CN103436498A - Porcine circovirus type II strain - Google Patents

Abstract

The present invention discloses a porcine circovirus type II strain, wherein the latin name is Circoviridae, and the preservation number is CCTCC NO:V201312. According to the invention, in vitro PCV2 culture proliferation conditions are optimized, and a PK15 cell clone strain with high PCV2 sensitivity and named L8 is screened so as to establish a foundation for further PCV2 researches.

Description

A kind of pig gyrate virus II type strain

Technical field

The present invention relates to a kind of pig gyrate virus II type strain.

Background technology

1974, investigator of Germany from porcine kidney cell line PK15 (ATCC-CCL33) find one new, there is no pathogenic small ribonucleotide virus sample pollutent.Report that subsequently this pollutent is an icosahedron, there is no cyst membrane, the genomic virus of sub-thread cyclic DNA is arranged, be known minimum can carry out the virus of self-replacation in mammalian cell, and then, called after pig circular ring virus (PCV).Its main infection Monocytes/Macrophages is cell, and wherein porcine alveolar macrophage is its main target cell.The PCV antibody serum that carries out pig in Germany, Canada, Great Britain and Northern Ireland is subsequently learned investigation, and result shows PCV ubiquity in swinery.With large pig of 9 monthly ages of PCV experimental infection, clinical disease does not occur in result, therefore thinks that virus does not have pathogenic.

In the latter stage nineties, from the swinery that suffers from becoming thin property disease of Canada West, isolate for the first time the virus of similar PCV sample with it.Shortly after that at northern US and Europe, also isolate similar Canadian virus strain.All demonstrate different at immunogenicity and genetics and PCV of these strains with monoclonal antibody, many anti-, gene sequencing.Therefore propose, the PCV that sick pig separates is PCV2, and the PCV that PK15 separates before is PCV1.Although the PCV1 no pathogenicity, extensively be present in pig body and pig cell lines; PCV2 has pathogenic, can cause the various diseases of pig.A series of disease syndromess of PCV2 and pig are relevant, and scientific terminology claims circovirus disease (PCVD).Reported first in 1996 syndromes of becoming thin is the pig of Canada West, within 1991, isolates PCV2 for the first time in the SPF of health swinery.The author proposes this noun of PMWS and describes its clinical symptom.The damage location of infected pigs detects a large amount of PCV2 Nucleotide and antigen, can isolate PCV2.In California, the interstitial pneumonia of the pig in 6 week age and lymphadenopathy can detect the PCV2 genome, also isolate a strain PCV2 virus.1996-1997, the disease of becoming thin that PCV2 is relevant is at France and Spain's report.Hereafter, in the world, all countries of raising pigs fall over each other report to the PMWS that PCV2 is relevant.Detect a large amount of PCV2 antigen from the lesion tissue sample of Spain, Britain and Japanese PMWS pig preservation in 1989 in 1986.In addition, from a retrospective assessment, find the evidence that just had PCV2 to infect as far back as 1969 in swinery.Therefore, not talkative PMWS is a kind of new disease, can not say that PCV2 is a new virus.The disease-related that PCV2 and another one enlarge rapidly swinery, the scorching nephrotic syndrome (PDNS) of pigskin, reached the epizootic disease ratio at some national PDNS.Although epidemiology shows that PMWS and PDNS may be associated, whether PDNS infects has direct relation still to need proof with PCV2.PCV2 is a cause of disease of pig breeding dysfunction, can in the myocarditic heart tissue of neonatal pig, detect a large amount of PCV2.PCV2 antigen detects in a large number in the lung tissue of hyperplasia necrotizing pneumonia (PNP) pig, also can in sow is miscarried the sow tissue of death syndrome (SAMS), detect PCV2.PCV2 is also an inducement of porcine respiratory disease syndromes.

In PCVAD, it is maximum that PMWS endangers, and it mainly betides the weanling pig in 5 ~ 16 weeks age, is a kind of immunosuppressive disease that progressive emaciation and multisystem pathology damage be principal character of take, and easy and other cause of disease is concurrent or secondary infection.PCVD brings the loss of 600,000,000 Euros every year to European Union according to estimates.Direct losses come from the death of child care pig and growing and fattening pigs, superseded pig.Indirect loss comes from the microbiotic dropped into for the control secondary infection and the pig farm overhead charges that drop into for reducing the PMWS impact.

At present, the disease caused for PCV2 is the effective preventive measures of neither one also, but preferred option is still to the pig vaccination.On vaccine development, running into maximum difficulty is exactly the low problem of PCV2 virus multiplication titre.A little less than virus vitro culture multiplication capacity, be difficult to meet the production of vaccine requirement.In addition, the vaccine immunity effect evaluation standard that neither one is fixing, strong virus infection animal model reaction result differs.

