CN103409539B - Quantitative PCR (polymerase chain reaction) kit with high sensitivity and good specificity - Google Patents
Quantitative PCR (polymerase chain reaction) kit with high sensitivity and good specificity Download PDFInfo
- Publication number
- CN103409539B CN103409539B CN201310361029.8A CN201310361029A CN103409539B CN 103409539 B CN103409539 B CN 103409539B CN 201310361029 A CN201310361029 A CN 201310361029A CN 103409539 B CN103409539 B CN 103409539B
- Authority
- CN
- China
- Prior art keywords
- solution
- quantitative pcr
- pcr
- kit
- enzyme
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention discloses a quantitative PCR (polymerase chain reaction) kit with high sensitivity and good specificity. The quantitative PCR kit comprises a fluorescent dye Gelgreen I and a hot start hTaq enzyme, wherein the fluorescent dye GelgreenI can be specifically bonded with a DNA (deoxyribonucleic acid) double strand to give out a fluorescence signal. The quantitative PCR kit contains the hot start hTap enzyme, magnesium ion concentration is appropriate, non-specific amplification can be well inhibited, false positive and high background results can be avoided, and a single peak can be obtained by virtue of a dissolution curve; the fluorescent dye GelgreenI is low in cost, easy to use, good in university and high in sensitivity and is applicable to a qPCR technoglogy. The invention provides a new quantitative PCR kit for molecular biology study.
Description
Technical field
The present invention relates to technical field of molecular biology, specifically, is a kind of highly sensitive, quantitative PCR kit that specificity is good.
Background technology
Real-time quantitative PCR (qPCR) is exactly in pcr amplification process, by detecting the corresponding fluorescent signal of each cyclic amplification product of PCR in real time, realizes carrying out quantitatively and a kind of technology of qualitative analysis starting template.QPCR technology is mainly from the different of regular-PCR technology: it is more that common PCR manually participates in, and data may not be accurate especially, also need agarose electrophoresis to detect after PCR terminates; And qPCR is real-time monitoring and detection, without the need to later stage electrophoresis, therefore qPCR have that detection time is short, easy and simple to handle, specificity is high, reproducible, highly sensitive, resolving power is high, sensing range more extensively, the advantage such as quantitatively accurate.Because qPCR technology possesses more advantages, be applied to now the every field of life science, the Differential expression analysis, SNP detection, allelic detection, drug development, clinical diagnosis, transgenic research etc. of such as gene.
The quantitative principle of qPCR relates to several important parameter: Ct value, threshold, baseline.In general, the fluorescent value of 3rd ~ 15 circulations is exactly baseline.Threshold value is generally 10 times of the standard deviation of baseline.Ct value is exactly the PCR cycle index of fluorescent value when reaching threshold value.Due to the exponential time base at pcr amplification, there is linear relationship (linear equation be Ct=-KlogN in the Ct value of DNA profiling and the starting copy number of this template
0+ B, wherein N
0template starting copy number), so become quantitative foundation.QPCR is quantitatively divided into again: absolute quantitation and relative quantification.The object of absolute quantitation measures goal gene molecule amount in the sample, namely usually said copy number.The object of relative quantification is the relative proportion measuring the content of goal gene in two or more sample, and does not need to know their copy numbers in each sample.
QPCR has the multiple method such as two-step approach, three-step approach, and classical three-step approach is sex change, annealing, extension three step.Two-step approach adopts same temperature that the two is merged into a step annealing and extension, and shorten experimental period, the requirement of the method to enzyme is higher, and the data that three-step approach obtains are relatively more accurate.Specifically use any method, will select in conjunction with primer annealing temperature, enzyme viability, concrete testing program.
No matter be absolute quantitation or relative quantification, by three-step approach or two-step approach, the core of qPCR technology has fluorescence to send in amplification procedure, and conventional fluorescence dye has SYBR Green, GelRed, GelGreen, GoldView
tMor GeneFinder
tM, the only increase of guaranteed fluorescent signal and the increase Complete Synchronization of PCR primer, just can guarantee that detection sensitivity is high, detected result is accurate.In qPCR testing process, often encounter non-specific amplification problem, non-specific amplification is exactly amplified the band beyond object band, occurs the result of false positive and high background.
Therefore, need a kind of highly sensitive, quantitative PCR kit that specificity is good, about quantitative PCR kit of the present invention, yet there are no report.
