CN103421804A - Application of Ghd7-1 gene in regulating rice production, florescence and plant height - Google Patents

Abstract

The invention belongs to the technical field of rice genetic engineering, and in particular relates to a major gene Ghd7-1 of a pleiotropic gene capable of increasing rice production, delaying heading period and increasing plant height, as well as cloning and application of two alleles. The nucleotide sequence is shown in SEQ ID No: 1, 3 and 5 respectively; genetic transformation shows that the single plant production of near-isogenic line, which is created by the invention, increases from 14.8 g to 25.6 g, meanwhile, the heading period is delayed for 19 days, the plant height is increased by 28 cm, and the number of glumous flowers on each plant is increased by 45, so that the application of Ghd7-1 gene has great application value for heredity improvement of rice.

Description

Application in Ghd7-1 gene regulating rice yield, flowering period and plant height

Technical field

The present invention relates to the plant gene engineering technology field.Be specifically related to one to rice grain output, flowering period and plant height have simultaneously enormous benefits the quantitative trait locus gene Fine Mapping and use agriculture bacillus mediated genetic transforming method and carried out functional verification.

Background technology

Paddy rice is the whole world Major Foods of half population nearly, but, along with the growing of population and the continuous deflation of ploughing, the output that how to improve the paddy rice unit surface meets ever-increasing grain demand, is a problem in the urgent need to address.The direct composing factor of rice yield comprises the real grain of every fringe number, and thousand seed weight and individual plant tiller number, be subject to again many-sided impacts such as lodging, disease and pest and water source simultaneously.Wherein, the real grain of every fringe number spends number and setting percentage jointly to determine by every fringe grain husk; Thousand seed weight is wide by grain length, grain, the thick and circularity of grain determines jointly.Paddy rice is as a short day plant that photosensitivity is very strong, and the morning and evening in flowering period has determined the plantation region restriction of paddy rice.Plant height is all influential and then affected the output of paddy rice on biomass and lodging property, and Second Green Revolution is exactly by reducing the paddy rice height, improves lodging resistance and has reached the purpose of high yield.

At present cloned numerous genes that affect output, wherein Ghd7 and Ghd8 have affected rice yield, the pleiotropic gene of flowering period and plant height simultaneously.Ghd7 is positioned at the nearly centric region of paddy rice the 7th karyomit(e), the albumen that comprises CCT domain of encoding, under the long day condition, it can increase plant height 30cm, postpone heading 30 days, increase production 50%(Weiya Xue etc., Natural variation in Ghd7 is an important regulator of heading date and yield potential in rice, Nature genetics simultaneously, 2008,40:761-767).Ghd8 is positioned at the 8th karyomit(e) upper end, the CBF genoid of having encoded, and under the long day, it can increase plant height 20cm, postpone heading 9 days, single plant yield is increased to 23.8 grams (Wenhao Yan etc., A major QTL, Ghd8 by 15.1 grams simultaneously, plays pleiotropic roles in regulating grain productivity, plant height, and heading date in rice, Molecular plant, 2011,4:319-330).

The present invention utilizes the method for map based cloning to clone one to be positioned at the long-armed end of the 7th karyomit(e), can to have affected rice yield, the pleiotropic gene Ghd7-1 of flowering period and plant height simultaneously.Under the long day, Ghd7-1 can increase every fringe grain husk and spends severally 50%, and single plant yield is brought up to 25.6g by 14.8g, postpones heading 19 days simultaneously, increases plant height 28cm, thereby rice breeding is had to huge using value.

Summary of the invention

The present invention has cloned a pleiotropic gene Ghd7-1 who controls rice grain output, heading stage and plant height.This gene, to a certain degree increasing plant height and prolong growth period, increases substantially rice yield simultaneously, has production application prospect preferably.This unnamed gene that the applicant will clone is Ghd7-1.

