CN103451169A - Timber growth regulation related gene and its application - Google Patents

Abstract

The invention relates to a timber growth regulation related gene and its application, and concretely provides a new PtMAN6 polypeptide or its coding sequence. The amino acid sequence of the PtMAN6 polypeptide is represented by SEQ ID NO.:2, and the coding sequence of the PtMAN6 polypeptide is represented by SEQ ID NO.:1. The invention also provides uses of a PtMAN6 gene and its coding proteins. The PtMAN6 gene and its coding proteins can reduce the xylem secondary cell wall synthesis and/or reduce crystallized fiber biomass accumulation; the over-expressed PtMAN6 gene can enrich mannan hydrolase degrading mannan hemicelluloses, and the regulation effect of the PtMAN6 gene reduces the content of lignin in transgenic plants, reduces the crystalline cellulose and substantially reduces the ethanol production cost and the papermaking industrial cost; and the promoter of the PtMAN6 gene has a specific conduit cellular localization function and can accurately regulate the expression of the gene in xylem conduit cells.

Description

A kind ofly regulate and control genes involved and the application thereof that timber is grown

Technical field

The invention belongs to biotechnology and bioenergy field, particularly, the present invention relates to a kind of genes involved and application thereof that timber is grown that regulate and control.

Background technology

Along with the continuous increase of socio-economic development and population, the mankind are more and more to the demand of the energy, and because fossil energy is limited, the price of the products such as oil rises steadily, and the stable sustainable development of economy is threatened.

Reproducible biomass energy is one of desirable substitute energy, and bio-ethanol is that prospect and topmost biomass energy are arranged at present most.Since the oil crisis in 20 century 70 mid-terms, take the U.S. and Brazil is that some main countries start actively to carry out the bio-ethanol evolutionary operation(EVOP), and since this century, global bio-ethanol output increases sharply.Early stage utilize more food crop as corn etc. as raw material production ethanol, cause higher food prices, have contradiction with national grain security, can not carry out scale operation.In recent years, American-European wait state a large amount of drop into to carry out take bio-ethanol production technology and the industrial practice that lignocellulose is raw material, actively cultivate applicable national energy crop simultaneously.China is also in the positive research of carrying out lignocellulose ethanol fermentation.

The lignocellulose alcohol production mainly contains four steps: 1 pre-treatment, and the structure of destruction lignocellulose, remove the materials such as xylogen that hinder saccharification and fermentation; 2 acid or enzymic hydrolysis Mierocrystalline cellulose become monose with hemicellulose; 3 use zymophytes are fermented into ethanol by hexose and five-carbon sugar; 4 distillation dehydration purifying ethanols, make it reach the requirement as the energy.Wherein the production cost of the 1st, 2 steps is too high, and efficiency is very low, has seriously limited the development of the fibrous biomass energy, causes xylogen bio-ethanol production cost high.

In addition, lignocellulose also is widely used in paper industry.Mainly contain at present two large class paper-making pulping process: mechanical feedback and chemical pulping.Mechanical feedback by mechanical separation paper fiber, is not removed xylogen wherein, can obtain high paper output, but but, because the existence of xylogen causes its bleachability low, the paper of production is easily jaundice under light.Chemical pulping utilizes chemical substance to remove the xylogen in cell walls, can obtain long and pliable and tough paper fiber, thereby can produce high-quality paper.The bleaching of paper pulp is other one important procedure of pulp and paper industry, is mainly further remove the xylogen in paper pulp or change the xylogen chromophoric group by chemical substance, thereby improves whiteness and the retention of whiteness of paper pulp.Traditional SYNTHETIC OPTICAL WHITNER mostly is chlorine bleaching agent, contains the toxic substance with strong carinogenicity in waste water, and environmental pollution is very large.

Therefore this area does not also have a kind of xylplant that is suitable for producing biofuel and papermaking, the genes involved of therefore growing in the urgent need to research regulation and control timber, and exploitation is applicable to the timber variety of production renewable energy source and papermaking.

Summary of the invention

Purpose of the present invention just is to provide a kind of genes involved and application thereof that timber is grown that regulate and control.

In a first aspect of the present invention, the encoding sequence of a kind of PtMAN6 polypeptide or PtMAN6 polypeptide is provided, the aminoacid sequence of described PtMAN6 polypeptide is as shown in SEQ ID NO.:2, and the encoding sequence of described PtMAN6 polypeptide is as shown in SEQ ID NO.:1.

In a second aspect of the present invention, the purposes of PtMAN6 polypeptide or its encoding sequence is provided, described purposes is optionally from one or more of lower group:

(1) reduce the synthetic of xylem secondary cell wall;

(2) reduce the accumulation of crystalline fibers biomass;

(3) reduce the content of xylogen (preferably reducing plant stem xylogen).

In another preference, described PtMAN6 polypeptide is selected from lower group:

(I) there is the polypeptide of aminoacid sequence shown in SEQ ID NO.:2 or SEQ ID NO.:17;

(II) the derivative polypeptide by (1) aminoacid sequence as shown in SEQ ID NO.:2 or SEQ ID NO.:17 formed through replacement, disappearance or the interpolation of one or several amino-acid residue; Or

(III) homology of aminoacid sequence >=90% shown in aminoacid sequence and SEQ ID NO.:2 or SEQ ID NO.:17 (preferably >=95%, the more preferably 98%) polypeptide derivative by (1).

In another preference, the encoding sequence of described PtMAN6 polypeptide is selected from lower group:

(i) coding has the polynucleotide of the polypeptide of aminoacid sequence shown in SEQ ID NO.:2 or SEQ ID NO.:17;

(ii) polynucleotide of sequence as shown in SEQ ID NO.:1 or SEQ ID NO.:16;

(iii) polynucleotide of the homology of sequence >=95% (preferably >=98%, more preferably >=99%) shown in nucleotide sequence and SEQ ID NO.:1 or SEQ ID NO.:16;

(iv) 5 ' of polynucleotide end and/or 3 ' end brachymemma or add the polynucleotide of 1-60 (preferably 1-30, more preferably 1-10) Nucleotide as shown in SEQ ID NO.:1 or SEQ ID NO.:16; Or

(v) with (i)-(iv) polynucleotide of arbitrary described polynucleotide complementation.

In a third aspect of the present invention, a kind of method that improves plant trait is provided, described improvement plant trait is selected from lower group: the secondary cell wall that (1) reduces the plant xylem synthesizes; (2) reduce the accumulation of plant crystalline fibers biomass; (3) reduce the content of plant lignin (preferably reducing plant stem xylogen);

Described method comprises step: the expression or the activity that improve PtMAN6 polypeptide in described plant or its encoding sequence.

In another preference, described method comprises step: the encoding sequence of PtMAN6 polypeptide is imported in vegetable cell, cultivate described vegetable cell, the regeneration plant.

In another preference, described plant is Salicaceous Plants, is preferably willow.

In a fourth aspect of the present invention, a kind of promoter element is provided, described promoter element is the promotor of plant PtMAN6 gene, and described promoter element has the function that plant xylem vessel cell-specific starts.

In another preference, described promoter element does not have the function of the special startup of plant xylem cambial cell.

In another preference, described promoter element is selected from lower group:

(a) there are the polynucleotide of sequence as shown in SEQ ID NO.:3;

(b) homology of sequence shown in nucleotide sequence and SEQ ID NO.:3 >=95% (preferably >=98%, more preferably >=99%), and there are the polynucleotide of plant xylem vessel cell-specific start-up performance;

(c) brachymemma 1-60,5 ' of polynucleotide end and/or 3 ' end (preferably 1-30, more preferably 1-6) Nucleotide as shown in SEQ ID NO.:3, and there are the polynucleotide of plant xylem vessel cell-specific start-up performance.

In a fifth aspect of the present invention, provide a kind of construction, the described promoter element of fourth aspect present invention that described construction contains foreign gene and is operatively connected with foreign gene.

In another preference, described foreign gene is selected from lower group:

Resistant gene, selection markers gene, antigenic protein gene, RNAi gene, microRNA gene, biotechnological formulation gene or plant quality genes involved.

In a sixth aspect of the present invention, a kind of expression cassette is provided, described expression cassette from 5 ' to 3 ' has following element successively: the described promoter element of fourth aspect present invention, gene ORF sequence and terminator.

In a seventh aspect of the present invention, a kind of carrier is provided, described carrier contains the described promoter element of fourth aspect present invention or the described expression cassette of sixth aspect present invention.

In a eighth aspect of the present invention, a kind of host cell is provided, and described host cell contains the described carrier of seventh aspect present invention or its chromosomal integration has the described promoter element of fourth aspect present invention of external source or its chromosomal integration that the described expression cassette of sixth aspect present invention is arranged.

In a ninth aspect of the present invention, provide the purposes of the described promoter element of fourth aspect, the 5th described construction in aspect or the 6th described expression cassette in aspect, the expression for specificity regulation and control foreign gene at plant xylem vessel cell.

