTCCTCCT
NKX2	CCAAGGACCCTAGAGCCGAA	ATAGGCGGGGTAGGCGTTAT
			NPPA	CAACGCAGACCTGATGGATTT	AGCCCCCGCTTCTTCATTC
NPPB	TGGAAACGTCCGGGTTACAG	CTGATCCGGTCCATCTTCCT
			PCGF5	AGCCAACAACAGTGACGGAAT	TGAACTTGGTTGCCACACCTT
PLN	ACCTCACTCGCTCAGCTATAA	CATCACGATGATACAGATCAGCA
			PPAPDC3	AGCTGAACCCCTCCTTCAAG	CCGATGACAAAGCCGGAGA
PPARGC1A	TCTGAGTCTGTATGGAGTGACAT	CCAAGTCGTTCACATCTAGTTCA
			PRICKLE1	TTTGCTTGCTTACCAGAGGAAA	ACTGGCAATACCGTACCTCAT
RARB	TCCGAAAAGCTCACCAGGAAA	GGCCAGTTCACTGAATTTGTCC
			SMAD6	GCTACCAACTCCCTCATCACT	CGTACACCGCATAGAGGCG
SMAD7	TTCCTCCGCTGAAACAGGG	CCTCCCAGTATGCCACCAC
			SNTA1	TGCTCCTCTACTTGTCTCTCC	TCTGCATCGTAGGGCACTGA
STAT4	TGTTGGCCCAATGGATTGAAA	GGAAACACGACCTAACTGTTCAT
			TBX2	GCTGACGATTGCCGCTATAAG	GGCTGTCTGGGTGGATGTA
TCEA3	AAGAGCACGGACATGAAGTACC	CTCTGCCGTCATCTTGGCTA
			TNNT2	GGAGGAGTCCAAACCAAAGCC	TCAAAGTCCACTCTCTCTCCATC
TRIM63	CTTCCAGGCTGCAAATCCCTA	ACACTCCGTGACGATCCATGA

TTN	CCCCATCGCCCATAAGACAC	CCACGTAGCCCTCTTGCTTC
			XPO4	ATTTCAGCGTTACCTTGCACT	CAGCACATTTTGCGAGGATTC
ZFPM2	GGCCTGAAAATCTGAGCTGC	CAGTCGTCTGTCTCAACTCCA

Embodiment 5, DNA methylation analysis

One, three groups of samples are set: H9-ESC, H9-NSC and H9-CM, often organize cell sample establish altogether three parallel.

Two, extract the DNA of each group of each sample cell, utilize the DNA methylation sequencing technologies based on bisulfite padlock-probe (bisulfitepadlock probes) and methylation level method of calculation (Diep D, Plongthongkum N, Gore A, Fung HL, Shoemaker R, Zhang is sequencing with bisulfite padlock probes.Nature methods9:270-272. K.2012.Library-freemethylation) analyze H9-ESC, the complete genome DNA methylation level of H9-NSC and H9-CM, portion gene detected result as shown in Figure 3.

In Fig. 3,

HESC is H9-ESC;

HNSC is H9-NSC;

HCM is H9-CM;

-10% represents that CpG island, the promoter region methylation level of gene lowers 10%;

-5% represents that CpG island, the promoter region methylation level of gene lowers 5%;

0 represents that the CpG island, promoter region of gene methylates without noticeable change;

5% represents that CpG island, the promoter region methylation level of gene raises 5%;

10% represents that CpG island, the promoter region methylation level of gene raises 10%.

Using human embryo stem cell H9-ESC as the upper standard lowered that is in harmonious proportion that methylates in figure.

Fig. 3 shows, compares with H9-ESC with H9-NSC, and H9-CM has the highest complete genome DNA methylation level.

By analysis, as compared to the methylation level of CpG island, gene promoter area in H9-ESC with H9-NSC, have the methylation level of CpG island, 985 gene promoter areas in H9-CM has more than 5% simultaneously raising than the methylation level of CpG island, this gene promoter area in H9-ESC and H9-NSC, have the methylation level of CpG island, 195 gene promoter areas in H9-CM has more than 5% simultaneously reduction than the methylation level of CpG island, this gene promoter area in H9-ESC and H9-NSC.