Summary of the invention

The purpose of this invention is to provide a kind of pig gyrate virus II type strain, Classification And Nomenclature: pig gyrate virus II type, Latin name: Circoviridae, depositary institution: Chinese Typical Representative culture collection center, depositary institution is called for short: CCTCC, depositary institution address: No. 16, Wuchang District Luo Ka hill path, Wuhan City, Hubei Province Wuhan University, preservation date: on May 28th, 2013, deposit number CCTCC NO:V201312.

Technical scheme of the present invention is: a kind of pig gyrate virus II type strain, pig gyrate virus II type (Circoviridae), CCTCC NO:V201312.

The invention has the beneficial effects as follows: this test is optimized and filters out the PK15 cell clone of the strain called after L8 higher to PCV2 susceptibility to PCV2 vitro culture proliferation conditions, for PCV2 further studies and lays a good foundation.

The accompanying drawing explanation

Fig. 1 is the pcr amplification result of organizing PCV2 in pathological material of disease, M. DNA Marker DL 2000; 1-2. the PCV2 pcr amplification product in pathological material of disease; 3. negative control;

Fig. 2 is the complete genomic PCR product of cell toxicant PCV2, M. DNA Marker DL 2000; 1-2. the pcr amplification product of PCV2 in cell toxicant; 3. negative control;

Fig. 3 is that PCV2 strain the genomic sequence compares, represent respectively AY556476, AY556477, AY578327, DQ910866, DQ915587, DQ923524, EF210106, EF565364, EF592576, EU148504, EU386606, EU408780, EU547458, EU747085, EU921257, FJ804417, FJ870972, FJ905470, FN687856, GU049340, GU247992, HM038028, HM038032, HM776453, HQ378161, EU780074, JQ692110, AF055392, AF055394, EU148503, HZ09.▲ expression laboratory strain isolated; ★ means 2a, 2b, 2c reference sequences;

The systematic evolution tree that Fig. 4 is PCV2 strain isolated genome nucleotide sequence, ▲ expression laboratory strain isolated;

Fig. 5 is that the virus PCR that goes down to posterity detects, M. DNA Marker DL 2000; 1-6. represent respectively the PCV2 Isosorbide-5-Nitrae, 8,12,16,20 generations; 7. negative control;

Fig. 6 is serial dilution method schematic diagram;

Fig. 7 is that L8 cell PCV1 detects, M. DNA Marker DL 2000; 1. PCV1 PCR product; 2.L8 cell; 3. negative control.

Embodiment

A kind of pig gyrate virus II type strain, pig gyrate virus II type (Circoviridae), CCTCC NO:V201312.

Isolation identification and the complete genome sequencing of one pig gyrate virus II type PCV2/HZ09 strain

1 materials and methods

1.1 test materials

Pick up from the tissues such as lymphoglandula, lungs and spleen of multisystemic exhaustion syndrome pig after the doubtful wean in pig farm, Zhengzhou in August, 2009.Aq archaeal dna polymerase, DL2000 DNA Marker, pMD18-T carrier, X-gal (the chloro-3-indoles-β of the bromo-4-of 5--D galactoside) and IPTG (sec.-propyl-β-D-sulfo-semi-lactosi) etc. are purchased from precious biotechnology (Dalian) company limited; Glue reclaims test kit and is purchased from BioTeke company; RPMI Medium 1640, new-born calf serum are purchased from Suo Laibao company; Anti-pig IgG-the FITC of rabbit, D-Glucosamine are purchased from Sigma company; The anti-PCV2 antiserum(antisera) of specificity is purchased from VMRD company.

1.2 design of primers

Primer P1/P2 reference (Kim et al., 2003) (table 1).Primer P3/P4, according to PCV1, PCV2 nucleotide sequence in GenBank, utilizes the Olig06.0 design.The PCR that primer P1/P2 and P3/P4 are respectively used to PCV2 detects and complete genomic amplification.Primer is synthetic by Shanghai biotechnology Services Co., Ltd.

Table 1 PCV2 detects primer and full gene amplification primer

1.3 pathological material of disease is processed

The tissues such as lymphoglandula, lungs and spleen that gather are mixed, after under aseptic condition, tissue being shredded, grind the suspension of making 1:5 (W/V) with aseptic PBS liquid, multigelation 3 times, centrifugal 30 min of 4000 r/min, get supernatant and cross 0.22 μ m filter degerming, add penicillin 1000 U/mL, Streptomycin sulphate 1000 μ g/mL, 4 ℃ of effect 6 h ,-20 ℃ save backup.