In a tenth aspect of the present invention, a kind of method at plant xylem vessel cell specific expression foreign gene is provided, comprise step:

(a) provide a construction, the described promoter element of fourth aspect that described construction contains foreign gene and is operably connected with this foreign gene;

(b) construction in step (a) is imported to plant xylem vessel cell, obtain the xylem vessel's cell transformed.

In should be understood that within the scope of the present invention, above-mentioned each technical characterictic of the present invention and can combining mutually between specifically described each technical characterictic in below (eg embodiment), thus form new or preferred technical scheme.As space is limited, tire out and state no longer one by one at this.

The accompanying drawing explanation

Following accompanying drawing, for the specific embodiment of the invention scheme is described, limits and be not used in the scope of the invention defined by claims.

Fig. 1 shows 35S:PtMAN6 over-express vector structure.

Fig. 2 shows 35S:PtMAN6-GFP over-express vector structure.

Fig. 3 shows 35S:PtMAN6AS antisense expression vector structure.

Fig. 4 shows MAN6G transient expression carrier structure.

Fig. 5 shows MAN6sG transient expression carrier structure.

Fig. 6 has shown various transfer-gen plant phenotypes.Fig. 6 A shows that Werstern Blot detects the transfer-gen plant result; Fig. 6 B shows overexpression PtMAN6(OE), wild-type (WT), antisense expression PtMAN6(AS) phenotype of plant, scale is 20 centimetres; Fig. 6 C-Fig. 6 E shows transfer-gen plant petiole physical strength, and overexpression plant (Fig. 6 D, OE) is with respect to wild-type (Fig. 6 C, WT) and antisense expression plant (Fig. 6 E, AS) petiole deliquescing, and arrow shows petiole, and scale is 10 centimetres; Fig. 6 F-Fig. 6 H shows respectively in Fig. 6 C-Fig. 6 E the deposition of xylogen in plant cane petiole, and petiole is through free-hand section, phloroglucinol stain, and the deposition of red display xylogen, scale is 500 microns.

Fig. 7 shows the result of variations of lignin deposition and wood components in transgenosis and wild-type willow stem.Fig. 7 A)-Fig. 7 C): wild-type (Fig. 7 A), PtMAN6OE(Fig. 7 B), and PtMAN6AS(Fig. 7 C) the free-hand section phloroglucinol stain of 14 joint stems in plant, red display lignin deposition, arrow indicates the accumulation of xylogen in myelocyte; Fig. 7 D-Fig. 7 F: be respectively the enlarged view of black surround part in Fig. 7 A-Fig. 7 C, arrow indicates the accumulation of xylogen in vessel cell; Fig. 7 G-Fig. 7 I: ultraviolet detection wild-type (Fig. 7 G), PtMAN6OE(Fig. 7 H), and PtMAN6AS(Fig. 7 I) 12 joint sections in plant, lignified cell autofluorescence is stronger, is blue, the cell that lignifying is weak, autofluorescence is purple a little less than, and arrow indicates immature vessel cell; The comparative result that Fig. 7 J is ABSL xylogen in transfer-gen plant timber, cross xylogen in expression PtMAN6 plant (OE) and significantly reduce; The comparison that Fig. 7 K is crystalline cellulose in transfer-gen plant timber, cross crystalline cellulose in expression PtMAN6 plant (OE) and significantly reduce; The area that Fig. 7 L is transfer-gen plant prematurity vessel cell changes result, and institute's survey conduit is the conduit of arrow sign in figure G-I; Statistical analysis adopts the T check, ^*represent p<0.05, ^*represent p<0.01, in Fig. 7 A-Fig. 7 C, scale is 500 μ m; In Fig. 7 D-Fig. 7 I, scale is 100 μ m, and Fig. 7 J-Fig. 7 L error line refers to the standard error of statistics.

Fig. 8 shows height and the girth analytical results of 1.5 years living transgenic poplar timber, and wherein, Fig. 8 A shows overexpression PtMAN6 willow (OE), and the trunk height of the willow of antisense expression PtMAN6 and wild-type (WT) willow does not have notable difference; Fig. 8 B shows that the girth of the butt of OE, AS and WT willow does not have notable difference, and statistical analysis adopts the T check.

Fig. 9 has shown the enzyme activity assay of PtMAN6; Wherein, the optimal pH measurement result that Fig. 9 A is PtMAN6, substrate is the 1%AZCL-glactomannan suspension that is dissolved in 0.1M citric acid-phosphoric acid buffer that the pH scope is 3.0-8.0, and WT and PtMAN6 refer to respectively from wild-type and cross and express the zymoprotein (lower same) extracted the plant mature leaf; Fig. 9 B shows the optimal reactive temperature measurement result of PtMAN6, and substrate is the 1%AZCL-glactomannan suspension that is dissolved in 0.1M citric acid-phosphoric acid buffer of pH5.0; Fig. 9 C shows PtMAN6 de-glycosylation result, PtMAN6(the first swimming lane extracted in Werstern hybridization analysis plant), and Endo H _fprocess the PtMAN6 of 0.5 hour (the second swimming lane) and 1 hour (the 3rd swimming lane), M: the protein label dyed in advance; Fig. 9 D is that glycosylation affects the enzymic activity result, with contrasting (control), compares, and PtMAN6 is through Endo H _fde-glycosylation 2 hours, enzymic activity approximately is reduced to original 50%.

Figure 10 shows the quantitative PCR analysis result of PtMAN6 gene in willow.Respectively from the xylem of 1 year growing poplar, phloem, spire, Lao Ye and stem top tissue extraction RNA carry out the quantitative RT-PCR analysis, using in willow the Actin gene as internal reference.

Figure 11 shows the immunolocalization analytical results of PtMAN6; Wherein, the sectional view that Figure 11 A and Figure 11 B are 1 year living wild-type willow the 6th internode, show that PtMAN6 is positioned xylem vessel's cell; Figure 11 B is the enlarged view at black surround position in Figure 11 A; The rip cutting figure that Figure 11 C is 1 year living wild-type willow the 6th internode, show that PtMAN6 is positioned xylem vessel's cell; The sectional view that Figure 11 D and Figure 11 E are 1 year living wild-type willow stem top tissue, show that PtMAN6 is positioned xylem vessel's cell; Figure 11 E is the enlarged view at black surround position in Figure 11 D; The negative contrast of Figure 11 F, the sectional view of 1 year living wild-type willow the 6th internode, fail to detect any signal for locating.

Figure 12 shows that the PtMAN6-GFP protein localization is in plasma membrane.Figure 12 A and Figure 12 B show stably express PtMAN6-GFP albumen in the Arabidopis thaliana root, and this protein localization is in plasma membrane; Figure 12 C and Figure 12 D, 30% sucrose plasmolysis Arabidopis thaliana root cells, show that the PtMAN6-GFP protein localization is in plasma membrane; Figure 12 E is the carrier for transient expression; The Werstern that Figure 12 F is subcellular components detects, and M is for indicating protein molecular, and 1 is the kytoplasm component, and 2 is membrane component; Particle bombardment MAN6G carrier in transient expression Figure 12 E in onion epidermis cell for Figure 12 G and Figure 12 H; Figure 12 I and Figure 12 J show with particle bombardment MAN6sG carrier in transient expression Figure 12 E in onion epidermis cell; Particle bombardment carrier of CK in transient expression Figure 12 E in onion epidermis cell for Figure 12 K and Figure 12 L; A, C, G, I, K is GFP fluorescence picture; B, D, H, J, L is the light field picture, scale is 50 μ m.

Figure 13 shows relative expression's level of secondary wall formation associated transcription factor in the plant of overexpression PtMAN6.RNA extracts from 1 year growing poplar xylem, and the expression of wild-type is defined as 1, and willow Actin gene is as internal reference.

Figure 14 has shown in the plant of overexpression PtMAN6 and has changed with the expression of secondary wall component synthetic gene.Figure 14 A shows that in the plant of overexpression PtMAN6, the gene of lignin monomer route of synthesis and lignin polymerization's genes involved are suppressed; Figure 14 B shows that in the plant of overexpression PtMAN6, the expression of the Mierocrystalline cellulose synthetic gene CesA8 that secondary wall is relevant is suppressed; Figure 14 C shows that in the plant of overexpression PtMAN6, the expression of the xylan synthetic gene GT43B that secondary wall is relevant is suppressed.RNA extracts from 1 year growing poplar xylem, and the expression of wild-type is defined as 1, and willow Actin gene is as internal reference.

Embodiment

The inventor, through extensive and deep research, has found a kind of new PtMAN6 polypeptide or its encoding sequence first, and the aminoacid sequence of described PtMAN6 polypeptide is as shown in SEQ ID NO.:2, and described encoding sequence is as shown in SEQ ID NO.:1.In addition, the present invention also provides the purposes of the albumen of PtMAN6 gene in the plant and coding thereof, and they can be synthetic for the secondary cell wall that regulates and controls xylem and the accumulation of regulation and control fibrous biomass; Overexpression PtMAN6 can be in plant the mannosans lytic enzyme of enrichment degraded mannans hemicellulose, while is due to the regulating and controlling effect of PtMAN6, in this transfer-gen plant, content of lignin reduces, the crystalline fibers cellulose content reduces, thereby has reduced the cost of lignocellulose alcohol production and papermaking; In addition, PtMAN6 albumen has special vessel cell positioning function, its gene promoter energy accuracy controlling gene expression in xylem vessel's cell.Completed on this basis the present invention.