Summary of the invention
The object of the invention is for deficiency of the prior art, provide a kind of highly sensitive, quantitative PCR kit that specificity is good, to solve non-specific amplification problem, and provide a kind of new fluorescence dye, make test kit versatility good, detection sensitivity is high.
For achieving the above object, the technical scheme that the present invention takes is:
A kind of highly sensitive, quantitative PCR kit that specificity is good, described test kit comprises fluorescence dye Gelgreen I and warm start hTaq enzyme, described fluorescence dye Gelgreen I can send fluorescent signal in conjunction with DNA double chain specifically, and can not launch any fluorescent signal in conjunction with the Gelgreen I dye molecule of DNA chain, thus ensure the increase of fluorescent signal and the increase Complete Synchronization of PCR primer.
The working concentration of described fluorescence dye Gelgreen I is 0.5 × ~ 1 ×, the working concentration of described warm start hTaq enzyme is 0.01 ~ 0.1U/ μ L.
Described test kit also comprises PCR damping fluid, dATP solution, dUTP solution, dGTP solution, dCTP solution, PCR protective material, magnesium ion and aseptic double-distilled water.
Described test kit also comprises PCR damping fluid, forward primer, reverse primer, dATP solution, dUTP solution, dGTP solution, dCTP solution, PCR protective material, magnesium ion and aseptic double-distilled water.
The working concentration of described dATP solution, dUTP solution, dGTP solution or dCTP solution is 100 ~ 200 μm of ol/L.
Described PCR protective material is bSA, gelatin, Tween 20 or dithiothreitol (DTT).
Described PCR protective material is more preferably bSA.
DNA profiling amount in the PCR reaction system of test kit of the present invention of applying is: in 25 μ L reaction systems, genome 10 ~ 1000ng, or plasmid 1 ~ 30ng, or RT-PCR reacted cDNA 1 ~ 2 μ L; Magnesium ion concentration is 1.5 ~ 2.0mmol/L.
The invention has the advantages that:
Quantitative PCR kit provided by the invention contains warm start hTaq enzyme, and suitable magnesium ion concentration can suppress non-specific amplification well, avoids the result of false positive and high background, and solubility curve can obtain simple spike; Fluorescence dye Gelgreen I is cheap, easy to use, and versatility is good, and sensitivity is very high, is applicable to qPCR technology; The present invention is that molecular biology research provides a kind of new quantitative PCR kit.
Accompanying drawing explanation
Accompanying drawing 1 is the programming figure of qPCR reaction.
Accompanying drawing 2 is amplification curves of qPCR
Accompanying drawing 3 is melt curve analysis of qPCR.
Embodiment
Below in conjunction with accompanying drawing, embodiment provided by the invention is elaborated.
In the embodiment of the present invention, fluorescence dye Gelgreen I used is purchased from Ji Taiyuancheng bio tech ltd, Shanghai; Warm start hTaq enzyme is purchased from New England Biolabs (NEB) company; PCR damping fluid, dATP solution, dUTP solution, dGTP solution, dCTP solution are all purchased from Ji Taiyuancheng bio tech ltd, Shanghai; Forward primer, reverse primer, PCR protective material etc. are all purchased from Ji Taiyuancheng bio tech ltd, Shanghai.Test kit of the present invention is applied to Real-time quantitative PCR, can solve this difficult problem of non-specific amplification, and provides a kind of fluorescent substance Gelgreen I of new better performances.
embodiment 1
One, the quantitative PCR kit composition of the present embodiment is as follows:
10×Buffer（Mg
2+free）；
10×Gelgreen I；
10 × PCR protective material (bSA);
DATP, dUTP, dGTP and dCTP solution of each 10mmol/L;
The Mg of 25mmol/L
2+;
The hTaq enzyme of 5U/ μ L;
Aseptic double-distilled water.
Two, the application of the present embodiment quantitative PCR kit
(1) DNA to be measured is prepared: extracting DNA from mouse blood according to a conventional method, amplification EGF gene.
(2) synthesis of primer.
Forward primer: TATAGATATCATGAATAGTTATCCAGGATGCCCA
Reverse primer: TATA GAATTCTCAACGCAGTTCCCACCATCGTAG.
(3) foundation of PCR reaction system, reaction volume is totally 25 μ L, adds each reagent with reference to following table.
Table 1 PCR reaction system
。
(4) qPCR reaction
Adopt three-step approach PCR response procedures, warm start hTaq enzyme require hot activation process is lived to recover enzyme, so arranging PCR reaction denaturation condition is 95 DEG C, 10 minutes, programming as shown in Figure 1.