1.4 the detection of pathological material of disease PCV2

Get centrifugal 10 min of pathological material of disease 8000 rpm of freeze thawing, get supernatant liquor 200 μ L, phenol chloroform extraction method routinely extracts viral DNA.Concrete steps are: add 200 μ L SDS lysis buffers, add 5 μ L Proteinase Ks (final concentration is 200 μ g/mL), after mixing, in 55 ℃ of water-bath 1-2 h, add subsequently same volumetric balance phenol, centrifugal 5 min of 12000 rpm after mixing.Get supernatant, use respectively phenol: chloroform: primary isoamyl alcohol (25:24:1), chloroform: after primary isoamyl alcohol (24:1), chloroform extracting with the isopropanol precipitating of 1.5 times of volumes,-20 ℃ of precipitation 1 h, centrifugal 5 min of 12000 rpm, 70% washing with alcohol 3 times, drying at room temperature, add 20 μ L aseptic double-distilled waters to dissolve.PCR 25 μ L systems: template DNA 3 μ L, each 0.5 μ L of upstream and downstream primer P1/P2, rTaq archaeal dna polymerase 12 μ L, mend sterilized water to 25 μ L; Mix laggard performing PCR amplification.The PCR amplification program is: after 95 ℃ of 5 min, and 94 ℃ of 40 s, 53 ℃ of 50 s, 72 ℃ of 45 s, after 30 circulations, 72 ℃ are extended 12 min.Reaction is got 5 μ L PCR products and is carried out the result of electrophoresis detection PCR with 1% sepharose after finishing.

1.5 separation and the cultivation of virus

The PCR that gets 1.3 processing detects the samples of organizing for the PCV2 positive, every 2 ml add 100 μ L trichloromethane room temperature treatment 10 min, will be in the PK15 of division stage cell, abandon supernatant after 37 ℃ of cultivation 1 h, after adding the maintenance medium that contains 300 mmol D-glucosamine to continue to cultivate 72 h, results are viral, by process the PK-l5 cell with D-glucosamine, promote the PCV2 breeding.

1.6 the indirect immunofluorescence of PCV2 is identified

Adopt following method: inoculate the PK15 cell that separating obtained virus is cultivated on 96 porocyte plates, after 37 ℃ of cultivation 72 h, with PBS washing 3 times, dry; Fix 30 min with 4% paraformaldehyde, PBS washing 2 times, dry; Process and connect poison cell with 0.2% Tritonx-100/PBS, 37 ℃ of 10 min, PBS washing 2 times, dry; Every hole adds 37 ℃ of sealing 1 h of normal rabbit serum confining liquid, outwells; Primary antibodie is processed, and how anti-(1:1000) 37 ℃ of VMRD company hatched 45 min, and PBS washes 5 times; Two anti-processing, 37 ℃ of anti-pig IgG-FITC of rabbit (1:200) are hatched 45 min, and PBS washes 5 times; 0.01% Evans blue, 30 s that dye, PBS washes 3 times; 80% glycerine back cover, the fluorescence microscopy.

1.7 the complete genomic pcr amplification of PCV2

By after above-mentioned cell culture freeze thawing 3 times, centrifugal 5 min of 12000 rpm, collect supernatant liquor, extracts DNA, carries out pcr amplification.The PCR reaction system is template DNA 3 μ L, each 0.5 μ L of upstream and downstream primer P3/P4, rTaq archaeal dna polymerase 12 μ L, moisturizing to 25 μ L; Mix laggard performing PCR amplification.The PCR amplification program is after 95 ℃ of 5 min, 94 ℃ of 40 s, and 53 ℃ of 50 s, 72 ℃ of 45 s, after 30 circulations, 72 ℃ are extended 10 min.Reaction is observed after PCR product electrophoresis after finishing under uv analyzer.

1.8 the mensuration of PCV2 whole genome sequence and analysis

Electrophoresis, recovery purpose fragment, be connected, transform with the pMD18-T carrier according to a conventional method, extracts plasmid, after PCR, enzyme are cut evaluation, is accredited as positive recombinant plasmid and serves the order-checking of marine life Engineering Service company limited.Adopt DNAStar software that other PCV2 whole genome sequence obtained on clone's sequence and GenBank is carried out to homology relatively, generate Phylogenetic tree.

2 results and analysis

2.1 sample P CR detected result

Extract DNA the swine disease material infected from the doubtful PCV2 in pig farm, Zhengzhou City, carry out pcr amplification, the product of amplification detects and shows through agarose gel electrophoresis, all amplifies 1 purpose band (Fig. 1) that is about 500 bp in samples, with expected results, is consistent.

2.2 the cell cultures result of PCV2

The PCR of PCV2 DNA is detected to the positive filtrate of organizing and be inoculated in the PK15 cell polluted without PCV, continuous passage.In per generation cell toxicant, can amplify the specificity purpose band of PCV2 with the PCV2 Auele Specific Primer, illustrate that PCV2 breeds on the PK15 cell.By the PCV2 called after HZ09 strain separated.

2.3 fluorescent dye qualification result

The HZ09 strain is inoculated in the PK15 cell, after 37 ℃ of cultivation 72 h, all can observe typical specificity bright green fluorescence in the cell culture of inoculation, and the cell of negative control, blank is without the specificity green fluorescence.

2.4 PCV2 genome amplification result in cell toxicant

The DNA that the virocyte culture of take extracts is template, with the full genome of primer P3/P4 amplification PCV2, all amplifies the purpose band of 1 treaty 1800 bp, with expected result, is consistent (Fig. 2).