Term

As used herein, term " polypeptide of the present invention ", " albumen of the present invention ", " PtMAN6 polypeptide ", " PtMAN6 albumen " or " hemicellulose seminose lytic enzyme " can Alternate.In a preference, refer to the polypeptide with aminoacid sequence shown in SEQ ID NO.:2 or SEQ ID NO.:17, or its active fragments, or derivative.

PtMAN6 polypeptide of the present invention preferably derives from plant, preferably derives from Salicaceae, Populus, Salix or Chosenia etc.

As used herein, term " gene of the present invention ", " PtMAN6 gene " can Alternates, all refer to the nucleotide sequence and the derived sequence thereof that derive from a kind of hemicellulose seminose lytic enzyme of encoding.In a preference of the present invention, described nucleotide sequence is as shown in SEQ ID NO.:1 or SEQ ID NO.:16.

PtMAN6 gene of the present invention preferably derives from plant, preferably derives from Salicaceae, Populus, Salix or Chosenia etc.

As used herein, term " separation " refers to that material separates (if natural substance, primal environment is natural surroundings) from its primal environment.As the polynucleotide under the native state in active somatic cell and polypeptide do not have separation and purification, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, for separation and purification.

PtMAN6 polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide.Polypeptide of the present invention can be the product of natural purifying, or the product of chemosynthesis, or uses recombinant technology for example, to produce from protokaryon or eucaryon host (, bacterium, yeast, higher plant, insect and mammalian cell).The host used according to the recombinant production scheme, polypeptide of the present invention can be glycosylated, can be maybe nonglycosylated.Polypeptide of the present invention also can comprise or not comprise initial methionine residues.

The present invention also comprises that having regulation and control xylem secondary cell wall synthesizes PtMAN6 protein fragments and the analogue of active with the fibrous biomass accumulation in function.As used herein, term " fragment " refers to and basically keeps biological function or the active many skins that natural PtMAN6 albumen of the present invention is identical with " analogue ".

Polypeptide fragment of the present invention, derivative or analogue can be: one or more conservative or substituted polypeptide of non-conservation amino-acid residue (preferably conservative amino acid residue) (i) are arranged, and the amino-acid residue of such replacement can be also can not encoded by genetic code; Or (ii) in one or more amino-acid residues, there is the polypeptide of substituted radical; Or (iii) mature polypeptide and another compound (for example, such as the compound that extends the polypeptide transformation period, polyoxyethylene glycol) merge formed polypeptide; Or (iv) additional aminoacid sequence is fused to this peptide sequence and the polypeptide that forms (as leader sequence or secretion sequence or be used for sequence or the proteinogen sequence of this polypeptide of purifying or fusion rotein).Belong to the known scope of those skilled in the art according to these fragments of definition, derivative and the analogue of this paper.

The present invention also comprises with PtMAN6 polypeptide of the present invention or albumen having 50% or above (preferably more than 60%, more than 70%, more than 80%, more preferably more than 90%, more preferably more than 95%, most preferably more than 98%, as 99%) polypeptide with same or similar function or the albumen of homology.Can pass through several in protein variant and (be generally 1-60, preferably 1-30, more preferably 1-20,1-10 best) replace, lack or add the derived sequence of at least one amino acid gained, and add one or several (being generally in 20 at C-terminal and/or N-terminal, being preferably in 10, is more preferably in 5) amino acid.For example, in described albumen, when close or similar amino acid is replaced by performance, usually can not change the function of protein, C-terminal and/or end add one or several amino acid and usually also can not change the function of protein.The variation of these conservative propertys is best is replaced and is produced according to table 1.

Table 1

The difference that the present invention includes PtMAN6 protein analogue and natural PtMAN6 albumen can be the difference on aminoacid sequence, can be also the difference do not affected on the modified forms of sequence, or have both at the same time.The analogue of these albumen comprises genetic variant natural or that induce.The induce variation body can obtain by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also can knownly divide biological technology by site-directed mutagenesis method or other.Analogue also comprises having the analogue that is different from the amino acid whose residue of natural L-(as D-amino acid), and the analogue with that exist or the synthetic amino acid (as β, gamma-amino acid) of non-natural.Should be understood that albumen of the present invention is not limited to the above-mentioned representational albumen exemplified.

(usually the not changing primary structure) form of modifying comprises: in body or the chemically derived form of external albumen as acetoxylation or carboxylated.Modify and also comprise glycosylation, as those carry out glycosylation modified in protein synthesis and processing.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) and completes by albumen is exposed to.Modified forms also comprises have the phosphorylated amino acid residue sequence of (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).

The present invention also provides the polynucleotide sequence of coding PtMAN6 polypeptide, albumen or its variant.Polynucleotide of the present invention can be DNA form or rna form.DNA form comprises: the DNA of DNA, genomic dna or synthetic, DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The polynucleotide of encoding mature polypeptide comprise: the encoding sequence of an encoding mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; The encoding sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.

Term " polynucleotide of coded polypeptide " can be the polynucleotide that comprise this polypeptide of encoding, and can be also the polynucleotide that also comprise additional code and/or non-coding sequence.The invention still further relates to the varient of above-mentioned polynucleotide, its coding has many glycosides of identical aminoacid sequence or fragment, analogue and the derivative of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural occurs.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from the function of the polypeptide that changes in fact its coding.

The invention still further relates to and above-mentioned sequence hybridization and two sequences between have at least 50%, preferably at least 70%, the polynucleotide of at least 80% homogeny more preferably.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide of the present invention.In the present invention, " stringent condition " refers to: (1) at the hybridization than under low ionic strength and comparatively high temps and wash-out, as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time is added with denaturing agent, as 50% (v/v) first phthalein amine, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between two sequences at least more than 90%, be more preferably 95% and just hybridize when above.

Should understand, although PtMAN6 gene of the present invention is preferably from willow, from (as having more than 80%, as 85% with willow PtMAN6 gene height homology of other plant, 90`%, 95%, even 98% sequence homogeny) within the scope that other gene is also considered in the present invention.The Method and kit for of aligned sequences homogeny is also that this area is known, for example BLAST.

PtMAN6 Nucleotide full length sequence of the present invention or its fragment can obtain by the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available DNA library or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence is longer, usually need to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplified is stitched together by proper order.Once obtain relevant sequence, just can obtain in large quantity relevant sequence with recombination method.Normally it is cloned into to carrier, then proceeds to cell, then by ordinary method, from the host cell propagation, separate and obtain relevant sequence.

In addition, also can synthesize relevant sequence, especially fragment length more in short-term by the method for synthetic.Usually, by first synthetic a plurality of small segments, and then connect and can obtain the fragment that sequence is very long.At present, can be fully by chemosynthesis, obtain the DNA sequence dna of code book invention albumen (or its fragment, or derivatives thereof).Then this DNA sequence dna can be introduced in various existing DNA moleculars as known in the art (or as carrier) and cell.In addition, also can will suddenly change and introduce in protein sequence of the present invention by chemosynthesis.

The present invention also provides recombinant vectors and the application thereof that comprises gene of the present invention.As a kind of preferred mode, the promotor downstream of recombinant vectors comprises multiple clone site or at least one restriction enzyme site.When needs are expressed the object of the invention gene, goal gene is connected in applicable multiple clone site or restriction enzyme site, thereby goal gene is operably connected with promotor.As another kind of optimal way, described recombinant vectors comprises (from 5 ' to 3 ' direction): promotor, goal gene, and terminator.If necessary, described recombinant vectors can also comprise the element that is selected from lower group: 3 ' polymerized nucleoside acidifying signal; The untranslated nucleotide sequence; Transhipment and target nucleotide sequence; Resistance selective marker (Tetrahydrofolate dehydrogenase, neomycin resistance, hygromycin resistance and green fluorescent protein etc.); Enhanser; Or operation.

Method for the preparation of recombinant vectors is well known to those of ordinary skill in the art.Expression vector can be bacterial plasmid, phage, yeast plasmid, vegetable cell virus, mammalian cell is viral or other carriers.In a word, as long as it can copy and stablize in host, any plasmid and carrier are all can be adopted.

Those of ordinary skills can use the method for knowing to build the expression vector that contains gene of the present invention.These methods comprise extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technology of body etc.While using gene constructed recombinant expression vector of the present invention, can before its transcription initiation Nucleotide, add any enhancement type, composing type, organizing specific type or inducible promoter.