The present invention is achieved in that

1, the structure of QTL scanner uni near isogenic line: utilize one by the precious Shan 97(ZS97 of rice varieties) and the RIL of totally 190 familys that derives of special green grass or young crops (TQ) (name respectively RIL-1, RIL-2 ... RIL-190), planted F7 and F8 generation and found have one to control output when carrying out QTL scanning near the 7th end of chromosome RM248 simultaneously, the QTL in plant height and flowering period, and have plant height for the 189th family of heterozygous (being called for short RIL189) herein simultaneously, spend several separate with every fringe grain husk heading stage, wherein special blue or green genotype is high strain, the heading in evening, every fringe grain husk spends number to increase (Touming Liu etc., 2011), and appearing as 3:1 separates, with precious Shan 97 allelotypes, compare, special blue or green allelotype can increase output 50%, postpone 19 days heading stages, increase plant height 28cm, the near isogenic line in this site has built and (has seen accompanying drawing 1, 2).

2, determining of the Fine Mapping of Ghd7-1 and candidate gene: the near isogenic line background F2 large group of having planted 2200 strains in 2011 in Wuhan, Hubei carries out the Fine Mapping of gene, by the assignment of genes gene mapping at common indicium RM22181 the interval to the about 104kb of end of chromosome.By this section gene is carried out to function prediction, OsPRR37 to 20kb after mark RM22181 compares order-checking, with special green grass or young crops, compares, and there is the disappearance of a 8bp in precious Shan 97, the disappearance of this 8bp is designed to all restructuring individual plants of Marker Identification, find it and phenotype be divided into from.Therefore, it is defined as to candidate gene.The OsPRR37 coded product is for intending the response regulatory factor, and the disappearance of this 8bp has caused the premature termination of this gene encoding production, has caused the disappearance of CCT domain.OsPRR37 is at Arabidopis thaliana, and the homologous gene of barley and Chinese sorghum the inside is all verified has relation with flowering of plant, so we are using it as candidate gene.

3, the functional verification of Ghd7-1: utilize SamI and SalI point of contact, the CDS of OsPRR37 is connected on the pCAMBIA1301S carrier, utilize agriculture bacillus mediated genetic transformation that candidate gene is proceeded in precious Shan 97.And carry out the phenotype investigation in T1 generation, and find that overexpression OsPRR37 can increase plant height 16cm, postpone 30 days heading stages, increase every fringe grain husk simultaneously and spend several 40, confirm that OsPRR37 has the heading of delay, increase plant height and every fringe grain husk and spend several functions.

3, one of the gene structure analysis of Ghd7-1: Ghd7-1 coding is intended the response regulatory factor, and whole gene comprises REC domain and CCT domain totally 2 domain.And precious Shan 97 genotype have caused the gene frameshit at distance initiator codon (ATG) the 1515 disappearance 8bp of bp place, coding premature termination, final CCT domain disappearance.

The present invention has cloned paddy rice Ghd7-1 gene, and it can increase plant height simultaneously, and delay sky at heading stage and the every fringe grain husk of increase are spent number, increase output, for rice breeding provides good material.

The accompanying drawing explanation

Sequence table SEQ ID NO:1 is the nucleotide sequence of the present invention's Ghd7-1 major gene of cloning.Sequence length is 2229bp.

Sequence table SEQ ID NO:2 is the aminoacid sequence of the present invention's Ghd7-1 major gene of cloning.742 amino acid of encoding.

Sequence table SEQ ID NO:3 is one of them allelic nucleotide sequence of Ghd7-1 major gene that the present invention clones.Sequence length is 1527bp.

Sequence table SEQ ID NO:4 is one of them allelic aminoacid sequence of Ghd7-1 major gene that the present invention clones.508 amino acid of encoding.

Sequence table SEQ ID NO:5 is another allelic nucleotide sequence of Ghd7-1 major gene that the present invention clones.Sequence length is 2229bp.

Sequence table SEQ ID NO:6 is another allelic aminoacid sequence of Ghd7-1 major gene that the present invention clones.742 amino acid of encoding.

Fig. 1. be general technical route map of the present invention.Precious Shan 97, special blue or green for after the parent hybridizes and produce F1, carry out selfing and must choose 190 selfed seeds and plant F2 of future generation, and 190 F3 of 190 each individual plant selfing generations of F2 utilize 8 generations of this simple grain transmission method to the.Wherein utilize F7 generation and F8 build genetic linkage maps and scan QTL for genotype and phenotype, result is controlled plant height, heading stage and output at the long-armed Ghd7-1(of scanning of the 7th karyomit(e) simultaneously).Wherein RIL189 is that other section of heterozygous is all pure and mild type at the target section, so this family selfing of picking obtains the near isogenic line NIL(Ghd7-1 of Ghd7-1).The F2 colony that utilizes selfing to produce carries out meticulous equipotential and finds candidate gene, and carries out functional verification by transgenosis.

