CN103421776A - Genome-specific molecular marker primer of annual diploid dasypyrum villosum and application of primer - Google Patents
Genome-specific molecular marker primer of annual diploid dasypyrum villosum and application of primer Download PDFInfo
- Publication number
- CN103421776A CN103421776A CN2013103619108A CN201310361910A CN103421776A CN 103421776 A CN103421776 A CN 103421776A CN 2013103619108 A CN2013103619108 A CN 2013103619108A CN 201310361910 A CN201310361910 A CN 201310361910A CN 103421776 A CN103421776 A CN 103421776A
- Authority
- CN
- China
- Prior art keywords
- annual
- wheat
- dasypyrum villosum
- dasypyrum
- villosum
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention provides a deoxyribonucleotide sequence of a PCR (polymerase chain reaction)-based genome-specific molecular marker primer (which is an optional one of primer pairs of DV1, DV5 and DV11) of annual diploid dasypyrum villosum and application of a molecular marker to detecting genetic materials of the dasypyrum villosum.
Description
Technical field
The invention belongs to plant biotechnology field, be specifically related to the deoxyribonucleotide sequence of annual Dasypyrum villosum specific molecular marker primer, and this is marked at the purposes detected in annual Dasypyrum villosum genetic material.
Background technology
Wheat (Triticum aestivum L.) is the second largest food crop that are only second to paddy rice in China, and since the nineties in 20th century, China has become the first big country that produces in the world wheat.The stably manufactured of wheat, significant to the crisis in food problem that solves China.And wheat diseases is to threaten wheat stable yields, the important factor of high yield.It is most economical, effective, the safe method of control wheat diseases that good resistance is imported in wheat.
Annual Dasypyrum villosum (Dasypyrum villosum), as the important genetic resources of wheat improvement, shows numerous good resistances.Such as, (mildew-resistance sees reference document: Qi LL, ChenPD, Liu DJ, Zhou B, Zhang SZ The gene Pm21-a new source of resistanceto wheat powdery mildew.Acta Agron Sin (1995b) 21:257 – 262), (Resistant Gene To Rust sees reference document: Yildirim A, Jones SS, Murray TD, Line RF (2000) Evaluationof D.villosum populations for resistance to cereal eyespot and stripe rustpathogens.Plant Dis84:40 – 44), (anti-eye spot sees reference document: Yildirim A, JonesSS, Murray TD (1997) Mapping of a new eyespot resistance gene, Pch3, inwheat.In:Plant and animal genome-V conference, AbstrP186.http: //www.intl-pag.org/5/abstracts/p-5c-186.html), and abiotic stress resistance (document sees reference: Scarascia Mugnozza GT, De Pace C, Tanzarella OA (1982) Haynaldia villosa (L.) Schur.:una specie di potenziale valore per ilmiglioramento genetico del frumento.I.Analisi di alcuni caratterimorfologici.Genet Agr36:76-77).(document sees reference: Chen to be positioned at the Pm21 gene gene best to powder mildew resistance as China on annual Dasypyrum villosum 6V the short arm of a chromosome, P.D., Qi, L.L., Zhou, B., S.Z.Zhang, D.J.Liu.Development andmolecular cytogenetic analysis of wheat-Haynaldia villosa6VS/6ALtranslocation lines specifying resistance to powderymildew.TAG, 1995, (91): 1125-1128.) be transferred in the wheat genetic background, in the wheat resistance breeding, extensively utilized.In order will more and more to transfer in the wheat genetic background from the good resistance of annual Dasypyrum villosum, (some wheat-haynaldia villosa addition lines see reference document: Sears ER (1953) Addition of the genome of H.villosa to T.aestivum.Am J Bot40:168-174), (substitution line sees reference document: Liu DJ, Chen PD, Wang YN, Qiui BX, Wang SL (1988) Transfer of Haynaldia villosa chromosomes intoTriticum aestivum.In:Miller TE, Koebner RMD (eds) Proc7th Int WheatGenet Symp, Cambridge, UK, pp355-361.), (translocation line sees reference document: Li H, Chen X, Xin ZY, Ma YZ, Xu HJ, Chen XY et al (2005) Development andidentification of wheat Haynaldia villosa T6DL.6VS chromosometranslocation lines conferring resistance to powdery mildew.Plant Breeding124:203-205.) and the double diploid material (document sees reference: De Pace C, BenedettelliS, Qualset CO, Hart GE, Scarascia Mugnozza GT, Delre V et al (1988) Biochemical markers in Triticum x Dasypyrum amphiploids and deriveddisomic addition lines.In:Miller TE, Koebner, RMD (eds) Proc7th IntWheat Genet Symp, Cambridge, UK, pp503-509) formulated out successively.