Segment 1:PCR reacts the denaturation stage.
Segment 2:qPCR step of reaction.
Segment3: amplified production melt curve analysis information acquisition stage.
(5) experimental result
The amplification curve of qPCR asks for an interview Fig. 2, and as can be seen from the figure the collection of fluorescent signal is very good, illustrates that the fluorescence dye Gelgreen I selected by the present invention is most suitable, convenient and practical for qPCR, susceptibility is high and fluorescence dye cost is low.
The melt curve analysis of qPCR asks for an interview Fig. 3, picture only has a simple spike, illustrates that the test kit expanding effect used is fine, because of containing suitable concn warm start hTaq enzyme, solves the non-specific amplification difficult problem existed in qPCR technology well.
embodiment 2
The quantitative PCR kit composition of the present embodiment is as follows:
10×Buffer（Mg
2+free）；
10×Gelgreen I；
10 × PCR protective material (Tween 20);
DATP, dUTP, dGTP and dCTP solution of each 5mmol/L;
The Mg of 20mmol/L
2+;
The hTaq enzyme of 5U/ μ L;
The forward primer of 10 μm of ol/L;
The reverse primer of 10 μm of ol/L;
Aseptic double-distilled water.
The working concentration of described fluorescence dye Gelgreen I is 0.5 × ~ 1 ×.The working concentration of described warm start hTaq enzyme is 0.01 ~ 0.1U/ μ L.The working concentration of described dATP solution, dUTP solution, dGTP solution or dCTP solution is 100 ~ 200 μm of ol/L.
embodiment 3
The quantitative PCR kit composition of the present embodiment is as follows:
10×Buffer（Mg
2+free）；
10×Gelgreen I；
10 × PCR protective material (dithiothreitol (DTT));
DATP, dUTP, dGTP and dCTP solution of each 10mmol/L;
The Mg of 30mmol/L
2+;
The hTaq enzyme of 5U/ μ L;
The forward primer of 10 μm of ol/L;
The reverse primer of 10 μm of ol/L;
Aseptic double-distilled water.
The working concentration of described fluorescence dye Gelgreen I is 0.5 × ~ 1 ×.The working concentration of described warm start hTaq enzyme is 0.01 ~ 0.1U/ μ L.The working concentration of described dATP solution, dUTP solution, dGTP solution or dCTP solution is 100 ~ 200 μm of ol/L.
The above is only the preferred embodiment of the present invention; it should be pointed out that for those skilled in the art, under the prerequisite not departing from the inventive method; can also make some improvement and supplement, these improve and supplement and also should be considered as protection scope of the present invention.
Claims (1)
1. one kind highly sensitive, the quantitative PCR kit that specificity is good, it is characterized in that, described test kit comprises fluorescence dye Gelgreen I and warm start hTaq enzyme, described fluorescence dye Gelgreen I can send fluorescent signal in conjunction with DNA double chain specifically, the working concentration of described fluorescence dye Gelgreen I is 0.5 ×, the working concentration of described warm start hTaq enzyme is 0.05U/ μ L, described test kit comprises PCR damping fluid, dATP solution, dUTP solution, dGTP solution, dCTP solution, PCR protective material, magnesium ion and aseptic double-distilled water, described dATP solution, dUTP solution, the working concentration of dGTP solution and dCTP solution is 200 μm of ol/L, described test kit also comprises forward primer and reverse primer, described forward primer is TATAGATATCATGAATAGTTATCCAGGATGCCCA, described reverse primer is TATAGAATTCTCAACGCAGTTCCCACCATCGTAG, described PCR protective material is bSA.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310361029.8A CN103409539B (en) | 2013-08-19 | 2013-08-19 | Quantitative PCR (polymerase chain reaction) kit with high sensitivity and good specificity |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310361029.8A CN103409539B (en) | 2013-08-19 | 2013-08-19 | Quantitative PCR (polymerase chain reaction) kit with high sensitivity and good specificity |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103409539A CN103409539A (en) | 2013-11-27 |
| CN103409539B true CN103409539B (en) | 2015-07-01 |
Family
ID=49602580
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310361029.8A Active CN103409539B (en) | 2013-08-19 | 2013-08-19 | Quantitative PCR (polymerase chain reaction) kit with high sensitivity and good specificity |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103409539B (en) |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7601498B2 (en) * | 2005-03-17 | 2009-10-13 | Biotium, Inc. | Methods of using dyes in association with nucleic acid staining or detection and associated technology |
