CN103409537B - Application method of quantitative PCR (polymerase chain reaction) kit containing hot-start hTaq enzyme and dye Gelgreen I - Google Patents
Application method of quantitative PCR (polymerase chain reaction) kit containing hot-start hTaq enzyme and dye Gelgreen I Download PDFInfo
- Publication number
- CN103409537B CN103409537B CN201310360993.9A CN201310360993A CN103409537B CN 103409537 B CN103409537 B CN 103409537B CN 201310360993 A CN201310360993 A CN 201310360993A CN 103409537 B CN103409537 B CN 103409537B
- Authority
- CN
- China
- Prior art keywords
- pcr
- gelgreen
- solution
- qpcr
- enzyme
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention discloses an application method of a quantitative PCR (polymerase chain reaction) kit containing a hot-start hTaq enzyme and a dye Gelgreen I, which comprises the steps of preparation of DNA (deoxyribonucleic acid) to be detected, synthesis of primers, establishment of PCR reaction system, and qPCR reaction. The PCR reaction system contains a hot-start hTaq enzyme and a dye Gelgreen I, wherein the predenaturation conditions of the qPCR reaction are 95 DEG C and 10 minutes. Due to the adoption of the hot-start hTaq enzyme with appropriate magnesium ion concentration, the application method disclosed by the invention can well inhibit the non-specific amplification and avoid the result of false positive and high background, and the dissolution curve can obtain a single peak. The dye Gelgreen I has the advantages of low price, favorable universality and very high sensitivity, and is convenient to use and suitable for qPCR technique. The invention provides an application method of a new quantitative PCR kit for molecular biology research.
Description
Technical field
The present invention relates to technical field of molecular biology, specifically, is the using method of the quantitative PCR kit containing warm start hTaq enzyme and dyestuff Gelgreen I.
Background technology
Real-time quantitative PCR (qPCR) is exactly in pcr amplification process, by detecting the corresponding fluorescent signal of each cyclic amplification product of PCR in real time, realizes carrying out quantitatively and a kind of technology of qualitative analysis starting template.QPCR technology is mainly from the different of regular-PCR technology: it is more that common PCR manually participates in, and data may not be accurate especially, also need agarose electrophoresis to detect after PCR terminates; And qPCR is real-time monitoring and detection, without the need to later stage electrophoresis, therefore qPCR have that detection time is short, easy and simple to handle, specificity is high, reproducible, highly sensitive, resolving power is high, sensing range more extensively, the advantage such as quantitatively accurate.Because qPCR technology possesses more advantages, be applied to now the every field of life science, the Differential expression analysis, SNP detection, allelic detection, drug development, clinical diagnosis, transgenic research etc. of such as gene.
The quantitative principle of qPCR relates to several important parameter: Ct value, threshold, baseline.In general, the fluorescent value of 3rd ~ 15 circulations is exactly baseline.Threshold value is generally 10 times of the standard deviation of baseline.Ct value is exactly the PCR cycle index of fluorescent value when reaching threshold value.Due to the exponential time base at pcr amplification, there is linear relationship (linear equation be Ct=-KlogN in the Ct value of DNA profiling and the starting copy number of this template
0+ B, wherein N
0template starting copy number), so become quantitative foundation.QPCR is quantitatively divided into again: absolute quantitation and relative quantification.The object of absolute quantitation measures goal gene molecule amount in the sample, namely usually said copy number.The object of relative quantification is the relative proportion measuring the content of goal gene in two or more sample, and does not need to know their copy numbers in each sample.
QPCR has the multiple method such as two-step approach, three-step approach, and classical three-step approach is sex change, annealing, extension three step.Two-step approach adopts same temperature that the two is merged into a step annealing and extension, and shorten experimental period, the requirement of the method to enzyme is higher, and the data that three-step approach obtains are relatively more accurate.Specifically use any method, will select in conjunction with primer annealing temperature, enzyme viability, concrete testing program.
No matter be absolute quantitation or relative quantification, by three-step approach or two-step approach, the core of qPCR technology has fluorescence to send in amplification procedure, and conventional fluorescence dye has SYBR Green, GelRed, GelGreen, GoldView
tMor GeneFinder
tM, the only increase of guaranteed fluorescent signal and the increase Complete Synchronization of PCR primer, just can guarantee that detection sensitivity is high, detected result is accurate.In qPCR testing process, often encounter non-specific amplification problem, non-specific amplification is exactly amplified the band beyond object band, occurs the result of false positive and high background.
Summary of the invention
The object of the invention is for deficiency of the prior art, a kind of using method containing the quantitative PCR kit of warm start hTaq enzyme and dyestuff Gelgreen I is provided.