Along with annual Dasypyrum villosum genetic material is transferred in the wheat genetic background more and more, the kind specific molecular marker of PCR-based is with its characteristics easily, fast and accurately, (document sees reference: Scarascia Mugnozza GT to become the effective means that detects the exogenic heredity species, DePace C, Tanzarella OA (1982) Haynaldia villosa (L.) Schur.:una specie dipotenziale valore per il miglioramento genetico del frumento.I.Analisi dialcuni caratteri morfologici.Genet Agr36:76-77).Up to now; developed and obtained several annual Dasypyrum villosum specific molecular markers few in number (document sees reference: Liu SB; Tang ZH; You MS; Li BY; Song JM, Liu GT (2003) Development andapplication of a genome-specific PCR marker for Haynaldia villosa.J GenetGenom30:350 – 356; Liu SB, Tang ZH, You MS, Li BY, Song JM, Liu GT (2003) Development and application of a genome-specific PCR marker forHaynaldia villosa.J Genet Genom30:350 – 356).These molecule markers will lay the foundation for molecular mark, accelerate the transfer of annual Dasypyrum villosum good character to the wheat genetic background.
Summary of the invention
The object of the present invention is to provide the deoxyribonucleotide sequence of molecule marker primer of annual Dasypyrum villosum (Dasypyrumvillosum) genome specific of PCR-based, and this is marked at the usage detected in annual Dasypyrum villosum genetic material.
To achieve the object of the present invention, the technical solution used in the present invention is as follows:
The invention provides annual Dasypyrum villosum (Dasypyrum villosum) genome specific molecule marker primer, described primer is primer pair DV1, DV5, and a pair of arbitrarily in DV11,
Wherein, the deoxyribonucleotide sequence of primer pair DV1 is:
DV1F：5'-ACTCTGAGTTCGTCGCTAACACAA-3'；
DV1R：5'-GCCGGATTGTTGTTGATTTGAC-3'。
According to random primer, (sequence: 5'-AGGGGTCTTG-3'') expand in annual Dasypyrum villosum and specific band by after its recovery order-checking, the design primer obtains this primer pair.The wheat product (kind) that this primer pair can be formulated out durum-h. villosa Amphidiploid, wheat-haynaldia villosa 1-7V addition line and contain annual Dasypyrum villosum genetic material at annual Dasypyrum villosum, itself and durum wheat, wheat distance edge hybrid are the middle specific fragment that 317bp that expands.And the wheat line that does not contain annual Dasypyrum villosum genetic material can't amplify this purpose band.The DNA sequence of this band is:
ACTCTGAGTTCGTCGCTAACACAAACGCGCAGAGTGGCGGTCAGCACCGAAAGAACAATGGTAAACCGCCACGCCCGCAGCGCGGTGACGGTTCAGGGATCAACTTGGAAGCCATGCTCAACCAGCCTTGTCCGAAGCACGGGACCAAGGAAAAACCGGCGCAGCACCTCTGGAAGGACTGCCACATCATGAAGGCTTTAAAAAATTCTTCGTTTTCAGATGACCATAACTCAGGAGGAGGTTTAGGATCGGGTTACAGCAATGGTAACTCAGGATCTGGTTTTCAGGGTAACCAGTCAAATCAACAACAATCCGGC。
Wherein, the deoxyribonucleotide sequence of primer pair DV5 is:
DV5F：5’-TCTGCCAACGATAGCCTCCTG-3’；
DV5R：5’-ACACGAGCAGATGACCACTCAGC-3’。
According to random primer, (sequence: 5'-GATGACCGCC-3') expand in annual Dasypyrum villosum and specific band by after its recovery order-checking, the design primer obtains this primer pair.The wheat breed (being) that this primer pair can be formulated out durum-h. villosa Amphidiploid, wheat-haynaldia villosa 1-7V addition line and contain the cluster hair wheat genetic material at annual Dasypyrum villosum, itself and durum wheat, wheat distance edge hybrid is planted and can be expanded the specific fragment that 288bp.And the wheat line that does not contain annual Dasypyrum villosum genetic material can't amplify this purpose band.The DNA sequence of this band is:
TCTGCCAACGATAGCCTCCTGCGGGATTGGGAGTCCCAAATCGGCTAGACGGGTATAGTACCCGGACATCCTCAGTAAGTGTTCACTGACAGACGAATTCTCCTCCATCTTGCAAGTGAAGAACTTATCGGAGACTTCATATCTCTCGATCTTAGCATTCTTCTCAAAGATAAACTTCAACTCATGGAACATCTCATATGCCCCATGATGTTCAAAACGTCGTTGAAGTCCTCCTTCCAAGCTTAACAAGATGGCACACTGCACAGCTGAGTGGTCATCTGCTCGTGT。
Wherein, the deoxyribonucleotide sequence of primer pair DV11 is:
DV11F:5’-TGATCCTCCCTACTCCCACATAATA-3’；
DV11R:5’-GGATTGTCACATCATGAAGGCTTAC-3’。
According to random primer, (sequence: 5'-GACGGATCAG-3') expand in annual Dasypyrum villosum and specific band by after its recovery order-checking, the design primer obtains this primer pair.The wheat breed (being) that this primer pair can be formulated out durum-h. villosa Amphidiploid, wheat-haynaldia villosa 1-7V addition line and contain annual Dasypyrum villosum genetic material at annual Dasypyrum villosum, itself and durum wheat, wheat distance edge hybrid is planted and can be expanded the specific fragment that 359bp.And the wheat line that does not contain annual Dasypyrum villosum genetic material can't amplify this purpose band.The DNA sequence of this band is:
TGATCCTCCCTACTCCCACATAATAGGCTGCTTCTGACCACCGCAGATATTGGGGAATCACCGGTTCAACGGCGTTAACAGATCTCTTCCGGAGTTTTTGATCACGTTTGCATAGGCTTGTTGTGAAAACATGGTACTGCCCACTGCTTAACTGCTTTGGATTACTCTGGTAGCTTGACTGCTGCTGTTGGCCCCCTTGGCCGGATTGTTGTTGATTTGACTGGTTGCCGTGAAAACCGGATCTAGAGTTACCATTACCATAACCCGGACCCTGAAAACCGGATCCTGAACCGCCTCCAGAACCGCGGTCGTCTTGAAACGAAGTGGAATTTTTGTAAGCCTTCATGATGTGACAATCC。
The present invention also provides the purposes of a kind of above-mentioned annual Dasypyrum villosum genome specific molecule marker primer in detecting annual Dasypyrum villosum genetic material.
In such use provided by the invention, the method that detects annual Dasypyrum villosum genetic material comprises the steps:
(1), adopt the CTAB method to extract plant genomic dna to be detected, extraction step is as follows:
1) get the fresh young leaflet tablet of 2g, liquid nitrogen grinding adds the 2 * CTAB extracting solution (2%CTAB that is preheated to 65 ℃ after becoming fine powder; 1.4M NaCl, 0.1M Tris-HCl, pH8.0,0.1M EDTA, pH8.0) 15ml, mix.
2) 65 ℃ of water-bath 30-45min, jog mixes therebetween.Be cooled to after room temperature and add isopyknic chloroform: primary isoamyl alcohol (24:1) mixes gently to supernatant liquor and is the milk shape, the centrifugal 10min of 4000rpm.
3) get supernatant liquor, add the equal-volume Virahol, be placed in ice bath precipitation DNA.
4) tick DNA, wash 2 times with 70% alcohol, dehydrated alcohol is washed once the dry DNA of gas, is dissolved in 1 * TE solution of appropriate pH8.0.Add the RNA enzyme to final concentration 100 μ g/ μ l.
5), under the 100V constant voltage, 1% agarose gel electrophoresis 30 minutes, detect DNA concentration and quality.
(2), pcr amplification:
Reaction system is as follows:
The PCR reaction is carried out in PTC-200 type PCR instrument (MJ Research, U.S.A.).Primer DV1, DV5, DV11 amplified production separate on 1% sepharose, and 100V constant voltage electrophoresis is after 40 minutes, the EB staining examine.Result as Figure 1-3.As seen from the figure, annual Dasypyrum villosum, durum-h. villosa Amphidiploid, wheat-haynaldia villosa 1-7V addition line and the wheat breed (being) that contains annual Dasypyrum villosum blood relationship can amplify purpose fragment (Dv1:317bp; Dv5:288bp; Dv11:395bp), do not contain the wheat of annual Dasypyrum villosum blood relationship and the sibling species genus of wheat and can not amplify the purpose fragment.
