CN109706242A - Myocardial cell damage detection kit and its application - Google Patents

Abstract

The present invention relates to myocardial cell damage detection kit, the kit includes the reagent for detecting non-methylation fragment in the island FAM101A gene order Zhong CpG.Kit positive detection accuracy rate of the invention is high, short the time required to reproducible, high sensitivity, and detection.

Description

Myocardial cell damage detection kit and its application

Technical field

The present invention relates to molecular diagnosis fields, in particular to myocardial cell damage detection kit and its application.

Background technique

Myocardial cell damage is clinically assessed at present, mainly passes through the liter of detection Blood Center creatase spectrum and troponin High-amplitude is assessed.Cardiac muscle cells are impaired more serious, and myocardium enzyme and the raised amplitude of troponin are bigger.But in blood Myocardium enzyme and troponin can not react the damage situations of cardiac muscle cell under certain pathologic conditions, such as in sepsis patient On, due to occur infection in blood and sufferer kidney organ be easy it is impaired, to the metabolism of troponin by The relevance of resistance, the changes of contents and heart damage of myocardium enzyme and troponin reduces.In addition, the inspection of myocardium enzyme and troponin It surveys due to being that protein level not can be carried out specific amplification, the sensitivity of detection is low compared with detection of nucleic acids, therefore cannot be earlier Phase predicts the generation of the heart diseases such as heart infarction.

Summary of the invention

In one embodiment, the present invention provides a kind of myocardial cell damage detection kit, and the kit includes Detect the reagent of non-methylation fragment in the island FAM101A gene order Zhong CpG.

In one embodiment, the kit includes in based on PCR method quantitative detection people's FAM101A gene order The island CpG in non-methylation fragment reagent.

In one embodiment, the kit includes the transcription initiation that methylated amplification position is FAM101A gene At point upstream 104kb, No. 12 chromosome of people: the primer and probe in the region of 124207928-124208072bp is covered.

In one embodiment, the kit includes following primer and probe: upstream primer sequence: ATGATTGATAATAATGTATGGTG；Downstream primer sequence: CCTCCACAAAATTTACCT；With detection probe sequence: TCAACTTCCATCTACAATTCCCA。

In one embodiment, the kit includes the reagent for detecting reference gene, and the reference gene is ACTB Gene；Detecting ACTB gene includes following primer and probe: upstream primer sequence: GTGATGGAGGAGGTTTAGTAAGTT；Under Swim primer sequence: CCAATAAAACCTACTCCTCCCTTAA；With detection probe sequence: ACCACCACCCAACACACAATAACAAACACA。

In one embodiment, the present invention provides application of the mentioned reagent box in myocardial cell damage detection.

Kit of the present invention can utmostly enable qPCR of the invention to distinguish heart tissue and its hetero-organization, thus So that kit accuracy in detection of the invention significantly improves, the false positive of detection is avoided to occur.Kit of the invention is positive Detection accuracy is high, reproducible, high sensitivity, and detection required time is short.

Detailed description of the invention

It in order to more clearly explain the technical solutions in the embodiments of the present application, below will be to needed in the embodiment Attached drawing is briefly described, it should be apparent that, the accompanying drawings in the following description is only some embodiments as described in this application, right For those of ordinary skill in the art, without creative efforts, it can also be obtained according to these attached drawings Its attached drawing.

Fig. 1 is the qPCR response diagram of the heart tissue of kit detection of the present invention, and long dotted line is the anti-of reference gene ACTB Answer curve；Short dash line is the response curve of FAM101A gene.It can be seen that internal reference and FAM101A gene are all in heart tissue It is positive；

Fig. 2 is the qPCR response diagram of kit detection blood sample of the present invention, and long dotted line is the response curve of reference gene ACTB； Short dash line is the response curve of FAM101A gene；

Fig. 3 is using the qPCR response diagram of non-present invention kit detection blood sample, and long dotted line is the anti-of reference gene ACTB Answer curve；With

Fig. 4 is to detect children with congenital heart disease perioperatively using kit of the present invention, the non-methyl of FAM101A in blood plasma Change the content results figure of segment.

Specific embodiment

In order to make art technology field personnel more fully understand the technical solution in the application, below in conjunction with following reality Applying example, the invention will be further described, it is clear that described embodiments are only a part of embodiments of the present application, rather than complete The embodiment in portion.Based on the embodiment in the application, those of ordinary skill in the art are without making creative work All other embodiment obtained, shall fall within the protection scope of the present application.