For achieving the above object, the technical scheme that the present invention takes is:
A kind of using method containing the quantitative PCR kit of warm start hTaq enzyme and dyestuff Gelgreen I, comprise preparation DNA to be measured, primer synthesizes, PCR reaction system is set up, qPCR reactions steps, PCR reaction system contains warm start hTaq enzyme and dyestuff Gelgreen I, described dyestuff Gelgreen I can send fluorescent signal in conjunction with DNA double chain specifically, and can not launch any fluorescent signal in conjunction with the Gelgreen I dye molecule of DNA chain, thus ensure the increase of fluorescent signal and the increase Complete Synchronization of PCR primer, the denaturation condition of described qPCR reaction is 95 DEG C, 10 minutes.
The working concentration of described dyestuff Gelgreen I is 0.5 × ~ 1 ×, the working concentration of described warm start hTaq enzyme is 0.01 ~ 0.1U/ μ L.
Described test kit also comprises PCR damping fluid, dATP solution, dUTP solution, dGTP solution, dCTP solution, PCR protective material, magnesium ion and aseptic double-distilled water.
The working concentration of described dATP solution, dUTP solution, dGTP solution or dCTP solution is 100 ~ 200 μm of ol/L.
Described PCR protective material is bSA, gelatin, Tween 20 or dithiothreitol (DTT).
Described PCR protective material is more preferably bSA.
Quantitative PCR kit of the present invention in use DNA profiling amount to be measured used is: in 25 μ L reaction systems, genome 10 ~ 1000ng, or plasmid 1 ~ 30ng, or RT-PCR reacted cDNA 1 ~ 2 μ L; Magnesium ion concentration is 1.5 ~ 2.0mmol/L.
The invention has the advantages that:
The using method containing the quantitative PCR kit of warm start hTaq enzyme and dyestuff Gelgreen I provided by the invention, because use heat starts hTaq enzyme, suitable magnesium ion concentration, can suppress non-specific amplification well, avoid the result of false positive and high background, solubility curve can obtain simple spike; Dyestuff Gelgreen I is cheap, easy to use, and versatility is good, and sensitivity is very high, is applicable to qPCR technology; The present invention is the using method that molecular biology research provides a kind of new quantitative PCR kit.
Accompanying drawing explanation
Accompanying drawing 1 is the programming figure of qPCR reaction.
Accompanying drawing 2 is amplification curves of qPCR
Accompanying drawing 3 is melt curve analysis of qPCR.
Embodiment
Below in conjunction with accompanying drawing, embodiment provided by the invention is elaborated.
In the embodiment of the present invention, dyestuff Gelgreen I used is purchased from Ji Taiyuancheng bio tech ltd, Shanghai; Warm start hTaq enzyme is purchased from New England Biolabs (NEB) company; PCR damping fluid, dATP solution, dUTP solution, dGTP solution, dCTP solution are all purchased from Ji Taiyuancheng bio tech ltd, Shanghai; Forward primer, reverse primer, PCR protective material etc. are all purchased from Ji Taiyuancheng bio tech ltd, Shanghai.The present invention contains the using method of the quantitative PCR kit of warm start hTaq enzyme and dyestuff Gelgreen I, can solve this difficult problem of non-specific amplification, and provide a kind of fluorescent substance Gelgreen I of new better performances.
embodiment 1
One, the quantitative PCR kit composition of the present embodiment is as follows:
10×Buffer（Mg
2+free）；
10×Gelgreen I；
10 × PCR protective material (bSA);
DATP, dUTP, dGTP and dCTP solution of each 10mmol/L;
The Mg of 25mmol/L
2+;
The hTaq enzyme of 5U/ μ L;
Aseptic double-distilled water.
Two, the application of the present embodiment quantitative PCR kit
(1) DNA to be measured is prepared: extracting DNA from mouse blood according to a conventional method, amplification EGF gene.
(2) synthesis of primer.
Forward primer: TATAGATATCATGAATAGTTATCCAGGATGCCCA
Reverse primer: TATA GAATTCTCAACGCAGTTCCCACCATCGTAG.
(3) foundation of PCR reaction system, reaction volume is totally 25 μ L, adds each reagent with reference to following table.
Table 1 PCR reaction system
。
(4) qPCR reaction
Adopt three-step approach PCR response procedures, warm start hTaq enzyme require hot activation process is lived to recover enzyme, so arranging PCR reaction denaturation condition is 95 DEG C, 10 minutes, programming as shown in Figure 1.
Segment 1:PCR reacts the denaturation stage.
Segment 2:qPCR step of reaction.
Segment3: amplified production melt curve analysis information acquisition stage.
(5) experimental result
The amplification curve of qPCR asks for an interview Fig. 2, and as can be seen from the figure the collection of fluorescent signal is very good, illustrates that the dyestuff Gelgreen I selected by the present invention is most suitable, convenient and practical for qPCR, susceptibility is high and fluorescence dye cost is low.