Beneficial effect of the present invention:
Adopt any one in 3 molecule markers disclosed by the invention, can utilize the method for polymerase chain reaction (PCR), the annual Dasypyrum villosum genetic material in the wheat that effectively increases (but being not limited only to wheat) genetic background; Also can be using any one pcr amplified fragment obtained in 3 molecule markers disclosed by the invention as probe, utilize fluorescence in situ hybridization (FISH), the methods such as Southern hybridization detect the annual Dasypyrum villosum genetic material in wheat (but being not limited only to wheat) genetic background.Molecule marker provided by the invention is used in the molecular marker assisted selection breeding process, follow the trail of quickly and efficiently the genetic material of annual Dasypyrum villosum, be conducive to accelerate transfer and the utilization of annual Dasypyrum villosum good character to the acceptor kind, accelerate breeding process, improve the efficiency of new quality seed selection.
The accompanying drawing explanation
Fig. 1 is the amplification of primer DV1 in different wheats.M:Marker (Trans2K plus II); 1: annual Dasypyrum villosum; 2: durum-h. villosa Amphidiploid; 3: the 1V chromosome addition system of annual Dasypyrum villosum in common wheat; 4: the 2V chromosome addition system of annual Dasypyrum villosum in common wheat; 5: the 3V chromosome addition system of annual Dasypyrum villosum in common wheat; 6: the 4V chromosome addition system of annual Dasypyrum villosum in common wheat; 7: the 5V chromosome addition system of annual Dasypyrum villosum in common wheat; 8: the 6V chromosome addition system of annual Dasypyrum villosum in common wheat; 9: the 7V chromosome addition system of annual Dasypyrum villosum in common wheat; 10: the wheat line that contains annual Dasypyrum villosum blood relationship (kind) 9R178,11: the interior wheat of the wheat line that contains annual Dasypyrum villosum blood relationship (kind) No. 9,12: the interior wheat of the wheat line that contains annual Dasypyrum villosum blood relationship (kind) No. 8; 13: durum wheat (Ttiticum durum); 14: partially protruding goatweed (Aegilops ventricosa); 15: the wheat breed China spring (Triticum aestivum) that does not contain annual Dasypyrum villosum blood relationship; 16: rye (Secale cereale L.);
Fig. 2 is the amplification of primer DV5 in different wheats.M:Marker (Trans2K plus II); 1: annual Dasypyrum villosum; 2: durum-h. villosa Amphidiploid; 3: the 1V chromosome addition system of annual Dasypyrum villosum in common wheat; 4: the 2V chromosome addition system of annual Dasypyrum villosum in common wheat; 5: the 3V chromosome addition system of annual Dasypyrum villosum in common wheat; 6: the 4V chromosome addition system of annual Dasypyrum villosum in common wheat; 7: the 5V chromosome addition system of annual Dasypyrum villosum in common wheat; 8: the 6V chromosome addition system of annual Dasypyrum villosum in common wheat; 9: the 7V chromosome addition system of annual Dasypyrum villosum in common wheat; 10: the wheat line that contains annual Dasypyrum villosum blood relationship (kind) 9R178,11: the interior wheat of the wheat line that contains annual Dasypyrum villosum blood relationship (kind) No. 9,12: the interior wheat of the wheat line that contains annual Dasypyrum villosum blood relationship (kind) No. 8; 13: durum wheat (Ttiticum durum); 14: partially protruding goatweed (Aegilops ventricosa); 15: the wheat breed China spring (Triticum aestivum) that does not contain annual Dasypyrum villosum blood relationship; 16: rye (Secale cereale L.);
Fig. 3 is the amplification of primer DV11 in different wheats.M:Marker (Trans2Kplus II); 1: annual Dasypyrum villosum; 2: durum-h. villosa Amphidiploid; 3: the 1V chromosome addition system of annual Dasypyrum villosum in common wheat; 4: the 2V chromosome addition system of annual Dasypyrum villosum in common wheat; 5: the 3V chromosome addition system of annual Dasypyrum villosum in common wheat; 6: the 4V chromosome addition system of annual Dasypyrum villosum in common wheat; 7: the 5V chromosome addition system of annual Dasypyrum villosum in common wheat; 8: the 6V chromosome addition system of annual Dasypyrum villosum in common wheat; 9: the 7V chromosome addition system of annual Dasypyrum villosum in common wheat; 10: the wheat line that contains annual Dasypyrum villosum blood relationship (kind) 9R178,11: the interior wheat of the wheat line that contains annual Dasypyrum villosum blood relationship (kind) No. 9,12: the interior wheat of the wheat line that contains annual Dasypyrum villosum blood relationship (kind) No. 8; 13: durum wheat (Ttiticum durum); 14: partially protruding goatweed (Aegilops ventricosa); 15: the wheat breed China spring (Triticum aestivum) that does not contain annual Dasypyrum villosum blood relationship; 16: rye (Secale cereale L.);
Embodiment
Explain the present invention below in conjunction with embodiment.Embodiment is for ease of better understanding the present invention, but limitation of the present invention not.Experimental technique in following implementation method is ordinary method, and related experiment material is routine biochemistry reagent.