The one non-methylation detection kit of .FAM101A gene of embodiment

Research finds that non-methylation fragment occurs in cardiac muscle cell in FAM101A gene, and in its hetero-organization, including blood It is all hyper-methylation in liquid.Therefore can by detection peripheral blood blood plasma in dissociative DNA the non-methylation fragment of FAM101A, Come the case where judging myocardial cell damage.When cardiac muscle cells are impaired more, the FAM101A gene in blood plasma in dissociative DNA is non- Methylation fragment is more.

In order to facilitate the content of the non-methylation fragment of the FAM101A gene in dissociative DNA in detection peripheral blood blood plasma, originally Invention provides the primer and TaqMan probe of a kind of non-methylation fragment of specific detection FAM101A gene.And by interior Whether the detection situation of crt gene ACTB is normal come the result for assessing experiment.

Behind the island analysis of biological information FAM101A gene order Zhong CpG, the region for finding the enrichment of the island CpG is qPCR The target region of primer, probe design；FAM101A gene is located at No. 12 chromosome of people: 124,311,708-124,314,623 Place；The methylated amplification position that the present invention selects for the transcripting start point upstream 104kb of FAM101A gene at, the PCR of amplification is produced Object is 134bp, covers No. 12 chromosome of people: the region of 124207928-124208072bp.134bp range as described above, 4 TG are devised in upstream primer, and 4 CA of design on the probe on 2 CA and anti-chain are devised in downstream primer.And this A little bases are CG sequences in its hetero-organization other than heart tissue, thus can utmostly enable our area qPCR Divide heart tissue and its hetero-organization.

Primer involved in the present invention, probe sequence such as the following table 1:

The non-methylation fragment of table 1.FAM101A carries out the primer and probe of qPCR method detection

Title	Sequence (5 ' -3 ')	Sequence names	Tm value
				FAM101A upstream primer	ATGATTGATAATAATGTATGGTG	SEQ ID NO:1	50.8
FAM101A downstream primer	CCTCCACAAAATTTACCT	SEQ ID NO:2	50.9
				FAM101A probe	TCAACTTCCATCTACAATTCCCA	SEQ ID NO:3	58.9

The dinucleotides base of the above italicized item is the distinguishing base of non-methylation state and methylation state.Non- methyl TG, CA when change state corresponding dinucleotides sequence in methylation state are all CG respectively.

The end of probe 5 ' of FAM101A has fluorescent reporter group FAM, and 3 ' ends have fluorescent quenching group BHQ1.

It is also same in order to monitor whether plasma dna extraction, the conversion of DNA sulphite and qPCR reaction system work normally When joined the ACTB gene of reference gene people, the primer of ACTB gene, probe such as the following table 2.

The primer and probe of 2. reference gene ACTB gene of table progress qPCR method detection

The end of probe 5 ' of ACTB has fluorescent reporter group VIC, and 3 ' ends have fluorescent quenching group BHQ1.

In addition the present invention has selected No. 12 chromosome of section selected positioned at the present invention: 124207928-124208072 At the upstream the 5' 500bp in region, it is following (abbreviated here as " setting another set FAM101A gene primer, probe design have been carried out Meter 2 ") and the present invention designed by primer, probe be compared.

The non-methylation fragment for the FAM101A that table 3. compares carries out the primer and probe of qPCR method detection

Title	Sequence (5 ' -3 ')	Sequence names	Tm value
				FAM101A upstream primer	TTGGTGTTATTTTGATGGGTA	SEQ ID NO:7	53.5
FAM101A downstream primer	TCTTCCCCTAAAACCAAT	SEQ ID NO:8	53.3
				FAM101A probe	AATCCTAACTTCCACCCAAC	SEQ ID NO:9	58.6

The long 125bp of PCR product, the dinucleotides base of the above italicized item are non-methylation state and methylation state Distinguishing base.

The application of the two non-methylation detection kit of .FAM101A gene of embodiment

1. applying 1

The present invention detects the difference of the methylation of FAM101A gene in heart tissue and peripheral blood first.Tissue samples and Blood sample takes the genomic DNA of 300ng after extracting genomic DNA, is respected at kind sulphite treatment kits with Jiangsu Reason, so that the C base of non-methylation is converted into U base, and the C base to methylate continues to remain C base, this by sub- Treated that DNA is known as bis-DNA for sulfate.Jiangsu, which is respected, to be also equipped with magnetic bead in kind sulphite treatment kits and can recycle bis-DNA.Following quantitative fluorescent PCR reaction is carried out using the bis-DNA of recycling: such as table 1, reaction condition such as table 2.