Fig. 2. the heading stage, plant height and the every fringe grain husk that are different allelotype individual plants in the near isogenic line that builds of the present invention are spent several phenotypes.In figure: Fig. 2 A is the individual plant that NIL under the near isogenic line background (ZS), NIL (TQ) mean respectively precious Shan 97, special blue or green allelotype, and special blue or green allelotype individual plant postpones heading in 19 days; Fig. 2 B compares with NIL (ZS) individual plant under the near isogenic line background, and NIL (TQ) individual plant can increase plant height 28cm; Fig. 2 C compares with NIL (ZS) individual plant under the near isogenic line background, and NIL (TQ) individual plant can increase every fringe grain husk and spend several 45.

Fig. 3. utilize the result of 2200 strain F2 colony Fine Mapping.In figure: what black line meaned above is the mark title, below corresponding numeral at respective markers place restructuring individual plant number.Utilize self-designed indel mark PN19 to screen altogether 110 restructuring individual plants in conjunction with phenotype, utilize common indicium RM248 screening to obtain 75 restructuring individual plants, utilize common indicium RM22181 to screen 1 restructuring individual plant, finally recombinate individual plant 8bpdeletion place genotype and phenotype be divided into fully from.

Fig. 4. the aminoacid sequence of precious Shan 97 and special blue or green Ghd7-1 proteins encoded is compared, the precious Shan 97 of Ghd7-1 and special blue or green two kinds of genotypic aminoacid sequences, the fine nucleotide sequence of Japan of conversion use.

Fig. 5. in the present invention, overexpression vector used builds schematic diagram.

Fig. 6. transgenosis heading stage and plant height phenotype: Fig. 6 A is that transgenic positive individual plant (OE (+)) is compared and postponed with the negative individual plant of transgenosis (OE (-)) heading stage; To be transgenic positive individual plant (OE (+)) compare plant height with the negative individual plant of transgenosis (OE (-)) to Fig. 6 A increases.

Embodiment

Simultaneously scan control plant height, heading stage and every fringe grain husk with special blue or green RIL the inside at the 7th end of chromosome from rice varieties treasure Shan 97 and spend several QTL, picking RIL189 family wherein builds near isogenic line NIL (Ghd7-1), and carries out genetic analysis to investigate the effect of QTL.Utilize the NIL-F2 colony of 2200 strains to carry out Fine Mapping, finally the section in the approximately 104kb finished from common indicium RM22181 to karyomit(e) by the assignment of genes gene mapping.Have 7 genes in this interval, wherein comprise OsPRR37, to its carry out the sequencing result discovery precious Shan 97 inside basic because of in the disappearance of 8bp is arranged and causes premature termination, and to recombinating single group, carry out genotype identification find the disappearance of this 8bp and phenotype be divided into fully from, this gene is decided to be to candidate gene.The fine allelotype of the Japan of this gene is received on the pCABIA1301s overexpression vector and transformed precious Shan 97, at T1, for also having occurred that the transgenic positive individual plant postpones heading stage, increase plant height and every fringe grain husk and spend several phenotypes, confirmed that OsPRR37 is exactly Ghd7-1.

Following examples further define the present invention, and have described separating clone and the functional verification of Ghd7-1 gene.According to following description and these embodiment, those skilled in the art can determine essential characteristic of the present invention, and, in the situation that do not depart from spirit and scope of the invention, can make various changes and modification to the present invention, so that its applicable various uses and condition.