Embodiment 1:
It is test material that the wheat breed (being) of take annual Dasypyrum villosum, durum-h. villosa Amphidiploid, wheat-haynaldia villosa 1-7V addition line and containing annual Dasypyrum villosum blood relationship and the sibling species of the wheat that does not contain annual Dasypyrum villosum blood relationship and wheat belong to, and with DV1, it is identified:
1), adopt the CTAB method to extract wheat cdna group DNA, extraction step is as follows:
(1) get the fresh young leaflet tablet of 2g, liquid nitrogen grinding adds the 2 * CTAB extracting solution (2%CTAB that is preheated to 65 ℃ after becoming fine powder; 1.4M NaCl, 0.1M Tris-HCl, pH8.0,0.1M EDTA, pH8.0) 15ml, mix.
(2) 65 ℃ of water-bath 30-45min, jog mixes therebetween.Be cooled to after room temperature and add isopyknic chloroform: primary isoamyl alcohol (24:1) mixes gently to supernatant liquor and is the milk shape, the centrifugal 10min of 4000rpm.
(3) get supernatant liquor, add the equal-volume Virahol, be placed in ice bath precipitation DNA.
(4) tick DNA, wash 2 times with 70% alcohol, dehydrated alcohol is washed once the dry DNA of gas, is dissolved in 1 * TE solution of appropriate pH8.0.Add the RNA enzyme to final concentration 100 μ g/ μ l.
(5), under the 100V constant voltage, 1% agarose gel electrophoresis 30 minutes, detect DNA concentration and quality.
2), pcr amplification:
Reaction system is as follows:
The PCR reaction is carried out in PTC-200 type PCR instrument (MJ Research, U.S.A.).Primer DV1 amplified production separates on 1% sepharose, and 100V constant voltage electrophoresis is after 40 minutes, the EB staining examine.Result is as Fig. 1, as shown in Figure 1, annual Dasypyrum villosum (swimming lane 1), durum-h. villosa Amphidiploid (swimming lane 2), wheat-haynaldia villosa 1-7V chromosome addition system (swimming lane 3-9), the wheat line that contains annual Dasypyrum villosum blood relationship (kind) (swimming lane 10-12) can amplify obvious purpose fragment 317bp, and all the other sibling specieses of common wheat belong to durum wheat (swimming lane 13), partially protruding goatweed (swimming lane 14), rye (swimming lane 16) and containing the wheat breed China spring (swimming lane 13) of annual Dasypyrum villosum blood relationship, can not amplify the purpose fragment of 317bp.
Embodiment 2:
It is test material that the wheat breed (being) of take annual Dasypyrum villosum, durum-h. villosa Amphidiploid, wheat-haynaldia villosa 1-7V addition line and containing annual Dasypyrum villosum blood relationship and the sibling species of the wheat that does not contain annual Dasypyrum villosum blood relationship and wheat belong to, and with Dv5, it is identified:
1), adopt the CTAB method to extract wheat cdna group DNA, extraction step is as follows:
(1) get the fresh young leaflet tablet of 2g, liquid nitrogen grinding adds the 2 * CTAB extracting solution (2%CTAB that is preheated to 65 ℃ after becoming fine powder; 1.4M NaCl, 0.1M Tris-HCl, pH8.0,0.1M EDTA, pH8.0) 15ml, mix.