The reaction system of table 4.qPCR method detection FAM101A gene methylation state

Moisturizing is to 20 μ L.

Table 5.qPCR reaction condition

On quantitative fluorescent PCR instrument ABI7500, the fluorescent quantitation for detecting heart tissue and normal blood tissue reacts bent Line chart is referring to Fig. 1 and Fig. 2.When qPCR amplification Ct value < 45 when think for the positive.As can be seen from Figure 1 in heart tissue, Internal reference and FAM101A gene are all positive (Ct value are respectively 26.8,32.1)；As can be seen from Figure 2 in blood sample, internal reference base The qPCR of cause the result is that the positive (value=28.7 Ct), FAM101A gene qPCR the result is that feminine gender (not playing peak, do not have Ct value).Fig. 3 The primed probe of the design 2 of display in normal blood sample, FAM101A gene also occur nonspecific false positive (Ct value= 38.2), therefore the present invention can be by the presence of the non-methylation fragment of FAM101A gene in detection blood sample, to reflect the heart The severity that myocyte is damaged.

2. applying 2

According to application 1 as a result, selection children with congenital heart disease operation consent and postoperative 6 hours peripheral bloods detect The variation of the non-methylation fragment of FAM101A gene postoperative content in the preoperative is handled using internal reference Gene A CTB as data normalization Baseline, as a result referring to fig. 4.Figure 4, it is seen that 6 hours after operation, the content of the non-methylation fragment of FAM101A in blood plasma Occur significantly raised, after clinically observing openheart surgery, the phenomenon that myocardial cell damage is identical.

For the condition of the pcr amplification reaction in the present invention, it is not exposed to special limitation, is produced as long as amplification can be obtained Object is conducive to probe and combines.

It should be understood that the present invention disclosed is not limited only to specific method, scheme and the substance of description, because these It is alterable.It will also be understood that purpose of the terminology used here just for the sake of the specific embodiment scheme of description, rather than It is intended to limit the scope of the invention, the scope of the present invention is limited solely by the attached claims.

Those skilled in the art, which will also be appreciated that or be able to confirm that, uses no more than routine experiment, institute herein The many equivalents for the specific embodiment of the invention stated.These equivalents are also contained in the attached claims.

Sequence table

<110>the emerging biomedical Science and Technology Ltd. of Shunde District, Foshan City brightness brocade wound

<120>myocardial cell damage detection kit and its application

<130> PF1904

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 1

atgattgata ataatgtatg gtg 23

<210> 2

<211> 18

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 2

cctccacaaa atttacct 18

<210> 3

<211> 23

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 3

tcaacttcca tctacaattc cca 23

<210> 4

<211> 24

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 4

gtgatggagg aggtttagta agtt 24

<210> 5

<211> 25

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 5

ccaataaaac ctactcctcc cttaa 25

<210> 6

<211> 30

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 6

accaccaccc aacacacaat aacaaacaca 30

<210> 7

<211> 21

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 7

ttggtgttat tttgatgggt a 21

<210> 8

<211> 18

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 8

tcttccccta aaaccaat 18

<210> 9

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 9

aatcctaact tccacccaac 20

Claims (6)

1. myocardial cell damage detection kit, which is characterized in that the kit includes in detection FAM101A gene order The reagent of non-methylation fragment in the island CpG.

2. kit according to claim 1, which is characterized in that the kit includes based on PCR method quantitative detection In people's FAM101A gene order in the island CpG non-methylation fragment reagent.

3. kit according to claim 2, which is characterized in that the kit includes that methylated amplification position is At the transcripting start point upstream 104kb of FAM101A gene, No. 12 chromosome of people is covered: 124207928-124208072bp's The primer and probe in region.

4. kit according to claim 3, which is characterized in that the kit includes following primer and probe:

Upstream primer sequence: ATGATTGATAATAATGTATGGTG；

Downstream primer sequence: CCTCCACAAAATTTACCT；With

Detection probe sequence: TCAACTTCCATCTACAATTCCCA.

5. kit according to claim 4, which is characterized in that the kit includes the reagent for detecting reference gene, The reference gene is ACTB gene；Detecting ACTB gene includes following primer and probe:

Upstream primer sequence: GTGATGGAGGAGGTTTAGTAAGTT；

Downstream primer sequence: CCAATAAAACCTACTCCTCCCTTAA；With

Detection probe sequence: ACCACCACCCAACACACAATAACAAACACA.

6. application of -5 any kits in myocardial cell damage detection according to claim 1.