2.5 the mensuration of sequence and analysis

Sequence is spliced and the analysis showed that by DNAStar, isolated PCV2 whole genome sequence is 1767 bp.Sequence homology relatively shows: the full DNA homolog between HZ09 strain and laboratory PCVl strain isolated is respectively 74.6%, and the homology between domestic and international 30 PCV2 strains is 92.6%～99.9%.Further analytical results show the HZ09 strain and domestic FJ870972 (Heilungkiang) sibship nearest, homology is up to 99.7%; Nearest with external HQ378161 (Serbia) kinship, homology is 96.3%.Farthest, homology is 94.4%(Fig. 3 to HZ09 strain and EU148504 (Denmark) sibship).

Draw systematic evolution tree (Fig. 4) according to the 30 strain PCV2 gene orders of issuing in GenBank both at home and abroad.Can find out that 31 strain PCV2 are divided into three larger branches, be PCV-2a, PCV-2b and tri-hypotypes of PCV-2c (AF055392, AF055394 and EU148503 are respectively the reference sequences of PCV-2a, PCV-2b and PCV-2a).As seen from the figure, the HZ09 strain is positioned in PCV-2a branch, and therefore, HZ09 pnca gene type is PCV-2a.HZ09 strain and FJ870972 (Hubei) relation is nearest, and they are on same subbranch, and genome length is 1767 bp.In general, the HZ09 strain is very near with the sibship of domestic and international strain isolated, can show that thus the genome mutation degree of worldwide PCV2 is little.

3 conclusions and discussion

When PCV2 separates, by the maintenance medium that contains D-glucosamine, be conducive to the adaptation of virus to cell, this may enter the S phase with the D-glucosamine inducing cell, promotes that viral propagation is relevant.While doing indirect immunofluorescence, finally, with Evans blue dyeing 30s, can deepen the comparative between feminine gender and positive cell like this, more easily observe.PCV2 distributes all over the world, and the PCV2 strain gene order that world's every country is issued shows: the sequence length of PCV2 is 1767 bp or 1768 bp, and the report of 1766 bp is also arranged.China in 2001 separate first 3 PCV2(BF, BX and HR) be all 1767bp; The 6 strain sequences of next separating have 5 strain 1767 bp, 1 strain 1768 bp.The 2 strain PCV2 that this paper separates are 1767 bp, and wherein HZ09 strain ORF2 is 705 bp, 233 amino acid of coding of deriving.

2008, the circovirus disease council of European Union proposed a unified PCV2 genotype naming method, and PCV2 is divided into to PCV-2a, PCV-2b and PCV-2c.According to this method, when being greater than 0.035, the genetic distance between the ORF2 of PCV2 sequence just can be divided into different genotype.By phylogenetic analysis, most of China PCV2 strain is classified as 2a and 2b, and only having a little strain is that 2d(is only in the new genotype of China), the 2c genotype does not appear.Nearly ten years, Chinese Major Epidemic strain was PCV-2b.The 2 strain PCV2 that this paper separates, a strain is PCV-2a, another strain is PCV-2b, the popular positive increasingly complex of PCV2.

Research finds, PCV2 often causes the morbidity of pig body with the common infected pigs of other pathogenic agent body.Have clinical investigation to show: in China, PRRSV, PPV, CSFV and mycoplasma are the modal pathogenic agent of its concurrent infection, have once in a while PRV.Separately there are some researches show: the common probability infected of PCV2 and PRRSV is 52.3%, and the probability jointly infected with PPV is 26.9%.The acquisition of the full gene of 2 strain PCV2 strain, for the functional study of carrying out ORFs, explore its virulence and immunogenic research is laid a good foundation.

The optimization of two pig gyrate virus II type strain virus isolated in Henan province proliferation conditions

1 materials and methods

1.1 virus and cell PCV2/HZ09 strain deposit number (CCTCC NO:V201312), the PK15 cell cryopreservation.

1.2 main agents

1640 substratum (Suo Laibao company), PCV2 positive serum (VMRD company); Anti-(Sigma) company of the anti-pig IG-g-FITC bis-of rabbit; Rabbit anteserum confining liquid (doctor's moral); D-glucosamine (Sigma company); Other reagent is analytical reagent.

1.3 the selection of IFA reaction conditions

1.3.1 the sero-fast working concentration of PCV2

By in 96 orifice plates, cover with individual layer infection supernatant discarded after PK15 cell cultures 72 h of PCV2, with PBS washing three times, 37 ℃ of drying 30 min, then fix 45 min with 37 ℃ of 4% paraformaldehydes, PBS washs 3 times; Again with 37 ℃ of effect 20 min of 0.2% Trition-100, PBS washing 3 times; 37 ℃ of effect 2 h of 10% rabbit anteserum, discard and do not wash; Rabbit anteserum with 5% is done 1:500,1:800,1:1000,1:1200,1:1600 dilution by the PCV2 antiserum(antisera), four holes of each extent of dilution, 50 μ L/ holes, 37 ℃ of effect 45 min, PBS washing 5 times; Add the anti-pig IG-g-FITC of 1:1000 rabbit, 37 ℃ of effect 1 h, PBS washing 5 times; 80% glycerine back cover, fluorescence microscope.