(2) 65 ℃ of water-bath 30-45min, jog mixes therebetween.Be cooled to after room temperature and add isopyknic chloroform: primary isoamyl alcohol (24:1) mixes gently to supernatant liquor and is the milk shape, the centrifugal 10min of 4000rpm.
(3) get supernatant liquor, add the equal-volume Virahol, be placed in ice bath precipitation DNA.
(4) tick DNA, wash 2 times with 70% alcohol, dehydrated alcohol is washed once the dry DNA of gas, is dissolved in 1 * TE solution of appropriate pH8.0.Add the RNA enzyme to final concentration 100 μ g/ μ l.
(5), under the 100V constant voltage, 1% agarose gel electrophoresis 30 minutes, detect DNA concentration and quality.
2), pcr amplification:
Reaction system is as follows:
The PCR reaction is carried out in PTC-200 type PCR instrument (MJ Research, U.S.A.).Primer DV5 amplified production separates on 1% sepharose, and 100V constant voltage electrophoresis is after 40 minutes, the EB staining examine.Result is as Fig. 2, as shown in Figure 2, annual Dasypyrum villosum (swimming lane 1), durum-h. villosa Amphidiploid (swimming lane 2), wheat-haynaldia villosa 1-7V chromosome addition system (swimming lane 3-9), the wheat line that contains annual Dasypyrum villosum blood relationship (kind) (swimming lane 10-12) can amplify obvious purpose fragment 288bp, and all the other sibling specieses of common wheat belong to durum wheat (swimming lane 13), partially protruding goatweed (swimming lane 14), rye (swimming lane 16) and containing the wheat breed China spring (swimming lane 13) of annual Dasypyrum villosum blood relationship, can not amplify the purpose fragment of 288bp.
Embodiment 3:
It is test material that the wheat breed (being) of take annual Dasypyrum villosum, durum-h. villosa Amphidiploid, wheat-haynaldia villosa 1-7V addition line and containing annual Dasypyrum villosum blood relationship and the sibling species of the wheat that does not contain annual Dasypyrum villosum blood relationship and wheat belong to, and with Dv11, it is identified:
1), adopt the CTAB method to extract wheat cdna group DNA, extraction step is as follows:
(1) get the fresh young leaflet tablet of 2g, liquid nitrogen grinding adds the 2 * CTAB extracting solution (2%CTAB that is preheated to 65 ℃ after becoming fine powder; 1.4M NaCl, 0.1M Tris-HCl, pH8.0,0.1M EDTA, pH8.0) 15ml, mix.
(2) 65 ℃ of water-bath 30-45min, jog mixes therebetween.Be cooled to after room temperature and add isopyknic chloroform: primary isoamyl alcohol (24:1) mixes gently to supernatant liquor and is the milk shape, the centrifugal 10min of 4000rpm.
(3) get supernatant liquor, add the equal-volume Virahol, be placed in ice bath precipitation DNA.
(4) tick DNA, wash 2 times with 70% alcohol, dehydrated alcohol is washed once the dry DNA of gas, is dissolved in 1 * TE solution of appropriate pH8.0.Add the RNA enzyme to final concentration 100 μ g/ μ l.
(5), under the 100V constant voltage, 1% agarose gel electrophoresis 30 minutes, detect DNA concentration and quality.
2), pcr amplification:
Reaction system is as follows:
The PCR reaction is carried out in PTC-200 type PCR instrument (MJ Research, U.S.A.).Primer DV11 amplified production separates on 1% sepharose, and 100V constant voltage electrophoresis is after 40 minutes, the EB staining examine.Result is as Fig. 3, as shown in Figure 3, annual Dasypyrum villosum (swimming lane 1), durum-h. villosa Amphidiploid (swimming lane 2), wheat-haynaldia villosa 1-7V chromosome addition system (swimming lane 3-9), the wheat line that contains annual Dasypyrum villosum blood relationship (kind) (swimming lane 10-12) can amplify obvious purpose fragment 359bp, and all the other sibling specieses of common wheat belong to durum wheat (swimming lane 13), partially protruding goatweed (swimming lane 14), rye (swimming lane 16) and containing the wheat breed China spring (swimming lane 13) of annual Dasypyrum villosum blood relationship, can not amplify the purpose fragment of 359bp.