| CN102936623B (en) * | 2012-09-28 | 2014-11-19 | 中国人民解放军疾病预防控制所 | Method for preventing nucleic acid contamination and indicating reaction result in nucleic acid isothermal amplification reaction |
-
2013
- 2013-08-19 CN CN201310361029.8A patent/CN103409539B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN103409539A (en) | 2013-11-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Varona et al. | Visual detection of single-nucleotide polymorphisms using molecular beacon loop-mediated isothermal amplification with centrifuge-free DNA extraction | |
| Garibyan et al. | Research techniques made simple: polymerase chain reaction (PCR) | |
| CN104099425B (en) | A kind of test kit for detecting B-raf transgenation | |
| CN103911427A (en) | Method and kit for detecting gene point mutation based on digital PCR platform | |
| Hancock et al. | Introducing undergraduate students to real‐time PCR | |
| CN103146692A (en) | Kit for rapidly detecting warfarin individualized medication related gene SNP sites, and its detection method | |
| Zhou et al. | Tandem reassembly of split luciferase-DNA chimeras for bioluminescent detection of attomolar circulating microRNAs using a smartphone | |
| CN104232781A (en) | TaqMan probe real-time fluorescence PCR (Polymerase Chain Reaction) method for detecting HLA (Human Leukocyte Antigen)-B*5801 alleles | |
| Doak et al. | Real-time reverse-transcription polymerase chain reaction: technical considerations for gene expression analysis | |
| CN105400904A (en) | RPA kit used for detecting Ebola virus, and special-purpose primers, probes, and applications of RPA kit | |
| Wang et al. | Determination of content of camel milk in adulterated milk samples by normalized real‐time polymerase chain reaction system based on single‐copy nuclear genes | |
| Koo et al. | High-speed biosensing strategy for non-invasive profiling of multiple cancer fusion genes in urine | |
| Pu et al. | XNA probe and CRISPR/Cas12a-powered flexible fluorescent and electrochemical dual-mode biosensor for sensitive detection of m6A site-specific RNA modification | |
| CN104263857A (en) | Nanometer PCR (Polymerase Chain Reaction) kit for rapid detection of mink enteritis virus and application thereof | |
| Lin et al. | Detection of BCR–ABL using one step reverse transcriptase-polymerase chain reaction and microchip electrophoresis | |
| CN103409540B (en) | A kind of raising sensitivity and specific quantifying PCR method | |
| CN103074438B (en) | Multi-gene detection kit for guiding administration of warfarin and detection method of multi-gene detection kit | |
| CN103409539B (en) | Quantitative PCR (polymerase chain reaction) kit with high sensitivity and good specificity | |
| CN103409537B (en) | Application method of quantitative PCR (polymerase chain reaction) kit containing hot-start hTaq enzyme and dye Gelgreen I | |
| CN103409538B (en) | A kind of purposes containing the quantitative PCR kit of warm start hTaq enzyme and dyestuff Gelgreen I | |
| MX2016002210A (en) | Digital analysis of molecular analytes using electrical methods. | |
| JP2016533746A5 (en) | ||
| Hu et al. | A simple and rapid DNA extraction method from meat by microneedle patch for detection of adulterated components | |
| CN105176995A (en) | Hydrolysis probe method based kit capable of simultaneously detecting deletion -alpha<21.9> and alpha2 variation of thalassemia | |
| CN105603104A (en) | Method for detecting circulating microRNA in serum |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20170410 Address after: Taicang City, Suzhou City, Jiangsu province 215400 Hong Kong Port Development Zone Road No. 52, building 4, floor 2 Patentee after: EXCELL BIOLOGY (TAICANG) CO.,LTD. Address before: 215434 Binjiang Road, Taicang economic and Technological Development Zone, Suzhou, Jiangsu, No. 88 Patentee before: SUZHOU JITAI BIOTECHNOLOGY Co.,Ltd. |
|
| TR01 | Transfer of patent right | ||
| CP03 | Change of name, title or address |
Address after: 215434 No. 66, Anjiang Road, Fuqiao Town, Taicang City, Suzhou City, Jiangsu Province Patentee after: Suzhou Ecosai Biotechnology Co.,Ltd. Address before: 215400 Floor 2, Building 4, No. 52, Yingang Road, Port Development Zone, Taicang City, Suzhou, Jiangsu Province Patentee before: EXCELL BIOLOGY (TAICANG) CO.,LTD. |
|
| CP03 | Change of name, title or address |