The location of embodiment 1:Ghd7-1 and effect analysis

(1) discovery of Ghd7-1: utilize the face dragon peace academician's seed selection of precious Shan 97(Jiangxi Province academy of sciences and be so kind as to give) with special blue or green self-mating system (the auspicious academician's seed selection of yellow credit of academy of agricultural sciences, Guangdong Province and be so kind as to give), at F7 generation and F8, withhold and collect heading stage and every fringe grain husk is spent several phenotypes, to each family, utilize public SSR mark (www.gramene.org) identified gene type to build genetic linkage maps (Touming Liu etc. simultaneously, 2011, Comparison of quantitative trait loci for rice yield, panicle length and spikelet density across three connected populations, Journal of Genetics, 90:377-382), then utilize with WinQTLcartographer 2.0 softwares and select composite interval mapping method (Zeng ZB.Precision mapping of quantitative trait loci.Genetics, 1994,136:1457-1468) scanning QTL, F7 and F8 are at the 7th end of chromosome common indicium RM248(www.gramene.org) locate all to scan heading stage and every fringe grain husk is spent several QTL.In RIL189 family the inside, in this interval, be that other place of heterozygous genes type is all pure and mild genotype, and occur that in the offspring phenotype separation separates, all precious Shans 97 are genotypic is all early blossoming, short strain, small ear, special blue or green genotype is all late flower, high strain, (the RIL189 family is that the seed selection of near isogenic line NIL (Ghd7-1) of Ghd7-1 is referring to Touming Liu etc. for large fringe, 2011, Quantitative trait loci for the number of grains per panicle dependent on or independent of heading date in rice (Oryza sativa L.), Breeding Science 61:142 – 150, lower same).

(2) structure of the near isogenic line of Ghd7-1 and Effect Evaluation: in 190 family the insides of RIL, it is only the heterozygous genes type at the RM248 place that the RIL189 family is one, and other position genotype is pure and mild genotypic individual plant.There is plant height in the RIL189 selfing in producing in F2 group, spend the separating of number and output with every fringe grain husk heading stage, and separate than being 3:1, therefore separate by RIL189 family (this family is the near isogenic line NIL of Ghd7-1, the document of the same Touming Liu of document etc.) the near isogenic line NIL (Ghd7-1) that has obtained Ghd7-1.Respectively the individual plant of the picking precious pure and mild allelotype NIL of Shan 97 of 30 strains (ZS97) and the special blue or green pure and mild allelotype NIL of 30 strains (TQ), investigate heading stage, plant height, and every fringe grain husk is spent number and single plant yield (see figure 2), and concrete outcome is as table 1:

Table 1 Ghd7-1 near isogenic line phenotype relatively

From table can see, under the near isogenic line background, with precious Shan 97 allelotype NIL (ZS), compare, special blue or green allelotype NIL (TQ) can postpone 19 days heading stages, increase plant height 28cm, increase every fringe grain husk and spend severally 50%, single plant yield is brought up to 25.6g by 14.8g.

(3) Fine Mapping of Ghd7-1: in the NIL-F2 of 2200 strains colony the inside, utilize self-designed indel mark PN19 and RM248 to identify the individual plant genotype, in conjunction with phenotypic screen restructuring at heading stage individual plant, find between PN19 and Ghd7-1 to have 110 restructuring individual plants, and between common indicium RM248 and Ghd7-1, have 75 the restructuring individual plants, these 75 restructuring Dan Zuwei PN19 and RM248 have, in these 75 individual plant the insides, RM248 is identical with the PN19 genotype, illustrates that Ghd7-1 is positioned at the position (shown in Fig. 3) that RM248 to the 7 ends of chromosome finish.The PN19 primer sequence is as follows:

PN19F:TTCGTTTCGCAATTTACACG

PN19R:CCAGCCCAAGGCTTTTTAC

Utilize common indicium RM22181 to screen these 75 restructuring individual plants and find to also have 1 restructuring individual plant, this restructuring individual plant is at PN19, but RM248 and RM22181 place are all the heterozygous genes types early ear, the verity of this restructuring individual plant has also been verified in progeny testing, illustrates that Ghd7-1 is positioned at the long end of RM22181 to the 7 karyomit(e) and finishes.RM22181 has 104kb according to the long-armed least significant end of the 7th karyomit(e), wherein comprises 7 genes such as OsPRR37 (Os07g0695100) (http://rapdblegacy.dna.affrc.go.jp/).OsPRR37 is at Arabidopis thaliana (the Arabidopsis Clock-Associated Pseudo-Response Regulators PRR9 such as Norihito Nakamichi, PRR7 and PRR5 Coordinately and Positively Regulate Flowering Time Through the Canonical CONSTANS-Dependent Photoperiodic Pathway, 2007, Plant Cell Physiol.48:822-832), barley (Adrian Turner etc., The Pseudo-Response Regulator Ppd-H1 Provides Adaptation to Photoperiod in Barley, Science, 2005, 310:1031-1034) and Chinese sorghum (Rebecca L.Murphy etc., Coincident light and clock regulation of pseudoresponse regulator protein 37 (PRR37) controls photoperiodic flowering in sorghum, PNAS, 2011, homologous gene 108:16469-16474) is all influential to heading stage.And to the full-length cDNA of OsPRR37 compare after order-checking we find the precious Shan allelotype in distance translation initiation site 1515bp place lacked GAACGTTG altogether the precious Shan 97cDNA of 8bp(sequence see SEQ ID NO:3, special blue or green cDNA sequence is shown in SEQ ID NO:1), and then amino acid when translation frameshit, translation premature termination (the precious Shan 97 of OsPRR37 is shown in Fig. 4 with special blue or green amino acid comparison result) have been caused.The OsPRR37 proteins encoded has comprised a signal reception zone REC domain and a DNA calmodulin binding domain CaM CCT domain(http: //www.uniprot.org/uniprot/Q0D3B6), and cause frameshit, amino acid translation premature termination in precious Shan 97 the inside 8bp disappearances, the CCT domain disappearance of protein, may functionating.Utilize the disappearance of this 8bp to design a pair of SSR primer, its DNA sequence dna is as follows:

8bp?deletion?F:GTGTCCATTAGCCTTAACAGC

8bp?deletion?R:CAAGGTTCTAATGGTAGTAGC

Utilize this to SSR primer 8bp deletion, 2240 individual plants to be carried out to genotype identification, find that it is all early blossoming that the disappearance of this 8bp and phenotype are divided into from: all precious Shans 97 allelotype of isozygotying fully, all late Huadus are isozygoty special blue or green genotype or heterozygous genes type, therefore OsPRR37 are located to candidate gene.At PN19, RM248, the restructuring individual plant between RM22181 and 8bp deletion is respectively 110,75 and 1, as shown in Figure 3.

The transgenosis functional verification of embodiment 2:Ghd7-1

(1) transform the acquisition of fragment: the blade RNA(article No. 15596-026 that utilizes the fine kind of Trizol reagent extracting Japan), getting the total RNA of 4ug carries out reverse transcription (method is shown in invitrogen SS III specification sheets, article No. 18080-093), getting 0.5ul does template (method is shown in precious biotechnology Dalian company limited by the method for pcr amplification, LA Taq enzyme specification sheets, article No. DRR002A) obtain the coding region total length (SEQ ID NO:5) of this gene, the primer is: CDSF:AcccgggAAACCCCTGCCACCACTCAACCC

CDSR:TGTCGACTTGTTGATCGATCGGCCAAGG

Program thereby is that the PCR reaction conditions is as follows: 1. 94 ℃ 4 minutes, 2. 94 ℃ 30 seconds, 3. 58 ℃ 30 seconds, 4. 72 ℃ 1 minute 30 seconds, 5. from 2.-4. circulating 35 times, 6. 72 ℃ 15 minutes, 7. 4 ℃ of preservations.By the recovery of the recovery test kit of PCR product utilization Fermentas, (method is shown in this test kit specification sheets, article No. #K0513), (method is shown in this test kit specification sheets to the T-easy test kit of connection promega company, article No. A1380), order-checking obtains cloning for building overexpression vector without the TA of sudden change.