1.3.2 the working concentration of the anti-pig IG-g-FITC of rabbit

Press the 1.3.1 method, add the PCV2 antiserum(antisera) of 1:800 dilution, 37 ℃ of effect 1 h, wash 5 times; The anti-pig IG-g-FITC of rabbit is done to 1:300,1:600,1:800,1:000,1:1400 dilution, and 37 ℃ of effect 45 min, wash 5 times; 80% glycerine back cover, fluorescence microscope.

1. the optimization of 4 PCV2 proliferation conditions

1.4.1 the optimum concn of D-glucosamine

By the infection of growing fine 0.25% the trysinization for the PK15 cell of PCV2, then add 1640 substratum of 10% calf serum, be sub-packed in 96 aseptic orifice plates, every hole 100 μ L, 37 ℃, 5% CO2: standing cultivation in incubator, after 24 h, discard supernatant liquor.The final concentration that adds respectively D-glucosamine is 0.25,0.5,1,2,3 mM 2% calf serum 1640 substratum, 4 holes of each extent of dilution (100 μ L/hole), set up negative control simultaneously, putting into 37 ℃ of CO2 incubators continues to cultivate, detect the positive cell number in every hole by the IFA method after 48 h, the concentration of the corresponding D-glucosamine in hole that the positive cell number of usining is maximum is as optimum concn.

Receive determining of poison time 1.4.2 best

By the infection of growing fine 0.25% the trysinization for the PK15 cell of PCV2, then add 1640 substratum of 10% calf serum, be sub-packed in 96 aseptic orifice plates every hole 100 μ L, 37 ℃, 5% CO ₂standing cultivation in incubator, after 24 h, discard supernatant liquor.Add 1640 substratum containing 2 mM D-glucosamine 2% calf serums, continue to cultivate, cultivate 24 h, 48 h and 72 h, do respectively the IFA test.Determine the best receipts poison time.

The propagation 1.5 PCV2 goes down to posterity

0.25% the trysinization for PK15 cell in good condition by one bottle of 25 ml, add the RMPI-1640 nutrient solution piping and druming of 5 ml containing 10% calf serum, get in the Tissue Culture Flask that 2 ml are added to 25 new ml, then the cell toxicant that respectively adds 800 μ L mixes, add substratum and be added to 8 ml, 37 ℃ of cultivations, after 24 h, discard nutrient solution, respectively add 1640 substratum maintenance medium 8 ml containing 2 mM D-glucosamine 2% calf serums, continue to cultivate 48 h, after 48 h, one bottle in-20 ℃ of freeze thawing three times, be stored in-20 ℃ standby; The trysinization of another bottle of use 0.025% becomes individual cells, is divided into two and goes down to posterity, and so moves in circles, until the 20th generation.

1.6 TCID50 measures

With the enchylema of new digestion, the virus liquid in 20 generations is done to 10 ^-1to 10 ^-7doubly after dilution, be inoculated on 96 orifice plates, negative control is established in each extent of dilution 8 hole simultaneously.37 ℃, standing cultivation in 5% CO2 incubator, after 24 h, discard nutrient solution, adds the 1640 substratum maintenance mediums containing 2 mM D-glucosamine, 2% foetal calf serum, and every hole 100 μ L continue to cultivate 48 h, discard maintenance medium, with PBS washing 3 times, dry; Fix 30 min with 4% paraformaldehyde, PBS washing 2 times, dry; Process and connect poison cell with 0.2% Tritonx-100/PBS, 37 ℃ of 10 min, PBS washing 2 times, dry; Every hole adds 37 ℃ of sealing 1 h of normal rabbit serum confining liquid, discards and does not wash; Primary antibodie is processed, and how anti-(1:1000) 37 ℃ of VMRD company hatched 45 min, and PBS washes 5 times; Two anti-processing, 37 ℃ of anti-pig IgG-FITC of rabbit (1:200) are hatched 45 min, and PBS washes 5 times; PBS washes 3 times; 80% glycerine back cover, the fluorescence microscopy.

2 results and analysis

2.1 the optimization of IFA reaction conditions

2.1.1 PCV2 antiserum(antisera) optimum dilution degree

The fluorescence microscopy Microscopic observation, 1:800,1:1000, tri-extent of dilution positive cell quantities of 1:1200 are similar, the hole of 1:800 dilution, fluorescence intensity is bright.1:300, two extent of dilution of 1:600 occur that the non-specific fluorescence particle is more, in the hole of 1:1600 dilution, positive cell quantity and fluorescence intensity obviously weaken.Therefore, we are using 1:800 as sero-fast optimum dilution degree.