The melt curve analysis of qPCR asks for an interview Fig. 3, picture only has a simple spike, illustrates that the test kit expanding effect used is fine, because of containing suitable concn warm start hTaq enzyme, solves the non-specific amplification difficult problem existed in qPCR technology well.
embodiment 2
The quantitative PCR kit composition of the present embodiment is as follows:
10×Buffer（Mg
2+free）；
10×Gelgreen I；
10 × PCR protective material (Tween 20);
DATP, dUTP, dGTP and dCTP solution of each 5mmol/L;
The Mg of 20mmol/L
2+;
The hTaq enzyme of 5U/ μ L;
The forward primer of 10 μm of ol/L;
The reverse primer of 10 μm of ol/L;
Aseptic double-distilled water.
The working concentration of described dyestuff Gelgreen I is 0.5 × ~ 1 ×.The working concentration of described warm start hTaq enzyme is 0.01 ~ 0.1U/ μ L.The working concentration of described dATP solution, dUTP solution, dGTP solution or dCTP solution is 100 ~ 200 μm of ol/L.
Prepare DNA to be measured according to a conventional method, set up PCR reaction system, carry out qPCR reaction, the denaturation condition of qPCR reaction is 95 DEG C, 10 minutes.
embodiment 3
The quantitative PCR kit composition of the present embodiment is as follows:
10×Buffer（Mg
2+free）；
10×Gelgreen I；
10 × PCR protective material (dithiothreitol (DTT));
DATP, dUTP, dGTP and dCTP solution of each 10mmol/L;
The Mg of 30mmol/L
2+;
The hTaq enzyme of 5U/ μ L;
The forward primer of 10 μm of ol/L;
The reverse primer of 10 μm of ol/L;
Aseptic double-distilled water.
The working concentration of described dyestuff Gelgreen I is 0.5 × ~ 1 ×.The working concentration of described warm start hTaq enzyme is 0.01 ~ 0.1U/ μ L.The working concentration of described dATP solution, dUTP solution, dGTP solution or dCTP solution is 100 ~ 200 μm of ol/L.
Prepare DNA to be measured according to a conventional method, set up PCR reaction system, carry out qPCR reaction, the denaturation condition of qPCR reaction is 95 DEG C, 10 minutes.
The above is only the preferred embodiment of the present invention; it should be pointed out that for those skilled in the art, under the prerequisite not departing from the inventive method; can also make some improvement and supplement, these improve and supplement and also should be considered as protection scope of the present invention.
Claims (1)
1. one kind contains the using method of the quantitative PCR kit of warm start hTaq enzyme and dyestuff Gelgreen I, comprise preparation DNA to be measured, primer synthesis, the foundation of PCR reaction system, qPCR reactions steps, it is characterized in that, the sequence of forward primer is TATAGATATCATGAATAGTTATCCAGGATGCCCA, and the sequence of reverse primer is TATAGAATTCTCAACGCAGTTCCCACCATCGTAG, PCR reaction system contains the warm start hTaq enzyme of New England Biolabs company and the dyestuff Gelgreen I of Ji Taiyuancheng bio tech ltd, Shanghai, described dyestuff Gelgreen I can send fluorescent signal in conjunction with DNA double chain specifically, the working concentration of described dyestuff Gelgreen I is 0.5 ×, the working concentration of described warm start hTaq enzyme is 0.05U/ μ L, described test kit comprises PCR damping fluid, dATP solution, dUTP solution, dGTP solution, dCTP solution, PCR protective material, magnesium ion and aseptic double-distilled water, described dATP solution, dUTP solution, the working concentration of dGTP solution and dCTP solution is 200 μm of ol/L, described PCR protective material is bSA, described qPCR reaction is three-step approach response procedures, and the denaturation condition of described qPCR reaction is 95 DEG C, 10 minutes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310360993.9A CN103409537B (en) | 2013-08-19 | 2013-08-19 | Application method of quantitative PCR (polymerase chain reaction) kit containing hot-start hTaq enzyme and dye Gelgreen I |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310360993.9A CN103409537B (en) | 2013-08-19 | 2013-08-19 | Application method of quantitative PCR (polymerase chain reaction) kit containing hot-start hTaq enzyme and dye Gelgreen I |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103409537A CN103409537A (en) | 2013-11-27 |
| CN103409537B true CN103409537B (en) | 2015-07-08 |
Family
ID=49602578
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310360993.9A Active CN103409537B (en) | 2013-08-19 | 2013-08-19 | Application method of quantitative PCR (polymerase chain reaction) kit containing hot-start hTaq enzyme and dye Gelgreen I |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103409537B (en) |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7601498B2 (en) * | 2005-03-17 | 2009-10-13 | Biotium, Inc. | Methods of using dyes in association with nucleic acid staining or detection and associated technology |