DNA methylation analysis is combined with the transcriptome analysis of embodiment 4 and obtains the methylation level of gene and the result of expression level.As shown in Figure 4, Fig. 4 shows the result of portion gene, and cardiac structure becomes positive correlation with the DNA demethylation of cardiac transcription factor genes involved with gene expression dose.

DNA methylation analysis combined with the transcriptome analysis of embodiment 4 and draw: compare with H9-ESC with H9-NSC, in H9-CM, the expression level identifying gene brings up to more than 2 times and 29 kinds of genes of CpG island, promoter region methylation level reduction by more than 5%.These genes can as the molecular marked compound of human myocardium's cell, as shown in table 2.

The DNA methylation level of table 2 29 kinds of genes and expression level

Embodiment 6, analysis of biological information

Gene-disease network analysis is carried out to the most significant 50 genes of differential expression, finds that there is a kind of cardiovascular disorder of 27 kinds of genes at least with known relevant.Comprising 6 kinds in the above-mentioned 29 kinds of human myocardium's cellular elements markers identified, they are NPPA, MYL4, MYOZ2, ANKRD1, TNNI1, MYH6 respectively.

The analysis of biological information of the remarkable gene of embodiment 7, differential expression

Gene expression level in embodiment 4 being existed to significant difference carries out further analysis of biological information, analyzes and comprises gene clusters analysis (Gene Ontology, GO), functional dependency network analysis and gene-disease network analysis etc.

One, gene clusters analysis

Use the BiNGO plug-in unit of Cytoscape software to carry out cluster analysis, the gene majority that analytical results display is significantly raised has been included in the relevant GO classification of heart function, and this classification comprises myocardial contraction, heart development, sarcomere structural etc.On the contrary, the gene majority significantly lowered is included into m period, the classification such as nuclear division and mitotic division, has pointed out the mitotic division of cell in myocardial cell to be subject to strong suppression.In addition, hESCs can be identified by the significance of modulated gene in analyzing gene regulated and control network upstream and downstream and break up the minimum decisive assortment of genes to hCMs, be determined the stable regulated and control network of a double-core by computation model, as shown in Figure 5.These two cores are relevant with myocardial cell's characteristic to multipotency respectively.The gene expression dose of people for a change in double-core can cause the chain reaction of regulation and control, and hESCs is broken up to hCMs.The transdifferentiation of other cell types to hCMs may be realized equally to the autotelic regulation and control of portion gene in double-core.

Two, functional dependency network analysis

For disclosing the functional dependency of 695 hCMs specific genes that embodiment 4 finds, utilizing the GeneMANIA plug-in unit of Cytoscape software to create network based on dependency, comprising coexpression, altogether location, interact.In addition, be included into myocardial contraction, heart development by above-mentioned GO cluster analysis, the gene group of the classifications such as cardiac transcription regulation and control produces secondary network respectively, as shown in Figure 6.

Fig. 6 A is myocardial contraction genes involved network.

Fig. 6 B is cardiac transcription regulated and control network.

Fig. 6 C is heart development genes involved network.

Network shown in Fig. 6 is expression of cardiac gene New function, the prediction etc. of new dependency provides support.

Three, gene-disease network analysis

The DisGeNET plug-in unit of Cytoscape software is utilized to carry out gene-disease network analysis to the most significant 50 genes of differential expression in hCMs specific gene.Wherein, a kind of cardiovascular disorder of 27 genes at least with known is relevant.In addition, there are 5 kinds of genes (NPPB, TNNT2, NPPA, RYR2 and PLN) and are related more than 10 kinds of different types of cardiovascular disordeies.Be proved to be relevant with these differential expressions the most significant hCMs specific gene more than the transgenation of 140 kinds of disease-relateds, partial results as shown in Figure 7.The analytical results of gene-disease network highlights these hCMs specific genes further to the vital role maintaining normal heart growth, provides reference and foundation for disclosing heart trouble mechanism and even treating heart trouble.