Claims (5)
1. annual Dasypyrum villosum (Dasypyrum villosum) genome specific molecule marker primer, is characterized in that, described primer is primer pair DV1, DV5, and a pair of arbitrarily in DV11, wherein
The deoxyribonucleotide sequence of DV1 primer pair is
DV1F：5'-ACTCTGAGTTCGTCGCTAACACAA-3'；
DV1R：5'-GCCGGATTGTTGTTGATTTGAC-3'；
The deoxyribonucleotide sequence of DV5 primer pair is
DV5F：5’-TCTGCCAACGATAGCCTCCTG-3’；
DV5R：5’-ACACGAGCAGATGACCACTCAGC-3’；
The deoxyribonucleotide sequence of DV11 primer pair is
DV11F:5’-TGATCCTCCCTACTCCCACATAATA-3’；
DV11R:5’-GGATTGTCACATCATGAAGGCTTAC-3’。
2. annual Dasypyrum villosum according to claim 1 (Dasypyrum villosum) genome specific molecule marker primer, it is characterized in that, the wheat product (kind) that primer pair DV1 can formulate out durum-h. villosa Amphidiploid, wheat-haynaldia villosa 1-7V addition line and contain annual Dasypyrum villosum genetic material at annual Dasypyrum villosum, itself and durum wheat, wheat distance edge hybrid are the middle specific fragment that 317bp that expands.
3. annual Dasypyrum villosum according to claim 1 (Dasypyrum villosum) genome specific molecule marker primer, it is characterized in that, the wheat breed (being) that primer pair DV5 can formulate out durum-h. villosa Amphidiploid, wheat-haynaldia villosa 1-7V addition line and contain annual Dasypyrum villosum genetic material at annual Dasypyrum villosum, itself and durum wheat, wheat distance edge hybrid is planted and can be expanded the specific fragment that 288bp.
4. annual Dasypyrum villosum according to claim 1 (Dasypyrum villosum) genome specific molecule marker primer, it is characterized in that, the wheat breed (being) that primer pair DV11 can formulate out durum-h. villosa Amphidiploid, wheat-haynaldia villosa 1-7V addition line and contain annual Dasypyrum villosum genetic material at annual Dasypyrum villosum, itself and durum wheat, wheat distance edge hybrid is planted and can be expanded the specific fragment that 359bp.
5. the purposes of the described annual Dasypyrum villosum of any one (Dasypyrumvillosum) genome specific molecule marker primer in detecting annual Dasypyrum villosum genetic material in claim 1-4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310361910.8A CN103421776B (en) | 2013-08-19 | 2013-08-19 | Genome-specific molecular marker primer of annual diploid dasypyrum villosum and application of primer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310361910.8A CN103421776B (en) | 2013-08-19 | 2013-08-19 | Genome-specific molecular marker primer of annual diploid dasypyrum villosum and application of primer |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103421776A true CN103421776A (en) | 2013-12-04 |
| CN103421776B CN103421776B (en) | 2015-07-15 |
Family
ID=49647169
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310361910.8A Expired - Fee Related CN103421776B (en) | 2013-08-19 | 2013-08-19 | Genome-specific molecular marker primer of annual diploid dasypyrum villosum and application of primer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103421776B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106755507A (en) * | 2017-02-07 | 2017-05-31 | 电子科技大学 | Differentiate the molecular detecting method of cultivation rye and wild chromosomes of rye |
| CN112410451A (en) * | 2020-11-11 | 2021-02-26 | 中国科学院成都生物研究所 | Primer, detection method and application for specific KASP marker detection of diploid haynaldia villosa 3V chromosome |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101121945A (en) * | 2007-06-29 | 2008-02-13 | 天津师范大学 | Special RAPD molecule marker for wheat 6VS |
-
2013
- 2013-08-19 CN CN201310361910.8A patent/CN103421776B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101121945A (en) * | 2007-06-29 | 2008-02-13 | 天津师范大学 | Special RAPD molecule marker for wheat 6VS |
Non-Patent Citations (3)
| Title |
|---|
| JIE ZHANG ET AL: "Characterization of a genome-specific Gypsy-like retrotransposon sequence and development of a molecular marker specific for Dasypyrum villosum(L.)", 《JOURNAL OF GENETICS》, vol. 92, no. 1, 30 April 2013 (2013-04-30) * |
| 刘守斌等: "簇毛麦染色体组特异性RAPD标记的筛选、定位和应用", 《遗传学报》, vol. 29, no. 5, 31 December 2002 (2002-12-31), pages 453 - 457 * |