Comprise gene of the present invention, expression cassette or carrier can be for transforming suitable host cell, so that host expresses protein.Host cell can be prokaryotic cell prokaryocyte, as intestinal bacteria, and streptomyces, Agrobacterium; Or the eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as vegetable cell.Persons skilled in the art are all known carrier and the host cell that How to choose is suitable.With the recombinant DNA transformed host cell, can carry out with routine techniques well known to those skilled in the art.When the host is prokaryotic organism (as intestinal bacteria), can use CaCl ₂method is processed, and also available electroporation carries out.When the host is eukaryote, can select following DNA transfection method: calcium phosphate precipitation, conventional mechanical method (as microinjection, electroporation, liposome packing etc.).Conversion of plant also can be used the methods such as Agrobacterium-mediated Transformation or via Particle Bombardment Transformation, such as Ye Panfa, rataria conversion method, bud infusion method etc.Can use ordinary method regeneration plant for the vegetable cell, tissue or the organ that transform, thereby obtain genetically modified plant.

Extracellular can be expressed or be secreted into to described polypeptide of the present invention in cell or on cytolemma.If necessary, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.The example of these methods comprises (but being not limited to): conventional renaturation processes, process the combination of (salt analysis method), centrifugal, the broken bacterium of infiltration, super processing, ultracentrifugation, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods with protein precipitant.

The invention provides the purposes of PtMAN6 polypeptide or its encoding sequence, described purposes is optionally from lower group:

Reduce the accumulation of synthesizing, reduce the crystalline fibers biomass of xylem secondary cell wall, the content of reduction xylogen (preferably reducing plant stem xylogen).

Described PtMAN6 polypeptide is selected from lower group: the polypeptide that (I) has aminoacid sequence shown in SEQ ID NO.:2 or SEQ ID NO.:17; (II) the derivative polypeptide by (1) aminoacid sequence as shown in SEQ ID NO.:2 or SEQ ID NO.:17 formed through replacement, disappearance or the interpolation of one or several amino-acid residue; Or (III) homology of aminoacid sequence >=90% shown in aminoacid sequence and SEQ ID NO.:2 or SEQ ID NO.:17 (preferably >=95%, the more preferably 98%) polypeptide derivative by (1).

The encoding sequence of described PtMAN6 polypeptide is selected from lower group: (i) coding has the polynucleotide of the polypeptide of aminoacid sequence shown in SEQ ID NO.:2 or SEQ ID NO.:17; (ii) polynucleotide of sequence as shown in SEQ ID NO.:1 or SEQ ID NO.:16; (iii) polynucleotide of the homology of sequence >=95% shown in nucleotide sequence and SEQ ID NO.:1 or SEQ IDNO.:16 (preferably >=98%, more preferably >=99%); (iv) 5 ' of polynucleotide end and/or 3 ' end brachymemma or add the polynucleotide of 1-60 (preferably 1-30, more preferably 1-10) Nucleotide as shown in SEQ ID NO.:1 or SEQ ID NO.:16; Or (v) and (i)-(iv) polynucleotide of arbitrary described polynucleotide complementation.

The present invention also provides a kind of method for preparing transgenic plant, comprises step: the encoding sequence of PtMAN6 polypeptide is imported in vegetable cell, cultivate described vegetable cell, the regeneration plant.

The present invention also provides a kind of method that improves plant trait, and described improvement plant trait is selected from lower group:

(1) secondary cell wall that reduces the plant xylem synthesizes; (2) reduce the accumulation of plant crystalline fibers biomass; (3) reduce the content of plant lignin; Described method comprises step: the expression or the activity that improve PtMAN6 polypeptide in described plant or its encoding sequence.

The present invention also provides the plant of a kind improvement, with wild-type plant, compares, and in described plant, the content of xylogen and/or crystalline cellulose descends more than 10%, preferably descends more than 20%, more preferably descends 50%, descends more than 100% best.

Described plant is Salicaceous Plants, is preferably willow.

As used herein, term " promotor of the present invention ", " promotor of xylem vessel's specifically expressing ", " promotor of the special location of xylem vessel " are used interchangeably, refer to derive from plant, preferably derive from Salicaceae, the promoter element of the PtMAN6 of Populus, Salix or Chosenia etc., a kind of typical promoter element sequence of the present invention is as shown in SEQ ID NO.:3.

As used herein, term " promotor " or " promoter region (territory) " refer to a kind of nucleotide sequence of accurate and effective initial gene functional transcription, the guiding gene nucleotide sequence is transcribed into mRNA, it is present in the upstream (5 ' end) of goal gene encoding sequence usually, usually, promotor or promoter region provide RNA polymerase and correct initial recognition site of transcribing necessary other factors.

The invention provides the specific expressed promotor of a kind of xylem vessel specifically expressing, described promotor derives from plant, preferably derives from the PtMAN6 gene of Salicaceae.A kind of nucleotide sequence of preferred promotor is as shown in SEQ ID NO.:3.

Promotor of the present invention can be efficient, single-mindedly at xylem vessel's cells, and in cambial cell without any expression, promotor of the present invention can be improved plant xylem vessel cell characteristics for specificity.

In this article, described promotor or promoter region (territory) comprise the variant of promotor, and promoter variants can, by inserting or delete the regulation and control zone, carry out random or rite-directed mutagenesis etc. and obtain.

The present invention also comprises with preferred promoter sequence of the present invention (SEQ ID NO.:3) having 50% or above (preferably more than 60%, more than 70%, more than 80%, more preferably more than 90%, more preferably more than 95%, most preferably more than 98%, as 99%) nucleic acid of homology, described nucleic acid also has the function that the specificity regulation and control start xylem vessel's cell expressing." homology " refers to the per-cent identical according to position, the similar level between two or more pieces nucleic acid (being sequence similarity or identity).

Should understand, although the PtMAN6 gene promoter that derives from Salicaceae is provided in example of the present invention, but derive from other similar plant (especially with willow, belonging to the plant of a section or genus), there is the promotor of certain homology (conservative property) with promotor of the present invention, those skilled in the art are also included within scope of the present invention, as long as can separate and obtain this promotor easily the information that provides according to the application after the application has been provided from other plant.

As used herein, term " specific expressed " refers to goal gene specific time and/or specific expression of organizing in plant.Described " expression of plant xylem vessel cell-specific " refers under promoter regulation of the present invention, goal gene high degree of specificity and in specific manner at plant xylem vessel cells.

As used herein, " external source " or " allos " refers to the two or more pieces nucleic acid of different sources or the relation between protein sequence.For example, if the combination of promotor and goal gene sequence is not naturally occurring usually, promotor is external source for this goal gene.Cell or the organism that particular sequence inserts for it is " external source ".

As used herein, " cis-regulating element " refers to the transcription initiation of gene and transcribes the conservative property base sequence that efficiency plays regulatory role.

Promotor of the present invention can operationally be connected with foreign gene, and this foreign gene can be external source (allos) for promotor.Foreign gene of the present invention (also referred to as goal gene) has no particular limits, and can have the gene of specific function albumen for RNAi gene or coding, and for example some has the albumen of key property or function in agricultural or plant improvement.

The representative example of described foreign gene includes, but is not limited to: resistant gene, selection markers gene, antigenic protein gene and biotechnological formulation gene or plant quality genes involved.

Described resistant gene is selected from lower group: anti-herbicide gene, antiviral gene, cold tolerance gene, high temperature resistant gene, anti-drought gene, waterlogging-resistant gene or anti insect gene.Described selection markers gene is selected from lower group: gus (β-glucuronidase) gene, hyg (Totomycin) gene, neo (Liu Suanyan NEOMYCIN SULPHATE) gene or gfp (green fluorescent protein) gene.Described antigenic protein gene and biotechnological formulation gene are selected from lower group: bacterium class antigen protein is (as cholera toxin B, tetanus toxin etc.), virus type antigen protein (as canine parvovirus), protozoa antigen protein (amoeba cause of disease LecA), autoantigen albumen (as the CTB-pins of type i diabetes) or biotechnological formulation (as α 2b Interferon, rabbit, rhIGF-1 etc.).Described plant quality genes involved is selected from lower group: amino acid improvement genes involved, fat improvement genes involved, starch improvement genes involved or male sterile genes involved.

The present invention also provides a kind of expression casette, and described expression cassette has following elements successively from 5 '-3 ': promotor, gene ORF sequence and terminator.Preferably, described promoter sequence as shown in SEQ ID NO.:3 or with the homology of sequence shown in SEQ ID NO.:1 >=95%, preferably >=98%, more preferably >=99%.

The present invention also provides a kind of recombinant vectors that comprises promotor of the present invention and/or expression casette.As a kind of preferred mode, the promotor downstream of recombinant vectors comprises multiple clone site or at least one restriction enzyme site.When needs are expressed goal gene, goal gene is connected in applicable multiple clone site or restriction enzyme site, thereby goal gene is operably connected with promotor.As another kind of optimal way, described recombinant vectors comprises (from 5 ' to 3 ' direction): promotor, goal gene, and terminator.If necessary, described recombinant vectors can also comprise the element that is selected from lower group: 3 ' polymerized nucleoside acidifying signal; The untranslated nucleotide sequence; Transhipment and target nucleotide sequence; Resistance selective marker (Tetrahydrofolate dehydrogenase, neomycin resistance, hygromycin resistance and green fluorescent protein etc.); Enhanser; Or operation.