29 genes that embodiment 5 obtains are included into Muscle contraction in cluster analysis, and myoarchitecture forms, the classifications such as sarcomere structural, are the gene that cardiac structure is relevant.Visible, the gene relevant to cardiac structure mainly regulates and controls by DNA methylation.And all the other demethylation genes not producing significantly change on expression level may accept regulation and control in other level.In addition, most genes relevant to cardiac structure show the hyper-methylation on CpG island in hESCs and hNSCs, and pointed out in the cell lineage of non-myocardial infarction, the promoter region DNA methylation of these genes is topmost suppression signals.

In addition, there is the special transcription factor of some myocardial cells (as NKX2.5, GATA6, GATA4, MYOCD, HAND2, TBX5, TBX18 etc.) in hESCs, hNSCs and hCMs, all show similar hypomethylation level, but in hCMs expression level far above hESCs and hNSCs.Previous research have also discovered these transcription factors histone modification H3K27me3 level of inhibition in the atomization of hESCs to hCMs and there occurs reduction.Pointed out these genes, histone modification is only topmost epigenetic regulation factor.

Claims

1. one group for the identification of or the marker of assistant identification human myocardium cell, by following 29 kinds of genomic constitutions: POPDC2, ALPK2, TRIM55, ASPH, FILIP1, HSPB7, NPPA, KBTBD10, MYL4, CRYAB, LRRN4, MYOZ2, OBSCN, SMPX, NRK, ABLIM1, SYNPO2L, ANKRD1, TNNI1, MYH6, ABRA, TPM1, C15orf52, MYOM1, MASP1, MYBPC3, TNS1, FLNC, F2RL2;

2. marker according to claim 1, is characterized in that: CpG island, the promoter region methylation level of these 29 kinds of genes described all significantly reduces all methylated than the CpG island, promoter region of homologous genes in human embryos multipotential stem cell and/or the human nerve stem cell amount reduction by more than 5% of the methylated amount in CpG island, promoter region referring to often kind of gene in human myocardium's cell;

3. the application of marker described in claim 1 or 2 in identifier myocardial cell, described in be applied as non-diseases treatment or diagnostic method;

Or marker described in claim 1 or 2 is being prepared, is being developed or design the application in the product of identifier myocardial cell.

4. marker described in claim 1 or 2 is identifying the application in Human Cardiomyocytes from Human Cardiomyocytes, Human embryo multipotential stem cell and human nerve stem cell;

Or marker described in claim 1 or 2 is identifying the application in Human Cardiomyocytes from Human Cardiomyocytes and Human embryo multipotential stem cell.

5. marker described in claim 1 or 2 is being prepared, is being developed or design the application had in the product of following function: from Human Cardiomyocytes, Human embryo multipotential stem cell and human nerve stem cell, identify Human Cardiomyocytes;

Or marker described in claim 1 or 2 is in preparation, exploitation or design the application had in the product of following function: identify Human Cardiomyocytes from Human Cardiomyocytes and Human embryo multipotential stem cell.

6., according to the arbitrary described application of claim 3-5, it is characterized in that: described Human Cardiomyocytes is by described Human embryo pluripotent stem cell differentiation; Described human nerve stem cell is by described Human embryo pluripotent stem cell differentiation.

7. the application of material in the test kit of characterization human myocardium cell of the material detecting CpG island, the promoter region methylation level of 29 kinds of genes and the mrna expression amount detecting 29 kinds of genes;

8. the material of the material detecting CpG island, the promoter region methylation level of 29 kinds of genes and the mrna expression amount detecting 29 kinds of genes is preparing the application had in the test kit of following function: from Human Cardiomyocytes, Human embryo multipotential stem cell and human nerve stem cell, identify Human Cardiomyocytes;

9. the material of the material detecting CpG island, the promoter region methylation level of 29 kinds of genes and the mrna expression amount detecting 29 kinds of genes is preparing the application had in the test kit of following function: from Human Cardiomyocytes and Human embryo multipotential stem cell, identify Human Cardiomyocytes;

10., according to the arbitrary described application of claim 7-9, it is characterized in that: described Human Cardiomyocytes is by described Human embryo pluripotent stem cell differentiation; Described human nerve stem cell is by described Human embryo pluripotent stem cell differentiation.