(2) structure of conversion carrier: the method for utilizing conventional enzyme to cut connection cuts and is connected into pCAMBIA 1301S carrier (practicing teacher Xing Ming by State Key Laboratory of Crop Genetic Improvent provides) by sequence from the TA clone, and Fig. 5 is shown in operating process.Utilize SmaI on primer and SalI restriction enzyme site CDS fragment enzyme to be cut to (restricted excision enzyme is purchased from precious biotechnology (Dalian) company limited, article No. is D1085A and D1080A, working method is referring to the specification sheets of this biomaterial), carrier also carries out enzyme by identical method and cuts, utilize the recovery test kit of Fermentas to reclaim that (working method is shown in the specification sheets of this test kit, article No. #K0513), utilize the T4 ligase(B0202S of NEB, method is shown in specification sheets), connecting product electricity conversion DH10B(electroporation used is eppendorf electroporator 2510, voltage parameter is 1800v, using method is shown in the electroporation specification sheets, intestinal bacteria DH10B bacterial strain is purchased from promega company), the connection product is applied on the LA plate containing the kantlex of 30mg/L, after 16h, picking list bacterium colony is in 1mL in the LB substratum containing the kantlex of 30mg/L, extract plasmid after cultivating 12h, (working method is shown in J. Pehanorm Brooker to utilize SmaI and SalI enzyme to cut the detection positive colony, EF is Ritchie not, T Manny A Disi work, Huang Peitang, Wang Jiaxi etc. translate, molecular cloning experiment guide (third edition), Science Press, 2002 editions).Positive colony is checked order, confirmed that the external source fragment is without sudden change.(3) transform precious Shan 97: the carrier electricity built in above-mentioned (2) is transformed into to Agrobacterium (A.tumefaciens) EHA105(purchased from Australian CAMBIA laboratory), method transforms referring to the electricity that connects product in above-mentioned (2).Transform the method (Hiei etc. of the method for precious Shan 97 with reference to the people such as Hiei report, Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium andsequence analysis of the boundaries of the T-DNA.Plant J, 1994,6:271-282) carry out.

The method of the key step of genetic transformation of the present invention, substratum and preparation thereof is as described below:

(1) reagent and solution abbreviation

In the present invention, the abbreviation of substratum plant hormone used is expressed as follows: 6-BA(6-BenzylaminoPurine, 6-benzyladenine); CN(Carbenicillin, Pyocianil); KT(Kinetin, kinetin); NAA(Napthalene acetic acid, naphthylacetic acid); IAA(Indole-3-acetic acid, indolylacetic acid); 2,4-D(2,4-Dichlorophenoxyacetic acid, 2,4 dichlorophenoxyacetic acid); AS(Acetosringone, Syringylethanone); CH(Casein Enzymatic Hydrolysate, caseinhydrolysate); HN(Hygromycin B, Totomycin); DMSO(Dimethyl Sulfoxide, dimethyl sulfoxide (DMSO)); N6max(N6 macroelement composition solution); N6mix(N6 Trace Elements solution); MSmax(MS macroelement composition solution); MSmix(MS Trace Elements solution)

(2) main solution formula

1) N6 substratum macroelement mother liquor (according to 10 times of concentrated solutions (10X) preparation):

Mentioned reagent is dissolved one by one, then under room temperature, with distilled water, be settled to 1000 milliliters.

2) N6 substratum trace element mother liquor (is prepared according to 100 times of concentrated solutions (100X)

Mentioned reagent is at room temperature dissolved and be settled to 1000 milliliters with distilled water.

3) molysite (Fe2EDTA) stock solution (according to the preparation of 100X concentrated solution)

3.73 gram b diammonium disodium edtas (Na2EDTA2H2O) and 2.78 gram FeSO47H2O are dissolved respectively, mix and be settled to 1000 milliliters with distilled water, bathe 2 hours to 70 ℃ of temperature, 4 ℃ save backup.

4) VITAMIN stock solution (according to the preparation of 100X concentrated solution)

Adding distil water is settled to 1000 milliliters, and 4 ℃ save backup.

5) MS substratum macroelement mother liquor (MSmax mother liquor) (according to the preparation of 10X concentrated solution)

Mentioned reagent is at room temperature dissolved, and be settled to 1000 milliliters with distilled water.

6) MS substratum trace element mother liquor (MSmin mother liquor) (according to the preparation of 100X concentrated solution)

Mentioned reagent is at room temperature dissolved, and be settled to 1000 milliliters with distilled water.

7) 2, the preparation of 4-D stock solution (1 mg/ml):

Weigh 100 milligrams of 2,4-D, dissolve 5 minutes with 1 milliliter of 1N potassium hydroxide, be settled to 100 milliliters after then adding 10 ml distilled water dissolve completes, preserve under room temperature.

8) preparation of 6-BA stock solution (1 mg/ml):

Weigh 100 milligrams of 6-BA, dissolve 5 minutes with 1 milliliter of 1N potassium hydroxide, be settled to 100 milliliters, room temperature preservation after then adding 10 ml distilled water dissolve completes.

9) preparation of naphthylacetic acid (NAA) stock solution (1 mg/ml):

Weigh 100 milligrams of NAA, dissolve 5 minutes with 1 milliliter of 1N potassium hydroxide, be settled to 100 milliliters after then adding 10 ml distilled water dissolve completes, 4 ℃ save backup.

10) preparation of indolylacetic acid (IAA) stock solution (1 mg/ml):

Weigh 100 milligrams of IAA, dissolve 5 minutes with 1 milliliter of 1N potassium hydroxide, be settled to 100 milliliters after then adding 10 ml distilled water dissolve completes, 4 ℃ save backup.

11) preparation of glucose stock solution (0.5 grams per milliliter):

Weigh glucose 125 grams, then with distilled water, dissolve and be settled to 250 milliliters, after sterilizing, 4 ℃ save backup.

12) preparation of AS stock solution:

Weigh AS 0.392 gram, add 10 milliliters of dissolvings of DMSO, divide and be filled in 1.5 milliliters of centrifuge tubes, 4 ℃ save backup.

13) 1N potassium hydroxide stock solution

Weigh potassium hydroxide 5.6 grams, with distilled water, dissolve and be settled to 100 milliliters, room temperature preservation is standby.

(3) for the culture medium prescription of rice transformation

1) inducing culture

Adding distil water to 900 milliliter, 1N potassium hydroxide is regulated pH value to 5.9, boil and be settled to 1000 milliliters, divide and install to 50 milliliters of triangular flasks (25 milliliters/bottle), sterilizing according to a conventional method after sealing (for example 121 ℃ of lower sterilizings are 25 minutes, and following medium sterilization method is identical with the sterilising method of basal culture medium).

2) subculture medium

Adding distil water to 900 milliliter, 1N potassium hydroxide is regulated pH value to 5.9, boils and is settled to 1000 milliliters, divides and installs to 50 milliliters of triangular flasks (25 milliliters/bottle), sealing, sterilizing as stated above.

3) pre-culture medium

Adding distil water to 250 milliliter, 1N potassium hydroxide is regulated pH value to 5.6, sealing, sterilizing as stated above.

Use front heating for dissolving substratum and add 5 milliliters of glucose stock solutions and 250 microlitre AS stock solutions, (25 milliliters/ware) in culture dish are poured in packing into.

4) be total to substratum

Adding distil water to 250 milliliter, 1N potassium hydroxide is regulated pH value to 5.6, sealing, sterilizing as stated above.

Use front heating for dissolving substratum and add 5 milliliters of glucose stock solutions and 250 microlitre AS stock solutions, (25 milliliters/every ware) in culture dish are poured in packing into.

5) suspension medium

Adding distil water to 100 milliliter, regulate pH value to 5.4, divides in the triangular flask that installs to two 100 milliliters sealing, sterilizing as stated above.

Add 1 milliliter of aseptic glucose stock solution and 100 microlitre AS stock solutions before use.

6) select substratum

Adding distil water to 250 milliliter, regulate pH value to 6.0, sealing, sterilizing as stated above.

Dissolve substratum before using, add 250 microlitre HN(50 mg/ml) and 400 microlitre CN(250 mg/ml) packing pours (25 milliliters/ware) in culture dish into.(annotate: selecting for the first time substratum Pyocianil concentration is 400 mg/litre, and selecting substratum Pyocianil concentration after reaching for the second time is 250 mg/litre).

7) pre-division culture medium

Adding distil water to 250 milliliter, 1N potassium hydroxide is regulated pH value to 5.9, sealing, sterilizing as stated above.

Dissolve substratum, 250 microlitre HN(50 mg/ml before using) 250 microlitre CN(250 mg/ml), (25 milliliters/ware) in culture dish are poured in packing into.

8) division culture medium

Adding distil water to 900 milliliter, 1N potassium hydroxide is regulated pH value to 6.0.

Boil and be settled to 1000 milliliters with distilled water, dividing and install to 50 milliliters of triangular flasks (50 milliliters/bottle), sealing, sterilizing as stated above.

9) root media

Adding distil water to 900 milliliter, regulate pH value to 5.8 with 1N potassium hydroxide.

Boil and be settled to 1000 milliliters with distilled water, dividing and install to (25 milliliters/pipe) in the pipe of taking root, sealing, sterilizing as stated above.

(4) agriculture bacillus mediated genetic transformation step

Callus of induce

Ripe precious Shan 97 rice paddy seeds are shelled, then use successively 70% Ethanol Treatment 1 minute, 0.15% mercury chloride (HgCl2) seed-coat sterilization 15 minutes;

Wash seed 4-5 time with sterilizing;

Seed is placed on inducing culture;

Postvaccinal substratum is placed in to dark place and cultivates 4 weeks, 25 ± 1 ℃ of temperature.

3.2 callus subculture

Select the embryo callus subculture of glassy yellow, consolidation and relatively dry, be put in dark lower the cultivation 2 weeks on subculture medium, 25 ± 1 ℃ of temperature.

3.3 preculture

Select the embryo callus subculture of consolidation and relatively dry, be put in dark lower the cultivation 2 weeks on pre-culture medium, 25 ± 1 ℃ of temperature.

3.4 Agrobacterium is cultivated

1) at the LA substratum of selecting with corresponding resistance, (preparation of LA substratum is with reference to J. Pehanorm Brooker etc., the molecular cloning experiment guide, the third edition, Jin Dongyan etc. (translating), Science Press, 2002, Beijing) agrobacterium strains that upper this bacterial strain of preculture Agrobacterium EHA105(is openly used from CAMBIA company) two days, 28 ℃ of temperature;

Agrobacterium is transferred in suspension medium, cultivates 2-3 hour on 28 ℃ of shaking tables.

3.5 Agrobacterium is infected

1) pre-incubated callus is transferred in the bottle of the bacterium of having gone out;

Regulate the suspension of Agrobacterium to OD600 0.8-1.0;

Callus is soaked 30 minutes in agrobacterium suspension;

Shift callus blots to the good filter paper of sterilizing; Then be placed on common substratum and cultivate 3 days, temperature 19-20 ℃.

3.6 callus washing and selection are cultivated

1) aqua sterilisa washing callus is to cannot see Agrobacterium;

Be immersed in containing in the aqua sterilisa of 400 milligrams/L Pyocianil (CN) 30 minutes;

Shift callus blots to the good filter paper of sterilizing;

Shift callus to selecting on substratum to select cultivation 2-3 time, each 2 weeks.

3.7 differentiation

1) kanamycin-resistant callus tissue is transferred on pre-division culture medium and cultivates 5-7 days in the dark place;

Shift the callus of pre-differentiation culture to division culture medium, cultivate under illumination, 26 ℃ of temperature.

3.8 take root

1) cut the root that differentiation phase produces;

Then transfer them in root media and cultivate 2-3 week, 26 ℃ of temperature under illumination.

3.9 transplant

Wash the residual substratum on root off, the seedling that will have good root system proceeds to the land for growing field crops isolation environment, and field management is with common land for growing field crops.

The plant obtained is transgenosis T0 generation, utilize T0 for selfing obtain T1 for family for investigating phenotype.The indel primer amplification of the identification and utilization 8bp deletion design of transgenic positive individual plant, complete on 8%PAGE glue that (method is with reference to the Genome fingerprinting by simple sequence repeat (SSR) such as Zietkiewicz-anchored polymerase chain reaction amplification, genomecs, 1994).The heterozygosis banding pattern is the transgenic positive individual plant, and the pure and mild banding pattern of precious Shan 97 is entirely negative.

(4) transgenosis T1 investigates for the plant phenotype: Wuhan positive season plantation T1, for plant, investigates plant height to T1 for each family, and heading stage and every fringe grain husk are spent number, and concrete outcome is shown in accompanying drawing 6 and table 2.Result shows that all transgenic positive individual plants compare and all have delay heading stage with negative individual plant, increases the phenotype that every fringe grain husk spends number and plant height to uprise, and has confirmed that this section sequence has control heading stage, and every fringe grain husk is spent the function of several and plant height.

Table 2 transgenosis T1 investigates for each family phenotype

Claims (3)

1. the application of the major gene Ghd7-1 of a pleiotropic gene in controlling rice yield, flowering period and plant height, is characterized in that the nucleotide sequence of this major gene is as shown in sequence table SEQ ID NO:1.

2. the allelotrope of major gene claimed in claim 1, is characterized in that this allelic nucleotide sequence is as shown in sequence table SEQ ID NO:3.

3. the allelotrope of major gene claimed in claim 1, is characterized in that this allelic nucleotide sequence is as shown in sequence table SEQ ID NO:5.

Images