2.1.2 two anti-optimum dilution degrees

The fluorescence microscopy Microscopic observation, 1:300,1:600,1:800, tetra-extent of dilution positive cell quantities of 1:000 and fluorescence intensity be all without significant difference, in the 1:1400 dilution, the quantity minimizing of institute to the positive cell in deserved hole, weakened.So optimum dilution degree using 1:1000 as two anti-(IG-g-FITC).

2. the optimization of 2 PCV2 proliferation conditions

2. the optimal stimulus concentration of 2.1 D-glucosamine

With 3 mM and 2 mM D-glucosamine, stimulate the virus multiplication positive cell to be more or less the same, more than the positive cell number of other concentration, the lower concentration effect of stimulation is not obvious, therefore 2 mM is defined as to optimal stimulus concentration.

2.2.2 virus culture Best Times

Cultivate 72 h, the positive cell quantity in cell hole is maximum, and to 96 h, the positive cell quantity in hole is than reducing to some extent before.Therefore, cultivate 72 h after virus inoculation and be used as best the receipts poison time.

2.3 PCV2 breeds situation

Extract per generation viral DNA in the process that goes down to posterity, detect the situation of virus multiplication with the detection primer P1/P2 in test one, result, as Fig. 5, can find along with the carrying out of going down to posterity, and the purpose band of amplification brightens gradually.

2.4 the mensuration of virus titer

TCID50 through IFA test determination the 10th, 15,20 generation virus is respectively 10 ^3.2/ 0.1 ml, 10 ^4.5/ 0.1 ml, 10 ^{4. 75}/ 0.1 ml.

3 conclusions and discussion

The PCV2 cells infected does not have cytopathy to produce, and brings very large difficulty to propagation the go down to posterity situation of detection PCV2 on cell.This research adopts the IFA method to detect the antigen in virus infected cell, and the method has easy and simple to handle, and Antigen Location is accurate, and the advantages such as high specificity are applicable to viral quantitative and qualitative analysis.Can reflect exactly the propagation situation of virus in cell cultures.This research is optimized the IFA method, mainly comprises primary antibodie and two anti-best weaker concn and the best use of times.Result shows, primary antibodie 1:800 dilution, and IG-g-FITC 1:1000 dilution, effect 1h, the IFA effect is best.

What application was more at present is to adopt the PK15 cell to cultivate in vitro PCV2, but PCV2 viral titer on the PK15 cell is lower.The adaptability problem of cultivating about the PCV2 cell in vitro, the foreign scholar did some correlative studys.Result of study shows, PCV2 does not present cytopathy after infecting the PK15 cell, and virus is also poor at the multiplication capacity of cell, only infects about 20% cell.The viral titer of PCV2 on the PK15 cell, the TCID50/0.1ml that namely we say is generally 10 ³-10 ⁴between, be no more than 10 ⁴.Occur this situation reason may with this virus, to depend on the host cell polysaccharase in reproduction process unduly relevant, this enzyme is mainly synthetic in the cell proliferation S cycle, can increase viral breeding.Can significantly increase viral multiplication capacity with the D-glucosamine irritation cell of 300 mM.After processing cell with D-glucosamine, likely improve the ability of host cell S phase synthesized polymer enzyme, its amount is increased, its actual mechanism of action is not yet studied clear so far.D-glucosamine has very large toxicity to cell, and there in actually operating, slightly have to be improper, and cell there will be greatly and is not in good state, and necrocytosis while going down to posterity, cause cell can't continue to go down to posterity.Stimulate by the maintenance medium containing D-glucosamine the cell that infects PCV2 in this research.Without D-glucosamine, process, while going down to posterity for 20 generation, TCID50 is 10 ^4.375/ 0.1ml, while processing with D-glucosamine, the 15th generation TCID50 reaches 10 ^4.5/ 0.1ml.From test-results, also can effectively stimulate viral propagation with the D-glucosamine of lower concentration, and not affect normally going down to posterity of cell.

This test stimulates the PK15 that infects PCV2 to obtain a comparatively ideal virus quantity with the lower concentration D-glucosamine, for carry out the increment research of PCV2 on the PK15 cell later, lays a good foundation.

Three PCV2 breed the cloning and screening of responsive PK15 cell

1 materials and methods

1.1 PK15 cell

PK15 cell (frozen).

1.2 PK15 cell clone

Be incubated at after the PK15 cell recovery in the cell bottle and grow up to cell monolayer, trysinization with appropriate 0.025%, add appropriate PRM-1640 growth media (anti-containing 10% calf serum and 1% pair) piping and druming, it is single that cell dispersion becomes, and adds the PRM-1640 growth media to become the cell suspension of 5 * 104-1 * 105 cells/ml.Carry out cell clone (Fig. 6) by the serial dilution method, operate as follows:

(1) get one 96 orifice plates, except A1, every hole 100 μ L PRM-1640 growth medias (anti-containing 10% calf serum and 1% pair);

(2) add the well-grown PK15 cell of 200 μ L mixed solution in the A1 hole, then with pipettor, inhale 100 μ L to B1, after mixing, then by B1 to C1, arrive successively H1,100 of H1 sucking-off discards, operation avoids foam to produce;

(3) add 100 μ L growth medias with the 8 every holes of volley of rifle fire first row (A1-H1), after mixing, take out 100 μ L to secondary series (A2-H2) from first row fast, again by secondary series to the three row, be diluted to successively last row, the 100 μ L that last row are extracted out discard, and operation avoids foam to produce;

(4) add 100 μ L growth medias with the 8 every holes of the volley of rifle fire, final 200 μ L/ holes.Marking pen mark date and cell category, put incubator and cultivate.