Method for the preparation of recombinant vectors is well known to those of ordinary skill in the art.Expression vector can be bacterial plasmid, phage, yeast plasmid, vegetable cell virus, mammalian cell is viral or other carriers.In a word, as long as it can copy and stablize in host, any plasmid and carrier are all can be adopted.

Those of ordinary skills can use the method for knowing to build the expression vector that contains promotor of the present invention and/or goal gene sequence.These methods comprise extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technology of body etc.

Promotor of the present invention, expression cassette or carrier, can be for transforming suitable host cell, so that host expresses protein.Host cell can be prokaryotic cell prokaryocyte, as intestinal bacteria, and streptomyces, Agrobacterium: or the eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as vegetable cell.Persons skilled in the art are all known carrier and the host cell that How to choose is suitable.With the recombinant DNA transformed host cell, can carry out with routine techniques well known to those skilled in the art.When the host is prokaryotic organism (as intestinal bacteria), can use CaCl ₂method is processed, and also available electroporation carries out.When the host is eukaryote, can select following DNA transfection method: calcium phosphate precipitation, conventional mechanical method (as microinjection, electroporation, liposome packing etc.).Conversion of plant also can be used the methods such as Agrobacterium-mediated Transformation or via Particle Bombardment Transformation, such as Ye Panfa, rataria conversion method, bud infusion method etc.Can use ordinary method regeneration plant for the vegetable cell, tissue or the organ that transform, thereby obtain genetically modified plant.

As a kind of optimal way of the present invention, the method for preparing transgenic plant is: the carrier that will carry promotor and goal gene (both are operably connected) proceeds to Agrobacterium, and Agrobacterium will be incorporated on the karyomit(e) of plant containing the carrier segments of promotor and goal gene again.The transgene receptor plant related to is such as being Arabidopis thaliana, tobacco, fruit tree etc.

Major advantage of the present invention is:

(1) inventor to find that first the albumen of PtMAN6 gene in plant and coding thereof can reduce the secondary cell wall of xylem synthetic and reduce the accumulation of crystalline fibers biomass.

(2) promotor of PtMAN6 gene has special vessel cell positioning function, can the expression of accuracy controlling gene in xylem vessel's cell.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only are not used in and limit the scope of the invention for the present invention is described.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition as people such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.

Experiment material and method

1. vegetable material and growing environment

The willow gene clone is from comospore poplar (Populus trichocarpa), and expression vector all proceeds in commercially available southern woods 895 kinds, and poplar seedlings is cultivated glasshouse in the controlled environment chamber, 27 ℃ of natural lightings, and within 2 years, living sapling is transplanted farm natural climate plantation.

Arabidopis thaliana for conversion is Colombia's type, plants in 22 ℃ of phytotrons, and 12 hour photoperiod cultivated.

2. gene clone

The genome sequence of PtMAN6 from the JGI database download (US Department of Energy, Joint Genome Institute (JGI), http:// www.phytozome.net/poplar).

The xylem of growing from the comospore poplar by the CTAB method extracts RNA, and removes the DNA pollution with the DNase I of RNase-free.

Partial cDNA Sequence with primer 5 ' TGAATGGCTAATGGTGGCAAAGA 3 ' (SEQ ID NO.:4) and 5 ' TCAGGAGCCGATGGTCCATAAAA 3 ' (SEQ ID NO.:5) by the method clone PtMAN6 of RT-PCR, then use the method for 5 ' RACE clone 5 ' end of this gene (

kit, Invitrogen).With primer 5 ' CTGACTCAATACTATGGATACCC3 ' (SEQIDNO.:6) and the complete encoding sequence of 5 ' CTTCCTTTTCCTGTTGTGACCGA 3 ' (SEQ IDNO.:7) clone PtMAN6.

3. gene expression analysis

Gene expression analysis adopts the method for quantitative RT-PCR, the primer of the design gene specific specific gene fragment (100-300bp) of going to increase.The total RNA PrimerScript of 1 μ g ^tMreverse transcription test kit (Dalian is precious biological) reverse transcription becomes the first chain cDNA. quantitative PCR to adopt SYBR green method at MyiQ ^tMreal-Time PCR instrument (Bole, the U.S.) is upper to be detected.Using the PtActin gene in willow as reference gene.

4. antibody preparation

Sequence alignment by the PtMAN family gene, two little peptide sections have been selected in the non-conservative district of PtMAN6, (37 to 49 amino acids for EQFKTMVEEVDNH, SEQ ID NO.14) and ELNDVEEDEWL(61 position to 71 amino acids, SEQ ID NO.15), by synthetic, be injected in rabbit and produce polyclonal antibody (entrusting Ai Bimate company to complete).Antibody detects and can only detect single band in the xylem total protein through Western.Monoclonal antibody Anti-GFP and anti-Actin buy from Ai Bimate (Chinese Shanghai) company.

5. vector construction and Plant Transformation

5.135S:PtMAN6 and 35S:PtMAN6AS vector construction:

Following primer 5 ' CTT for the CDS sequence of total length PtMAN6 tCTAGAcTGACTCAATACTATGGATACCC3 ' (Xba I) (SEQ ID NO:10) and 5 ' CTG cTCGAGcCGATCAACTACTTTTACAAATC 3 ' (Xho I) (SEQ IDNO.:11) or:

5 ' CTT cTCGAGcTGACTCAATACTATGGATACCC 3 ' (Xho I) (SEQ IDNO.:12) and 5 ' CTG tCTAGAcCGATCAACTACTTTTACAAATC 3 ' (Xba I) (SEQ ID NO.:13) amplification, with corresponding enzyme cutting amplified fragments, by its subclone extremely in commercially available pBI121 carrier framework.

5.2 transient expression vector construction:

The CDS sequence of total length PtMAN6 or its front 31 aminoacid sequences are merged to EGFP on pA7 carrier and carrier by subclone.These two carriers are called after MAN6G or MAN6sG respectively.

5.335S:PtMAN6-GFP vector construction:

By the upper CaMV 35S promoter of MAN6G, PtMAN6-GFP and NOS terminator together subclone to pCAMBIA 2300 carriers.

5.4 Plant Transformation

Stably express, first be transformed into carrier GV3101 agrobacterium strains, preparation engineering bacterium.

Transformation of Arabidopsis thaliana adopts general agriculture bacillus mediated flower-dipping method.

Willow transforms and adopts general Ye Panfa.

6. the extraction of inscribe-Isosorbide-5-Nitrae in willow-'beta '-mannase and enzyme activity determination

Fresh Tissues of Poplar Clones is ground to form to fine powder fast with liquid nitrogen, then add the zymoprotein Extraction buffer of 1.5 times of volume precoolings to place on ice 1 hour, 4 ℃ of centrifugal 30min of 10000g, then supernatant filters by Miracloth, then concentrated and purified by the super filter tube of 10KD.The albumen of purifying BCA reagent quantitative.

Utilize colorimetry to carry out enzyme assay.Insoluble substrate A ZC L-galactomannan buys from Megazyme(Ireland), substrate 1%(w/v) is dissolved in citric acid-phosphoric acid buffer (pH3.0-8.0) or the 0.1M sodium-acetate buffer (pH 5.0) of 0.1M and makes suspension.Get the zymoprotein (or BSA contrast) that the above-mentioned substrate suspension of 100 μ l adds 20 μ g purifying, with corresponding buffer polishing to volume, be 200 μ l, then be placed in specific temperature of reaction reaction 2h, keep shaking during this time making reaction system even always, 100 ℃ of 5min termination reactions, the centrifugal 5min of 12000g, and the change of surveying absorbancy in 590nm, enzymic activity is with A590nmmg ^-1min ^-1mean, result is at least wanted independent the repetition three times.

7.PtMAN6 de-glycosylation

For Western, analyze, the PtMAN6 of purifying first, through 100 ℃ of sex change 10min, then adds Endo H according to specification sheets _f37 ℃ of processing 30min of enzyme (New England Biolabs) or 1h, sample, in 100 ℃ of inactivation 10min, is got 20 μ l and is carried out the SDS-PAGE detection.

Survey for the enzyme biopsy, directly add the Endo H of 6000 units from 60 μ g zymoproteins of overexpression PtMAN6 plant or the extraction of wild-type plant _f37 ℃ of processing 2h of enzyme, the albumen of getting 20 μ g processing carries out enzyme activity assay, each sample triplicate.

8. plant section analysis

Lignin deposition detects: 1 year growing poplar stem or petiole free-hand section, and then use 1% Phloroglucinol (being dissolved in 12% hydrochloric acid) to process 5min, then microscopic examination at once.

Xylogen autofluorescence and conduit area measurement: FAA(5% formaldehyde, 5% acetic acid, 70% ethanol) fixing stem section, paraffin embedding, after 10 μ m section dehydrations, direct ultraviolet is observed.With ImageJ software statistics conduit area, Student ' s t inspection statistics result.

9. the log in number of willow gene in NCBI of studying in the present invention is:

PtMAN6XM_002323644，PtrPAL(XM_002326150)，

PtrC4H1(EU603304)，Ptr4CL3(XM_002297663)，

PtrHCT1(EU603313)，PtrC3H1(XM_002308824)，

PtrCCoAOMT1(XM_002313089，EU603307)，

PtrCCR2/7(EU603310，XM_002303809)，

PtrCAld5H1(EU603312)，PtrCOMT2(XM_002317802,EU603317)，

PtrCAD1(EU603306)，PtrLAC17(XM_002317469)，

PtrCesA8(XM_002316779)，PtrGT43B(JF518935)，

PtrWND1A(HQ215847，XM_002317023)，

PtrWND1B(HQ215848)，PtrWND2A(HQ215849)，

PtrWND3A(XM_002322362)，PtrWND3B(XM_002318252)，

PtrWND4A(XM_002329829)，PtrWND5A(XM_002310261)，

PtrWND6A(XM_002327206)，PtrMYB3(XM_002299908)，

PtrMYB20(XM_002313267)，PtrMYB28(XM_002307154)，

Pt-IAA8(XM_002302315)，PtrXCP1(XM_002328102)，

PtrACT1(XM_002298674)。

The expressed sequence of embodiment 1PtMAN6 and the clone of promotor

1. sequence information

The CDS sequence that PtMAN6 is complete is as follows:

atggataccc acaagagggt atttgggttc aagatcattt tcttagtgtc cgtttttatt 60

cttcttaatg aaagttcaaa atgcagcagc tctggtgtta tggatgatga acaatttaaa 120

acaatggtgg aggaagtaga caatcatcta ccatcttcta gctcaagtca aggggtttat 180

gagttgaatg atgtggaaga agatgaatgg ctaatggtgg caaagaaagg aaaccagttt 240

gtgatcaatg accaaccttt ctatgtcaat ggatttaaca catactggct gatggtgttt 300

gctgctgatc aatctaccag aggaaaggtc actgaggttt tccaaaaagc atcctcagtt 360

ggtctatcag tttgcaggac ttgggctttt aatgatggtc aatggagagc tcttcaaaaa 420

tctccaggtg tttatgatga agatgttttc aaggccctgg attttgtggt cagtgaagca 480

aataagtaca agatcaggct catattatca ttggctaaca attgggatgc atatggtgga 540

aaagcacaat atgttaaatg gggaaaagct tctggcctta atttgacatc tgatgatgat 600

ttcttctctc atccaactct cagaagctac tacaaggctc atgtcaaggc ggtattgaat 660

agagtcaata cgatcacaaa cataacctac aaggatgacc ctacaatatt tgcttgggag 720

ctgatgaatg aacctcgatg cacctcagat ccctctggcg ataaactgca gtcatggata 780

acagacatgg cagtatatgt gaagagcatg gacgcaaagc acttagtaga gattggattg 840

gagggatttt atggaccatc ggctcctgat agggctcagt tcaatccaaa ctcgtatgct 900

acgcaagttg gaaccgactt tatcaggaac catcaggttc ttggtgttga ttttgcttct 960

gttcacatat atgcagactc ctggatttcg caaacaatta cggattctca tatccaattc 1020

accaagtcat ggatggaagc tcacatagag gatgctgaga aatatctggg aatgccggtt 1080

gtgttcgctg agtttggtgt atcttcaaaa gatcctggat acaactcatc attccgcgac 1140

acactaatta acacagtgta caagaccctc ttgaactcaa ccaagagagg tgggagtgga 1200

gctgggagcc ttctgtggca gcttttccct gacgggacag actacatgga tgatggatat 1260

gcaattgttc tatcaaaatc tccttccaca acaaacatca tttccctcca ttcaacacga 1320

gtcgcaatcg tcaattccat gtgttcatgg aaatgcaaat ggggctgcaa gaagaggaat 1380

cctttagagg cattcctcta ccatgatgat ttgtaa 1416

（SEQ ID NO.:1）

Or

atggataccc acaagagggt atttgggttc aagatcattt tcttagtgtc cgtttttatt 60

cttcttaatg aaagttcaaa atgcagcagc tctggtgtta tggatgatga acaatttaaa 120

acaatggtgg aggaagtaga caatcatcta ccatcttcta gctcaagtca aggggtttat 180

gagttgaatg atgtggaaga agatgaatgg ctaatggtgg caaagaaagg aaaccagttt 240

gtgatcaatg accaaccttt ctatgtcaat ggatttaaca catactggct gatggtgttt 300

gctgctgatc aatctaccag aggaaaggtc actgaggttt tccaaaaagc atcctcagtt 360

ggtctatcag tttgcaggac ttgggctttt aatgatggtc aatggagagc tcttcaaaaa 420

tctccaggtg tttatgatga agatgttttc aaggccctgg attttgtggt cagtgaagca 480

aataagtaca agatcaggct catattatca ttggctaaca attgggatgc atatggtgga 540

aaagcacaat atgttaaatg gggaaaagct tctggcctta atttgacatc tgatgatgat 600

ttcttctctc atccaactct cagaagctac tacaaggctc atgcggtatt gaatagagtc 660

aatacgatca caaacataac ctacaaggat gaccctacaa tatttgcttg ggagctgatg 720

aatgaacctc gatgcacctc agatccctct ggcgataaac tgcagtcatg gataacagac 780

atggcagtat atgtgaagag catggacgca aagcacttag tagagattgg attggaggga 840

ttttatggac catcggctcc tgatagggct cagttcaatc caaactcgta tgctacgcaa 900

gttggaaccg actttatcag gaaccatcag gttcttggtg ttgattttgc ttctgttcac 960

atatatgcag actcctggat ttcgcaaaca attacggatt ctcatatcca attcaccaag 1020

tcatggatgg aagctcacat agaggatgct gagaaatatc tgggaatgcc ggttgtgttc 1080

gctgagtttg gtgtatcttc aaaagatcct ggatacaact catcattccg cgacacacta 1140

attaacacag tgtacaagac cctcttgaac tcaaccaaga gaggtgggag tggagctggg 1200

agccttctgt ggcagctttt ccctgacggg acagactaca tggatgatgg atatgcaatt 1260

gttctatcaa aatctccttc cacaacaaac atcatttccc tccattcaac acgagtcgca 1320

atcgtcaatt ccatgtgttc atggaaatgc aaatggggct gcaagaagag gaatccttta 1380

gaggcattcc tctaccatga tgatttgtaa 1410

（SEQ ID NO.:16）

The aminoacid sequence of PtMAN6 albumen is as follows:

MDTHKRVFGF KIIFLVSVFI LLNESSKCSS SGVMDDEQFK TMVEEVDNHL PSSSSSQGVY 60

ELNDVEEDEW LMVAKKGNQF VINDQPFYVN GFNTYWLMVF AADQSTRGKV TEVFQKASSV 120

GLSVCRTWAF NDGQWRALQK SPGVYDEDVF KALDFVVSEA NKYKIRLILS LANNWDAYGG 180

KAQYVKWGKA SGLNLTSDDD FFSHPTLRSY YKAHVKAVLN RVNTITNITY KDDPTIFAWE 240

LMNEPRCTSD PSGDKLQSWI TDMAVYVKSM DAKHLVEIGL EGFYGPSAPD RAQFNPNSYA 300

TQVGTDFIRN HQVLGVDFAS VHIYADSWIS QTITDSHIQF TKSWMEAHIE DAEKYLGMPV 360

VFAEFGVSSK DPGYNSSFRD TLINTVYKTL LNSTKRGGSG AGSLLWQLFP DGTDYMDDGY 420

AIVLSKSPST TNIISLHSTR VAIVNSMCSW KCKWGCKKRN PLEAFLYHDD L 471

（SEQ ID NO.:2）

Or

MDTHKRVFGF KIIFLVSVFI LLNESSKCSS SGVMDDEQFK TMVEEVDNHL PSSSSSQGVY 60

ELNDVEEDEW LMVAKKGNQF VINDQPFYVN GFNTYWLMVF AADQSTRGKV TEVFQKASSV 120

GLSVCRTWAF NDGQWRALQK SPGVYDEDVF KALDFVVSEA NKYKIRLILS LANNWDAYGG 180

KAQYVKWGKA SGLNLTSDDD FFSHPTLRSY YKAHAVLNRV NTITNITYKD DPTIFAWELM 240

NEPRCTSDPS GDKLQSWITD MAVYVKSMDA KHLVEIGLEG FYGPSAPDRA QFNPNSYATQ 300

VGTDFIRNHQ VLGVDFASVH IYADSWISQT ITDSHIQFTK SWMEAHIEDA EKYLGMPVVF 360

AEFGVSSKDP GYNSSFRDTL INTVYKTLLN STKRGGSGAG SLLWQLFPDG TDYMDDGYAI 420

VLSKSPSTTN IISLHSTRVA IVNSMCSWKC KWGCKKRNPL EAFLYHDDL 469

（SEQ ID NO.:17）

Clone's PtMAN6 promoter sequence is as follows:

tgaggaccga aatgagagaa aaaaacatat gagcgaaaac ccttggtcaa tagttctgaa 60

ttttgttgat cttgaggata aaagtgtatt tttactgtcc aaataatttg aaaaagacta 120

atataccccc aaataatttt ttaatgacca ataaacatct tgaaaagacc aaactaccct 180

tatcataaag ccttctatta taaaattata atcttattat agcaatccac agtcaattat 240

aactagtgtt acaatgaaaa accctctccc tagtccctat atttcatgtt aattgatatt 300

gttaataatt ggcagaacac aggtgcgcac gagtcttaat aataaatctc attcaaggtt 360

tgggtaattg ttttattagg tcaactttaa aattatattg ttttttattt aaaaattact 420

caaccatgtg tcacttggat ttgactccat caactagtca atgggatttg attaaaacaa 480

ccttcaagaa tggcagtagc ctctctaaca acaggggtgc aataattcga taaaaacaag 540

aaaaacaaga aaaatcctga acttttgggt gacaattcta gcaaggccca gatagaaata 600

gaaaaatacc agagccatgc aagatgagtg cttcataatg ggccaacaaa aatagttcta 660

aaaaaaaaaa actgggctaa gatacaacat tttgcatggt agactttttt ttttttcatt 720

ataaaaaaac aagggatcga aatctaagct tctgatggct gaattcagct catatcttcc 780

ctgaaaattt tgaatttcaa gtttgattaa tccaatgtta ggtttttgat tcaataaaaa 840

caaagcaaaa tgatgcaaaa atataaactc tcgaagccat accaggatac ataatgatat 900

caaatacgtt gttatgatta aagcaggacc tcagattcct tgggagctac cttttgctac 960

ttcaaagtta aagatagttt tttccagttg aatttcaagt ttgattaatc caatgttaat 1020

gggaactttg agactgcaac agagcacaga tatgttaatt tgacccaaaa acaggacaga 1080

aacaaaaagc atatgatagt tgataaatca gacaggttat gtgtttggac aatcaaaggt 1140

tgccaggcta cttaacagga ttttttctag gtctgccata tatatatgaa acattcaagt 1200

taagcttgca acagatcagc ttagttctgc tcacctgctt accagctcca atatacttct 1260

tcaatctcct actctccaga ttgctttttg cagagaaatg gcatgcatcg atttcgtctt 1320

tctttccatg gatttatttc ttccgtgttt gtctatgtat atgtgtgtgt agagaccaat 1380

ctagtttgtt ggttttagga catgtcaaca tgttcttcaa gaaagatgca gtgaccttga 1440

agtaatgtca gtgtcatctg aactacaagt tatctaggtt taaaagggtc tcattttctt 1500

gtaggaccct taaaacttac cttaggagtc atacctgaag ccttgtttaa gtatgcaact 1560

agacctaggt ctgtagcttt tgcttgtgta tatccatcta tgtatctgtg tttggaagaa 1620

aagaaaatgg cagagaaagt ataagaattg aaattttctt ggatttaaag ccatggtgta 1680

gatcccctct tcaacactct tcttgcatat cacagtttct gctacagcct tagatggcca 1740

tgcatataaa tatggggggt ccagtgaaga ggggtgtgca acccttggtt tgctgactca 1800

at 1802

（SEQ ID NO.:3）

2. vector construction

2.1 Overexpression vector

Fig. 1 is shown in by 35S:PtMAN6 carrier collection of illustrative plates; 35S:PtMAN6-GFP carrier collection of illustrative plates Fig. 2.

2.2 antisense expression vector

Fig. 3 is shown in by the 35S:PtMAN6AS collection of illustrative plates.

2.3 transient expression carrier

MAN6G transient expression carrier is shown in Fig. 4, and MAN6sG transient expression carrier is shown in Fig. 5.

Embodiment 2 crosses expression PtMAN6, and the content of wood lignin and crystalline cellulose is reduced

Western detects proves that PtMAN6 crosses expression (OE) carrier and antisense (AS) expression vector successfully proceeds to willow, and can express in plant materials, and (Fig. 6 A) further plays a role.

Transfer-gen plant the analysis showed that, with respect to the wild-type plant, and OE plant petiole and cane deliquescing (Fig. 6 B, 6C and 6D), the AS plant is contrary (Fig. 6 B, 6C and 6E), illustrate that PtMAN6 participates in the physical strength of cane.Further slice analysis shows, in OE plant petiole, the content of xylogen reduces (Fig. 6 F-H).In same stem, lignin deposition also reduces (Fig. 7 A-I).The xylogen of autumn wood and crystalline cellulose assay further prove the PtMAN6 function, cross and express this gene, cause xylogen and crystalline fibers cellulose content reduction (Fig. 7 J, 7K) in timber.

The biomass of embodiment 3 transgenic poplars obviously do not change

The present embodiment has been measured the biomass of willow, and result shows, with respect to wild-type, the height of 1.5 years living transgenic poplar timber and girth all do not have noticeable change (Fig. 8).

Fig. 8 shows height and the girth analytical results of 1.5 years living transgenic poplar timber, and wherein, Fig. 8 A shows overexpression PtMAN6 willow (OE), and the willow of antisense expression PtMAN6 (AS) does not have notable difference with the trunk height of wild-type (WT) willow; Fig. 8 B shows that the girth of the butt of OE, AS and WT willow does not have notable difference, and statistical analysis adopts the T check.

Embodiment 4 transgenic plant timber monosaccharide components change

The present embodiment has been measured the component of various monose in the poplar wood, and result shows, in transgenic plant, the timber monosaccharide component has very large change.Compare with wild-type plant (WT), cross the monosaccharide component of secondary cell wall enrichment in Poplar Cultivars (PtMAN6OE) timber of expressing PtMAN6-GFP, as wood sugar and mannose content reduction, and corresponding primary cell wall enrichment contents of monosaccharides raises; The trend that in antisense expression Poplar Cultivars (PtMAN6AS), monosaccharide component changes is contrary with PtMAN6OE strain timber, and concrete outcome is in Table 1.

Monosaccharide component is measured by GC – MS, and unit is μ gmg ^-1aIR.In table, PtMAN6OE and PtMAN6AS meaned respectively to express the transgenic poplar of PtiMAN6-GFP and PtiMAN6 antisense vector.Statistical analysis adopts the T check, ^*represent p<0.05, ^*represent p<0.01 (n=4).

Willow enrichment hemicellulase β-Isosorbide-5-Nitrae of embodiment 5 overexpression PtMAN6-inscribe mannase

The present embodiment has been measured the β-1 in the willow plant, 4-inscribe mannosans enzymic activity, result shows, compare with wild-type, cross in the expression plant at PtMAN6, a large amount of enrichments β-1,4-inscribe mannase (Fig. 9), this enzyme optimal reaction pH value is 5.0, and optimal reactive temperature is 50 ℃, and glycosylation is most important to the hydrolytic activity that maintains PtMAN6.

Fig. 9 has shown the enzyme activity assay of PtMAN6.Wherein, the optimal pH measurement result that Fig. 9 A is PtMAN6, substrate is the 1%AZCL-glactomannan suspension that is dissolved in 0.1M citric acid-phosphoric acid buffer that the pH scope is 3.0-8.0, and WT and PtMAN6 refer to respectively from wild-type and cross and express the zymoprotein (lower same) extracted the plant mature leaf; Fig. 9 B shows the optimal reactive temperature measurement result of PtMAN6, and substrate is the 1%AZCL-glactomannan suspension that is dissolved in 0.1M citric acid-phosphoric acid buffer of pH5.0; Fig. 9 C shows PtMAN6 de-glycosylation result, PtMAN6(the first swimming lane extracted in Werstern hybridization analysis plant), and Endo H _fprocess the PtMAN6 of 0.5 hour (the second swimming lane) and 1 hour (the 3rd swimming lane), M: the protein label dyed in advance; Fig. 9 D is that glycosylation affects the enzymic activity result, with contrasting (control), compares, and PtMAN6 is through Endo H _fde-glycosylation 2 hours, enzyme work is reduced to original 50%.

Embodiment 6PtMAN6 gene can be used as xylem vessel's cell marking gene

The present embodiment expression of the methods analyst PtMAN6 gene of quantitative RT-PCR at different sites, find that the PtMAN6 predominant expression is in xylem (Figure 10).Further immunohistochemical analysis, find the special immature xylem vessel of the willow cell that is positioned of PtMAN6.At cambial cell, signal for locating (Figure 11) all can not be detected in xylem fibrocyte and parenchyma cell.Therefore this gene can be used as the marker gene of xylem vessel's cell.

Figure 10 shows the quantitative PCR analysis result of PtMAN6 gene in willow.Respectively from the xylem of 1 year growing poplar, phloem, spire, Lao Ye and stem top tissue extraction RNA carry out the quantitative RT-PCR analysis, using in willow the Actin gene as internal reference.Figure 11 shows the immunolocalization analytical results of PtMAN6.Wherein, the sectional view that Figure 11 A and Figure 11 B are 1 year living wild-type willow the 6th internode, show that PtMAN6 is positioned xylem vessel's cell; Figure 11 B is the enlarged view at black surround position in Figure 11 A; The rip cutting figure that Figure 11 C is 1 year living wild-type willow the 6th internode, show that PtMAN6 is positioned xylem vessel's cell; The sectional view that Figure 11 D and Figure 11 E are 1 year living wild-type willow stem top tissue, show that PtMAN6 is positioned xylem vessel's cell; Figure 11 E is the enlarged view at black surround position in Figure 11 D; The negative contrast of Figure 11 F, the sectional view of 1 year living wild-type willow the 6th internode, fail to detect any signal for locating.

The location of embodiment 7PtMAN6-GFP albumen

The present embodiment is by transient expression PtMAN6-GFP in stably express in Arabidopis thaliana and onion epidermis cell, and result all shows that the PtMAN6 protein localization is in plasma membrane, and the contrast that only turns GFP shows that the GFP signal spreads all over whole cell, comprises nucleus and kytoplasm.

Figure 12 shows that the PtMAN6-GFP protein localization is in plasma membrane.Figure 12 A and Figure 12 B show stably express PtMAN6-GFP albumen in the Arabidopis thaliana root, and this protein localization is in plasma membrane; Figure 12 C and Figure 12 D, 30% sucrose plasmolysis Arabidopis thaliana root cells, show that the PtMAN6-GFP protein localization is in plasma membrane; Figure 12 E is the carrier for transient expression; The Werstern that Figure 12 F is subcellular components detects, and M is for indicating protein molecular, and 1 is the kytoplasm component, and 2 is membrane component; Particle bombardment MAN6G carrier in transient expression Figure 12 E in onion epidermis cell for Figure 12 G and Figure 12 H; Figure 12 I and Figure 12 J show with particle bombardment MAN6sG carrier in transient expression Figure 12 E in onion epidermis cell; Particle bombardment carrier of CK in transient expression Figure 12 E in onion epidermis cell for Figure 12 K and Figure 12 L; A, C, G, I, K is GFP fluorescence picture; B, D, H, J, L is the light field picture, scale is 50 μ m.

Embodiment 8PtMAN6 negative regulation timber forms the expression of genes involved

The quantitative RT-PCR detected result shows, in PtMAN6 overexpression plant, form relevant PtrWND(PtrWNDA-PtrWND6A to timber) and some myb transcription factors (PtrMYB3,20,28) all lower (Figure 13), the biosynthetic pathway of lignin gene synthetic relevant to secondary wall, the expression of Mierocrystalline cellulose synthetic gene (CesA8) and xylan synthetic gene (GT43B) is decline (Figure 14) to some extent equally all.Thereby PtMAN6 has affected the thickening of normal cell walls by these genes of negative regulation, further affected Wood Properties Within.

Figure 13 has shown relative expression's level of secondary wall formation associated transcription factor in the plant of overexpression PtMAN6.RNA extracts from 1 year growing poplar xylem, and the expression of wild-type is defined as 1, and willow Actin gene is as internal reference.

Figure 14 has shown in the plant of overexpression PtMAN6 and has changed with the expression of secondary cell wall composition synthesis related gene.Figure 15 A shows that in the plant of overexpression PtMAN6, the gene of lignin monomer route of synthesis and lignin polymerization's genes involved are suppressed; Figure 15 B shows that in the plant of overexpression PtMAN6, the expression of the Mierocrystalline cellulose synthetic gene CesA8 that secondary wall is relevant is suppressed; Figure 15 C shows that in the plant of overexpression PtMAN6, the expression of the xylan synthetic gene GT43B that secondary wall is relevant is suppressed.RNA extracts from 1 year growing poplar xylem, and the expression of wild-type is defined as 1, and willow Actin gene is as internal reference.

All documents of mentioning in the present invention are all quoted as a reference in this application, just as each piece of document quoted separately as a reference.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.

Claims (10)

1. the encoding sequence of a PtMAN6 polypeptide or PtMAN6 polypeptide, is characterized in that, the aminoacid sequence of described PtMAN6 polypeptide is as shown in SEQ ID NO.:2, or the encoding sequence of described PtMAN6 polypeptide is as shown in SEQ ID NO.:1.

2.PtMAN6 the purposes of polypeptide or PtMAN6 polypeptid coding sequence, is characterized in that, described purposes is optionally from one or more of lower group:

(1) reduce the synthetic of xylem secondary cell wall;

(2) reduce the accumulation of crystalline fibers biomass;

(3) reduce the content of xylogen (preferably reducing plant stem xylogen);

Preferably, described PtMAN6 polypeptide is selected from lower group:

(I) there is the polypeptide of aminoacid sequence shown in SEQ ID NO.:2 or SEQ ID NO.:17;

(II) the derivative polypeptide by (1) aminoacid sequence shown in SEQ ID NO.:2 or SEQ ID NO.:17 formed through replacement, disappearance or the interpolation of one or several amino-acid residue; Or

(III) homology of aminoacid sequence >=90% shown in aminoacid sequence and SEQ ID NO.:2 or SEQ ID NO.:17 (preferably >=95%, the more preferably 98%) polypeptide derivative by (1);

Preferably, described PtMAN6 polypeptid coding sequence is selected from lower group:

(i) coding has the polynucleotide of the polypeptide of aminoacid sequence shown in SEQ ID NO.:2 or SEQ ID NO.:17;

(ii) polynucleotide of sequence as shown in SEQ ID NO.:1 or SEQ ID NO.:16;

(iii) polynucleotide of the homology of sequence >=95% (preferably >=98%, more preferably >=99%) shown in nucleotide sequence and SEQ ID NO.:1 or SEQ ID NO.:16;

(iv) 5 ' of polynucleotide end and/or 3 ' end brachymemma or add the polynucleotide of 1-60 (preferably 1-30, more preferably 1-10) Nucleotide as shown in SEQ ID NO.:1 or SEQ ID NO.:16; Or

(v) with (i)-(iv) polynucleotide of arbitrary described polynucleotide complementation.

3. a method that improves plant trait, wherein, described improvement plant trait is selected from lower group:

(1) secondary cell wall that reduces the plant xylem synthesizes;

(2) reduce the accumulation of plant crystalline fibers biomass;

(3) reduce the content of plant lignin (preferably reducing plant stem xylogen);

It is characterized in that, comprise step: the expression or the activity that improve PtMAN6 polypeptide in described plant or its encoding sequence;

Preferably, described method comprises step: the encoding sequence of PtMAN6 polypeptide is imported in vegetable cell, cultivate described vegetable cell, the regeneration plant.

4. a promoter element, is characterized in that, described promoter element is the promotor of plant PtMAN6 gene, and described promoter element has the function that plant xylem vessel cell-specific starts;

Preferably, described promoter element does not have the function of the special startup of plant xylem cambial cell;

Preferably, described promoter element is selected from lower group:

(a) there are the polynucleotide of sequence as shown in SEQ ID NO.:3;

(b) homology of sequence shown in nucleotide sequence and SEQ ID NO.:3 >=95% (preferably >=98%, more preferably >=99%), and there are the polynucleotide of plant xylem vessel cell-specific start-up performance;

(c) brachymemma 1-60,5 ' of polynucleotide end and/or 3 ' end (preferably 1-30, more preferably 1-6) Nucleotide as shown in SEQ ID NO.:3, and there are the polynucleotide of plant xylem vessel cell-specific start-up performance.

5. a construction, is characterized in that, the promoter element claimed in claim 4 that described construction contains foreign gene and is operatively connected with foreign gene;

Preferably, described foreign gene is selected from lower group:

Resistant gene, selection markers gene, antigenic protein gene, RNAi gene, microRNA gene, biotechnological formulation gene or plant quality genes involved.

6. an expression cassette, is characterized in that, described expression cassette from 5 ' to 3 ' has following element successively: promoter element claimed in claim 4, gene ORF sequence and terminator.

7. a carrier, is characterized in that, described carrier contains promoter element claimed in claim 4 or expression cassette claimed in claim 6.

8. a host cell, is characterized in that, described host cell contains carrier claimed in claim 7 or its chromosomal integration the promoter element claimed in claim 4 of external source or its chromosomal integration described expression cassette of requirement 6 of having the right.

9. the purposes of promoter element claimed in claim 4, construction claimed in claim 5 or expression cassette claimed in claim 6, is characterized in that, the expression for specificity regulation and control foreign gene at plant xylem vessel cell.

10. the method at plant xylem vessel cell specific expression foreign gene, is characterized in that, comprises step:

(a) provide a construction, the promoter element claimed in claim 4 that described construction contains foreign gene and is operably connected with this foreign gene;

(b) construction in step (a) is imported to plant xylem vessel cell, obtain the xylem vessel's cell transformed.

Images