| CN102936623B (en) * | 2012-09-28 | 2014-11-19 | 中国人民解放军疾病预防控制所 | Method for preventing nucleic acid contamination and indicating reaction result in nucleic acid isothermal amplification reaction |
-
2013
- 2013-08-19 CN CN201310360993.9A patent/CN103409537B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN103409537A (en) | 2013-11-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Varona et al. | Visual detection of single-nucleotide polymorphisms using molecular beacon loop-mediated isothermal amplification with centrifuge-free DNA extraction | |
| CN104099425B (en) | A kind of test kit for detecting B-raf transgenation | |
| Garibyan et al. | Research techniques made simple: polymerase chain reaction (PCR) | |
| CN103911427A (en) | Method and kit for detecting gene point mutation based on digital PCR platform | |
| Varona et al. | Solid-phase microextraction enables isolation of BRAF V600E circulating tumor DNA from human plasma for detection with a molecular beacon loop-mediated isothermal amplification assay | |
| CN103468830B (en) | NASBA kit for detecting monkey pox virus and application thereof | |
| Du et al. | Terminal deoxynucleotidyl transferase-activated nicking enzyme amplification reaction for specific and sensitive detection of DNA methyltransferase and polynucleotide kinase | |
| CN103146692A (en) | Kit for rapidly detecting warfarin individualized medication related gene SNP sites, and its detection method | |
| CN104232781A (en) | TaqMan probe real-time fluorescence PCR (Polymerase Chain Reaction) method for detecting HLA (Human Leukocyte Antigen)-B*5801 alleles | |
| CN102242207A (en) | Primers and probes for detecting mutation of cancer gene BRAFV600E | |
| Doak et al. | Real-time reverse-transcription polymerase chain reaction: technical considerations for gene expression analysis | |
| CN104328190A (en) | PCR (polymerase chain reaction) product melting point analysis method for quantitatively detecting species composition of mixed-type sample | |
| CN104263857A (en) | Nanometer PCR (Polymerase Chain Reaction) kit for rapid detection of mink enteritis virus and application thereof | |
| CN103451292A (en) | Identification of specificity of transgenic rice Huahui 1 by applying recombinase polymerase amplification (RPA) technology | |
| Lin et al. | Detection of BCR–ABL using one step reverse transcriptase-polymerase chain reaction and microchip electrophoresis | |
| CN103074438B (en) | Multi-gene detection kit for guiding administration of warfarin and detection method of multi-gene detection kit | |
| CN103409540B (en) | A kind of raising sensitivity and specific quantifying PCR method | |
| CN103409537B (en) | Application method of quantitative PCR (polymerase chain reaction) kit containing hot-start hTaq enzyme and dye Gelgreen I | |
| CN103409539B (en) | Quantitative PCR (polymerase chain reaction) kit with high sensitivity and good specificity | |
| CN103409538B (en) | A kind of purposes containing the quantitative PCR kit of warm start hTaq enzyme and dyestuff Gelgreen I | |
| CN105176995A (en) | Hydrolysis probe method based kit capable of simultaneously detecting deletion -alpha<21.9> and alpha2 variation of thalassemia | |
| Miller et al. | Quantitative polymerase chain reaction | |
| CN104087655A (en) | Single strand cleavage analysis method for restriction endonuclease based on rolling circle amplification | |
| Chen et al. | Smartphone-assisted fluorescence-based detection of sunrise-type smart amplification process and a 3D-printed ultraviolet light-emitting diode device for the diagnosis of tuberculosis | |
| Wang et al. | Absolute quantification of circRNA using digital reverse transcription-hyperbranched rolling circle amplification |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20170410 Address after: Taicang City, Suzhou City, Jiangsu province 215400 Hong Kong Port Development Zone Road No. 52, building 4, floor 2 Patentee after: EXCELL BIOLOGY (TAICANG) CO.,LTD. Address before: 215434 Binjiang Road, Taicang economic and Technological Development Zone, Suzhou, Jiangsu, No. 88 Patentee before: SUZHOU JITAI BIOTECHNOLOGY Co.,Ltd. |
|
| TR01 | Transfer of patent right | ||
| CP03 | Change of name, title or address |
Address after: 215434 No. 66, Anjiang Road, Fuqiao Town, Taicang City, Suzhou City, Jiangsu Province Patentee after: Suzhou Ecosai Biotechnology Co.,Ltd. Address before: 215400 Floor 2, Building 4, No. 52, Yingang Road, Port Development Zone, Taicang City, Suzhou, Jiangsu Province Patentee before: EXCELL BIOLOGY (TAICANG) CO.,LTD. |
|
| CP03 | Change of name, title or address |