Cultivate 5-7 days, micro-Microscopic observation, mark only has the hole of individual cells group, continues to cultivate, and gets off to forward to 24 orifice plates with 0.025% trysinization and then forward the cell bottle to after covering with individual layer and cultivate.

Select the mono-clonal strain and carry out enlarged culturing, and detect its susceptibility to PCV2 by IIF method.Selection is bred responsive clonal cell line to PCV2, is placed in 37 ℃ of incubator subcultures 3 times (one be designated as P1 generation), adds appropriate cells frozen storing liquid frozen.

1.3 PCV2 increment susceptible PK15 clone cell screening

The different PK15 clone cell of recovering, get off with 0.025% trysinization after passing for 3 generations, adds substratum, add again after 10% virus liquid fully mixes and be encapsulated in 24 orifice plates, 500 μ L/ holes, 37 ℃, standing cultivation in 5% CO2 incubator, after 24 h, discard supernatant liquor.Add containing 2 mM D-glucosamine 2% calf serums and continue to cultivate 48 h, detect the cell concentration of virus infection with IFA, filter out the clone cell of PCV2 susceptible.

1.4 indirect immunofluorescence assay (IFA)

24 above-mentioned orifice plates are discarded to maintenance medium, with PBS washing 3 times, dry; Fix 30 min with 4% paraformaldehyde, PBS washing 2 times, dry; Process and connect poison cell with 0.2% Tritonx-100/PBS, 37 ℃ of 10 min, PBS washing 2 times, dry; Every hole adds 37 ℃ of sealing 1 h of normal rabbit serum confining liquid, outwells; Primary antibodie is processed, and how anti-(1:1000) 37 ℃ of VMRD company hatched 45 min, and PBS washes 5 times; Two anti-processing, 37 ℃ of anti-pig IgG-FITC of rabbit (1:200) are hatched 45 min, and PBS washes 5 times; PBS washes 3 times; 80% glycerine back cover, the fluorescence microscopy.The cell that has fluorescent substance to dye is the PCV2 cells infected.

1.5 the detection of clone cell PCV1

Get clone cell liquid 200 μ L, multigelation three times, phenol chloroform extraction method routinely extracts DNA, PF:5TTGCTGAGCCTAGCGACACC3; PR:5TCCACT-GCTTCAAATCGGCC3, expand 349 bp that in PCV1 ORF1, and the PCR program is: template DNA 3 μ L, each 0.5 μ L of upstream and downstream primer PF/PR, rTaq archaeal dna polymerase 12 μ L, moisturizing to 25 μ L; Mix laggard performing PCR amplification.The PCR amplification program is: after 95 ℃ of 5 min, and 94 ℃ of 40 s, 65 ℃ of 50 s, 72 ℃ of 45 s, after 35 circulations, 72 ℃ are extended 10 min.Reaction is got 5 μ L PCR products and is carried out the result of electrophoresis detection PCR with 1% sepharose after finishing.

1.6 the going down to posterity of PK15 cell, frozen and recovery

By the recovery after the PK15 cell cultures in the cell bottle, to be generated to cell monolayer, with appropriate 0.025% trysinization, add appropriate nutrient solution (anti-containing 10% calf serum and 1% pair) piping and druming, it is single that cell dispersion becomes, and adds nutrient solution, be positioned over 37 ℃ of incubators after sub-bottle and cultivate 1-2 days, form individual layer, then use appropriate trysinization, go down to posterity always.In the process that goes down to posterity, get different generation cells and add appropriate cells frozen storing liquid frozen.

By P5, P10, P20 is for the PK15 cell monolayer, wash 2 times with Hank's liquid, add appropriate 0.025% trysinization, add appropriate growth media, centrifugal 10 min of 1000 rpm, remove supernatant, add appropriate cells frozen storing liquid (MEM) containing 30% calf serum, 10% DMSO and 1% pair anti-, suspension cell, simultaneously, be positioned under-196 ℃ of conditions and preserve, took out 1-2 at interval of 1 week and prop up recovery, observation of cell growth and morphology activity.

1. 7 viral TCID50 measure

With the PK15 enchylema of new digestion, the virus liquid in 20 generations is done to 10-1 and be inoculated on 96 orifice plates after 10-7 doubly dilutes, each extent of dilution 8 hole is provided with negative control simultaneously.37 ℃, standing cultivation in 5% CO2 incubator, after 24 h, discard nutrient solution, adds the 1640 substratum maintenance mediums containing 2 mM D-glucosamine 2% foetal calf serums, and every hole 100 μ L continue to cultivate 48 h, discard maintenance medium, with PBS washing 3 times, dry; Fix 30 min with 4% paraformaldehyde, PBS washing 2 times, dry; Process and connect poison cell with 0.2% Tritonx-100/PBS, 37 ℃ of 10 min, PBS washing 2 times, dry; Every hole adds 37 ℃ of sealing 1 h of normal rabbit serum confining liquid, outwells; Primary antibodie is processed, and how anti-(1:1000) 37 ℃ of VMRD company hatched 45 min, and PBS washes 5 times; Two anti-processing, 37 ℃ of anti-pig IgG-FITC of rabbit (1:200) are hatched 45 min, and PBS washes 5 times; PBS washes 3 times; 80% glycerine back cover, the fluorescence microscopy.Calculate viral TCID50 according to the KarberShi method.

1.8 L8 breeds Detection of Stability to PCV2

The P5 of L8 clone strain, P10, P15, P20 inoculate respectively the virus of equivalent, by the IFA method, detect positive cell number, and the difference of observing positive cell number between different generations judges that whether clone strain L8 is stable to PCV2 propagation.

2 results and analysis

2.1 cell clone and PCV2 IFA detect

PK15 is carried out to cell clone, obtain 6 clonal cell lines, be respectively L1, L5, L6, L8, L12 and L15.The IFA result shows, the L8 clone cell is to PCV2 susceptible the most, 72 h after L8 clone cell virus infection, and the green fluorescence material the PCV2 positive cell number showed increased of dying.

2.2 PCV1 detected result

By PCR method to the detected result of clone strain L8 PCV1 as Fig. 7), visible L8 is containing PCV1.

2.3 L8 clone PK15 cell cultures PCV2 strain TCID50 measures

The PCV2 virus of equivalent is inoculated into respectively to L8 and PK15 parent cell, after 37 ℃ of cultivation 48 h, measures its TCID50 by the IFA method respectively.The result demonstration, the virus titer of cell clone L8 reaches 10 ^6.25tCID50/0.1ml.PK15 parent cell viral titer reaches 10 ^4.75tCID50/0.1ml.

2.4 clone cell goes down to posterity, frozen and recovery

By L8 passage to 20 generation, all adherent good, after cell grows up to individual layer, form is consistent.By P5, P10, P15 cell cryopreservation in-196 ℃ one month, equal well-grown after recovery.

2.5 the stability of L8 to PCV2 propagation

P5, P10, P15, P20 meet respectively malicious 72 h, and to do the IFA result as follows: the positive cell quantity no significant difference, the clone cell of visible screening is more stable to PCV2 propagation.

3 conclusions and discussion

Generally, the PCV2 viral titer is too low, and in order to carry out better PCV2 Infection in Vitro experimental study, it is one of effective method that screening has high infective clone to PCV2.

This test adopts the serial dilution method to be cloned the PK15 cell.In operating process, for the strain of more effective acquisition cell monoclonal, the digestion be inoculated into before 96 orifice plates is very crucial, guarantee that cell is single to be dispersed in, just occur that like this probability of individual cells group can be high.Long owing to occurring that individual cells is rolled into a ball the needed time, so 96 orifice plates will be used rubber belt sealing, prevent that the growth media volatilization is too fast, supplement in time in case of necessity growth media.

At present, there is the scholar to filter out cell strain PK15-C1, the PKKC of the high infection rate of PCV2 abroad, find that under study for action the PK15 cell is diversified to the susceptibility of PCV2, includes the cell of high infection rate and low infection rate.Because the heterogeneity of cell infection rate causes PCV2 titre on PK15 lower.By cell clone, pick out the PK15-C1 of high infection rate from the PK15 parent cell, the PCV2 titre can reach 10 ⁷tCID50/0.1ml; PKKC, the PCV2 titre reaches 10 ^5.8tCID50/0.1ml, and cytopathy can appear after cultivating 6 days.This this test adopts serial dilution method (1) PK15 parent cell to be digested to individual cells, and concentration is 5 * 10 ⁴-1 * 10 ⁵cells/ml; (2) carry out twice serial dilution on 96 orifice plates; (3) the unicellular group of mark, enlarged culturing; (4) the IFA method identifies that clone cell is to PCV2 susceptibility; (5) continue to cultivate the clone of high infection rate.Finally obtain the higher cell strain PK15-L8 of a strain PCV2 susceptibility, do not have after testing PCV1 to pollute, go down to posterity stable, the PCV2 titre reaches 10 ^6.25individual TCID50/0.1ml.

Claims (1)

1. a pig gyrate virus II type strain, is characterized in that, pig gyrate virus II type (Circoviridae), CCTCC NO:V201312.

Images