| 唐祖强等: "簇毛麦5V染色体特异性ISSR标记的建立及其对亲缘物种的检测", 《农业生物技术学报》, vol. 15, no. 5, 31 December 2007 (2007-12-31), pages 799 - 804 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106755507A (en) * | 2017-02-07 | 2017-05-31 | 电子科技大学 | Differentiate the molecular detecting method of cultivation rye and wild chromosomes of rye |
| CN106755507B (en) * | 2017-02-07 | 2020-07-28 | 电子科技大学 | Molecular detection method for distinguishing chromosomes of cultivated rye and wild rye |
| CN112410451A (en) * | 2020-11-11 | 2021-02-26 | 中国科学院成都生物研究所 | Primer, detection method and application for specific KASP marker detection of diploid haynaldia villosa 3V chromosome |
| CN112410451B (en) * | 2020-11-11 | 2023-06-09 | 中国科学院成都生物研究所 | Primer for detecting diploid Haynaldia villosa 3V chromosome specific KASP marker, detection method and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103421776B (en) | 2015-07-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hasan et al. | Recent advancements in molecular marker-assisted selection and applications in plant breeding programmes | |
| CN106755478B (en) | SSR molecular marker IV for identifying progeny plants of Gala apples and application thereof | |
| Bajaj et al. | EcoTILLING-based association mapping efficiently delineates functionally relevant natural allelic variants of candidate genes governing agronomic traits in chickpea | |
| Sevanthi et al. | Whole genome characterization of a few EMS-induced mutants of upland rice variety Nagina 22 reveals a staggeringly high frequency of SNPs which show high phenotypic plasticity towards the wild-type | |
| Farkas et al. | Increased micronutrient content (Zn, Mn) in the 3Mb (4B) wheat–Aegilops biuncialis substitution and 3Mb. 4BS translocation identified by GISH and FISH | |
| Hofinger et al. | Validation of doubled haploid plants by enzymatic mismatch cleavage | |
| Mia et al. | Multiple near-isogenic lines targeting a QTL hotspot of drought tolerance showed contrasting performance under post-anthesis water stress | |
| Sattar et al. | Induced genetic variations in fruit trees using new breeding tools: Food security and climate resilience | |
| Wijnen et al. | Genetic resources for quantitative trait analysis: novelty and efficiency in design from an Arabidopsis perspective | |
| Stupar et al. | Insights from the soybean (Glycine max and Glycine soja) genome: past, present, and future | |
| CN102220316A (en) | Preparation method and application of molecular marker of rape male sterile restoring gene | |
| Thomson et al. | Functional allele validation by gene editing to leverage the wealth of genetic resources for crop improvement | |
| Sadeghzadeh et al. | Molecular marker linked to a chromosome region regulating seed Zn accumulation in barley | |
| CN108411024B (en) | Molecular marker SNP6 coseparating with powdery mildew resistance gene of cucumber-sour cucumber introgression line | |
| CN103421776B (en) | Genome-specific molecular marker primer of annual diploid dasypyrum villosum and application of primer | |
| CN106755465B (en) | Molecular marker closely linked with wheat flag leaf length QTL QFLL | |
| Shu et al. | A dominant gene for male sterility in Salvia miltiorrhiza Bunge | |
| CN109777884B (en) | Aegilops sharonensis 1Ssh chromosome specific molecular marker and application thereof | |
| Bhagyawant et al. | Molecular diversity assessment in chickpea through RAPD and ISSR markers | |
| CN107619880A (en) | A kind of haploid molecular labeling of tobacco for efficiently differentiating maternal origin and its application | |
| CN102373289B (en) | TRAP-SCAR585 label for identifying aegilops gametocidal chromosome 2C and application of same | |
| Syariyanto et al. | Gene expression analysis of somatic embryogenesis in oil palm | |
| CN101845499B (en) | Primer pair for assisting for screening wheat powdery mildew and its uses | |
| Zhou et al. | Monitoring of Roundup™ Ready soybean in Guangdong province in China | |
| Shah et al. | Molecular markers based identification of diversity for drought tolerance in bread wheat varieties and synthetic hexaploids |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150715 Termination date: 20210819 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |