CN103408666A - Humanized anti-AEG-1 single chain antibody and application thereof - Google Patents

Abstract

The invention discloses a humanized anti-AEG-1 single chain antibody and an application thereof. The single chain antibody comprises a heavy chain and a light chain, wherein the amino acid sequence of a variable region of the heavy chain is SEQ ID NO.1, and the amino acid sequence of a variable region of the light chain is SEQ ID NO.2, can specifically recognize AEG-1, has higher affinity and stronger immunocompetence, and has excellent targeting for cancer cells. The genes and amino acids of variable regions of the heavy chain and the light chain are verified through sequential analysis; the sequence of the single chain antibody has uniqueness. The single chain antibody not only provides support for anti-AEG-1 humanized genetically engineering antibody, but also establishes material base for diagnosis, targeted therapy, and prognosis of cancer.

Description

The anti-AEG-1 single-chain antibody of a kind of humanization and application thereof

Technical field

The invention belongs to field of biomedicine technology, be specifically related to the anti-AEG-1 single-chain antibody of a kind of humanization and application thereof.

Background technology

Astroglia cell up-regulated gene-1(astrocyte elevated gene-1, AEG-1), the albumin A EG-1 of its coding claims again different mucoprotein (metadherin, MTDH), it is an oncogene of discovered in recent years, in the Several Kinds of Malignancy tissues such as mammary cancer, the esophageal carcinoma, liver cancer, prostate cancer and lung cancer, all cross to express, and closely related with important biomolecule characteristics such as the genesis of tumour, metastasis, chemotherapy resistances.

Single-chain antibody (single chain Fv, scFv) is a kind of novel genetic engineering antibody, by the variable region of heavy chain (V of antibody _H) and variable region of light chain (V _L) be formed by connecting by one section small peptide (linker), its advantage is: (1) is a kind of active antibody fragment of molecular weight minimum, is only 1/6 of complete antibody molecular weight; (2) can the various solid tumor tissues of rapid permeability, in body, remove fast; (3) do not contain the Fc section, be difficult for being combined with the non-target cell with Fc acceptor, can be specifically in conjunction with target organ; (4) be easy to genetic manipulation and genetically engineered is produced in a large number.Therefore the applied research of single-chain antibody in treating malignant tumor and diagnosis more and more comes into one's own.

Yet mouse monoclonal antibody is applied in human body therapy exist problems: (1) is the complement effect system relevant with the Fc acceptor in human activin effectively; (2) by the human immune system, identified and produce human antimouse antibody (HAMA); (3) in the human recycle system, disposed very soon; (4) complete antibody molecule, namely the relative molecular weight of Ig is excessive, is difficult to penetrate the solid tumor tissue, does not reach effective treatment concentration, so the research of Humanized single chain antibody is one of focus of current antibody research.

Technology for the preparation of human antibody is mainly Antibody library, and this technology is by phenotype and genotype are interrelated, and when antibody library, screening high-affinity antibody, and obtains the gene of this antibody of coding.The screening of phage antibody library technology mainly comprises ribosomal display technology and display technique of bacteriophage, wherein the ribosomal display Antibody library is at preparation scFv, especially there is unique advantage the humanization aspect than display technique of bacteriophage: (1) whole process is all carried out in extracellular, do not need transformant, therefore can obtain high-capacity library (10 ¹¹～10 ¹³); (2) avoid the frequent transitions of the inside and outside operation of cell, greatly shortened the screening cycle, simplified operation; (3) can adjust screening pressure, thereby as add competitive antigen or screening time delay etc. and improve the characteristics such as antibody identification meter position and stability, avidity; (4), with the coupling of external mutation method, as in conjunction with site-directed mutagenesis technique, DNA shuffling etc., but in the short period of time, realize the external affinity maturation of single-chain antibody.

By literature search, the AEG-1 albumen played a crucial role in tumor development of take is target, utilizes the humanized ScFv of Antibody library preparation for AEG-1 albumen, has no at present report.

Summary of the invention

The problem that the present invention solves is to provide the single-chain antibody of the anti-AEG-1 of a kind of humanization, solved the problem that animal derived antibody easily causes immunologic injury, this single-chain antibody can specific recognition AEG-1 simultaneously, have good immunocompetence, can for future clinical treatment tumour the antibody drug of feasibility is provided.

The present invention is achieved through the following technical solutions:

The anti-AEG-1 single-chain antibody of a kind of humanization, comprise heavy chain and light chain, and 3 complementary determining region sequences of the variable region of described heavy chain are respectively:

CDR1：Gly-Phe-Thr-Phe-Asp-Asp-Tyr-Ala;

CDR2：Ile-Ser-Trp-Asn-Ser-Gly-Ser-Ile；

CDR3：Ala-Ser-Val-Ala-Ser-Ser-Thr-His-Tyr；

3 complementary determining region sequences of the variable region of described light chain are respectively:

CDR1：Gln-Ser-Val-Ser-Ser-Gly-Tyr；

CDR2：Gly-Ala-Ser；

CDR3：His-Gln-Ser-Ser-Ser-Leu-Pro-Trp-Thr。

Further, the aminoacid sequence of the variable region of described heavy chain is as shown in SEQ ID NO.1;

The aminoacid sequence of the variable region of described light chain is as shown in SEQ ID NO.2.

Encode the gene order of variable region of described heavy chain as shown in SEQ ID NO.3;

Encode the gene order of variable region of described light chain as shown in SEQ ID NO.4.

The gene of the anti-AEG-1 single-chain antibody of a kind of humanization of encoding, its nucleotide sequence is as shown in SEQ ID NO.5.

The application of the anti-AEG-1 single-chain antibody of described humanization in preparing diagnosis of malignant tumor, treatment and prognosis judgement reagent.

The application of the gene of the anti-AEG-1 single-chain antibody of described coding humanization in preparing diagnosis of malignant tumor, treatment and prognosis judgement reagent.

Compared with prior art, the present invention has following useful technique effect:

1, the single-chain antibody that the anti-AEG-1 of a kind of humanization is provided provided by the invention, select 10 routine untreated peripheral blood from patients with lung cancer, from the lymphocyte separated, extracting total RNA, through the V of RT-PCR pcr amplification people antibody _HWith V _L, be spliced into the single-chain antibody gene storehouse by Linker.The AEG-1 of take is target antigen, utilizes the ribosomal display technology to carry out solid phase to this antibody library and washes in a pan sieve, obtains the Humanized single chain antibody of anti-AEG-1, and human body is not had to species difference, can not cause immunologic injury.

The Humanized single chain antibody ScFv-No.7 of anti-AEG-1 provided by the invention can specific recognition AEG-1, and has higher avidity: can the purpose band all be arranged clearly at 60kD and 80kD place with A549, SiHa total protein of cell and AEG-1 expresses negative BEAS-2B cell and has no band, confirm that scFv-No.7 and AEG-1 have special in conjunction with activity; And scFv-N o.7 can be specific with tumour cell on the identification of AEG-1 albumen, combination, and show targeting.

2, heavy chain, chain variable region gene and the aminoacid sequence of the anti-AEG-1 single-chain antibody of the present invention ScFv-No.7, sequential analysis has confirmed the uniqueness of the sequence of this single-chain antibody.

3, the present invention analyzes the CDR district that obtains heavy chain, variable region of light chain, on this basis for building high-affinity, anti-AEG-1 humanized genetic engineering antibody with targeting provides support.

4, the present invention be take the AEG-1 molecule and is prepared specific single-chain antibody as target spot, for early diagnosis and the targeted therapy of malignant tumour lays the foundation.

The accompanying drawing explanation

Fig. 1 is the figure as a result that indirect ELISA detects 60 clones;

Fig. 2-1～Fig. 2-2 are respectively scFv-No.7, the anti-AEG-1mAb Western-blot analyses to total protein of cell AEG-1;

Fig. 3 is immunocytochemistry coloration result figure;

Fig. 4 is Flow cytometry figure as a result;

Fig. 5 is SEQ ID NO.1 heavy chain variable region gene homology sequence detected result;

Fig. 6 is SEQ ID NO.2 chain variable region gene homology sequence detected result;

Fig. 7 is SEQ ID NO.3 variable region of heavy chain amino acid identity sequential detection result;

Fig. 8 is SEQ ID NO.4 variable region of light chain amino acid identity sequential detection result.

Embodiment

The present invention is described in further detail below in conjunction with specific embodiment, and the explanation of the invention is not limited.

The present invention is based on the ribosomal display Antibody library and prepare, screen anti-AEG-1 single-chain antibody, it mainly operates and comprises: from the peripheral blood lymphocyte of patients with lung cancer, extracting RNA, through RT-PCR, amplify respectively the V of antibody _HAnd V _LEncoding gene, then by a connection peptides, both are connected into to the scFv gene.(the Gly that connection peptides normally is comprised of 15 amino acid ₄Ser) ₃, guarantee that the peptide section has enough snappinesies and is beneficial to V _HAnd V _LCan correctly fold.

The main flow process of preparation scFv is: at first build scFv(V _H-Linker-V _L) the DNA library; Set up its ribosomal display template; This template is transcribed and is translated under in-vitro transcription and translation system, form scFv-rrna-mRNA tripolymer; By the specific aglucon immobilization of target protein, screening contains the rrna tripolymer of scFv; The mixture that screening and separating is obtained decomposes, and the mRNA discharged carries out the reaction of reversed transcriptive enzyme chain polymerization, and the PCR product enters the next round circulation, through repeatedly circulation, finally can make the gene order of scFv and coding thereof obtain enrichment and separate.

The present invention is based on aforesaid operations, at first from Peripheral Lymphocytes in Lung Cancer Patients (PBLs), extracting mRNA, build scFvs gene library, utilize the ribosomal display technology of complete in-vitro screening, high storage capacity to prepare the humanized scFvs for AEG-1 albumen, the scFvs gene clone screened is carried out to prokaryotic expression in carrier pHEN1, by indirect ELISA, filter out high-affinity scFv-No.7, and confirm uniqueness and the CDR sequence thereof of this gene order and aminoacid sequence, for anti-AEG-1 humanized genetic engineering antibody provides support.Screening method, scFv immunocompetence below in conjunction with concrete scFv detect, and determining of the detection of sequence and uniqueness elaborate to the present invention, and the explanation of the invention is not limited.The present invention specifically implements according to the following steps:

1, utilize the high-affinity single-chain antibody of ribosomal display technology screening for AEG-1:

1.1, the structure in ScFvs storehouse:

Gather 10 untreated patients with lung cancer (particularly AEG-1 antibody positive) peripheral blood, extract peripheral blood lymphocyte (PBLs), use TRIZOL Reagent(purchased from invitrogen company) extract RNA, then use PrimeScript ^TMRT reagent Kit(is purchased from TaKaRa company) the synthetic cDNA of reverse transcription, the concrete operation step by specification carries out.

With 9 couples of V of software Primer Premier5.0 design _H-linker, 6 couples of V _κ, 11 couples of V _λWith 1 pair of C κ primer, the cDNA of take is template, uses

HS DNA Polymerase Kit PCR amplifies respectively 9 kinds of hypotype V _H, 6 kinds of hypotype V _κ, 11 kinds of hypotype V _λWith 1 C κ constant region; The condition of pcr amplification is: 98 ℃ of 10sec, 55 ℃ of 10sec, 72 ℃ of 1min, 28cycles.The size of amplification is followed successively by 400bp, 700bp, 380bp and 320bp, 9 kinds of hypotype V _H, 6 kinds of hypotype V _κ, 11 kinds of hypotype V _λGel reclaims product balanced mix respectively.

Adopt overlapping extension to carry out V _HWith V _LSplicing, the total length scFvs gene primer sequence wherein obtained is:

T7Ab/back

GCAGCTAATACGACTCACTATAGGAACAGACCACC ATG

(C/G)AGGT(G/C)CA(G/C)CTCGAG(C/G)AGTCTGG

HuCκ/for

GCTCTAGAACACTCTCCCCTGTTGAAGCT

Due to V _HDownstream primer HuIgM linker/for respectively with 6 kinds of V κ, 11 kinds of V _λUpstream primer subregion sequence overlapping, purpose is convenient to V _H-linker and V _κ, V _λSplicing.The sequence of Linker is GGGAGTGCATCCGCCCCAACCCTTTTCCCCCTCGTCTCC.In splicing time-division twice PCR, carry out, the template of the 1st PCR is the V of balanced mix _{H is mixed}Respectively with V _{κ is mixed}, V _{λ is mixed}Respectively add 1 μ l, do not add primer, amplification condition is: 98 ℃ of 1min, 55 ℃ of 1min, 72 ℃ of 1min, 8cycles.The template of the 2nd PCR is the 1st PCR product 2 μ l, adopts primer T7Ab/back and HuC κ/for to carry out total length scFv amplification, and amplification condition is: 98 ℃ of 10sec, 55 ℃ of 10sec, 72 ℃ of 1min, 28cycles.Amplify the V of total length scFv _H-linker-V κ and V _H-linker-V _λ-C κ, size is 1100bp.By V _H-linker-V κ and V _H-linker-V _λ-C κ glue reclaims the product balanced mix, concentrated with ethanol precipitation, is the ScFv storehouse of ribosomal display.And order-checking identifies the diversity in constructed scFvs storehouse, result shows in 30 clones, only has the gene order of two scFvs light, the heavy chain hypotype is identical, and remaining is all not identical, proves that the diversity in scFvs storehouse is good.

1.2, the screening in ribosomal display scFvs storehouse:

By coated Dynabeads M-270 magnetic bead (purchased from invitrogen company) after the AEG-1 protein quantification of purifying, the concrete operations by specification carries out.The scFvs storehouse built at TNT T7Quick for PCR DNA(purchased from Promega company) in-vitro transcription and translation in test kit, form mRNA-rrna-scFv trimer compositions.With the AEG-1 albumen be coated on magnetic bead, screening as antigen, with Trizol reagent, extract RNA after 3～5 washings, is cDNA by the RNA reverse transcription, and the cDNA of then take carries out pcr amplification as template, and the new DNA library formed can be used for the screening of next round.Concrete operations are as follows:

In 50 μ l reaction systems, contain the 300ng that pcr amplification obtains～500ng scFvs DNA library, 40 μ l TNT T7Quick for PCR DNA, 1.0 μ l1mM methionine(Met)s and 0.5 μ l100mM magnesium acetate; In 30 ℃ of water-baths, after incubation 60～90min, add DNase I and the 6 μ l10 * DNase I Digestive system of 20U, remove unnecessary DNA fragmentation with digestion; In 30 ℃ of water-baths, after incubation 15min, add 2 * dilution buffer liquid dilution mixture (PBS that contains the 10mM magnesium acetate) of 60 μ l precoolings; Add antigen prepared by 10 μ l-magnetic bead solution and add in newly-generated ARM tripolymer, 4 ℃ of jog 2h.After with the PBS that contains 0.1%, washing 3～5 times, Trizol reagent extracts RNA and carries out the RT-PCR amplification, and the new DNA library formed screens for next round.

When building the ScFv storehouse, the transcribed spacer merged at the C end is the constant region (C of κ light chain _κ) sequence, its major function is can be connected in vitro translated protein on rrna and make proteins encoded have enough spaces correctly folding.Upstream primer T7A1 carries out three-wheel screening (screening process as mentioned above) with downstream primer Hu2, Hu3, Hu4 respectively, in each screening circulation, scFvs DNA library fragment length is shortened gradually at the κ constant region of light chain, the final just V generated _HAnd V _LThe 800bp scFvs DNA fragmentation be formed by connecting by Linker.In the ScFv storehouse, the sequence of 800bp scFvs DNA fragmentation may be tens kinds or hundreds of kind.

T7A1：GCAGCTAATACGACTCACTATAGGAACAGACCACC ATG

Hu2：GCTCAGCGTCAGGGTGCTGCT；

Hu3：CTCTCCTGGGAGTTACC；

Hu4：GAAGACAGATGGTGCAGC。

2.3, ELISA filters out high-affinity scFv-No.7:

Primer is expressed in design according to carrier pHEN1:

HuE1/back

TTTTGGCCCAGCCGGCCATGGCCGCCATGSAGGTSCASCTCGAG?SAGTCTGG

HuE1/for

TTTTGCGGCCGCAGTTCGATTGATCTCCACCTT

The scFvs gene of the anti-AEG-1 that third round is screened is used, downstream primer HuE1/back and HuE1/for pcr amplification, purpose has identical restriction enzyme site Sfi I and Not I in order to introduce with carrier pHEN1, build prokaryotic expression plasmid scFv-pHEN1, enzyme is cut and identified that 60 correct different clones carry out prokaryotic expression, further filter out the scFv-No.7 of high-affinity with indirect ELISA.AEG-1 albumen is as envelope antigen, testing sample be the scFvs expression product as primary antibodie, detecting antibody is the Anti-myc-HRP enzymic-labelled antibody, substrate is used OPD.As shown in Figure 1, ordinate zou is the absorbance (A630) at 630nm wavelength place to detected result, means the avidity degree of AEG-1 albumen and scFv; X-coordinate is 60 difference clones that express scFv; No.61 is the mAb of AEG-1, as positive control.Can find out that the high-affinity scFv-No.7OD value size filtered out is 0.876, suitable with its mAb OD value.

And the nucleotide sequence of the DNA of the scFv-No.7 of 800bp is as shown in SEQ.ID.NO.5.Wherein, the sequence corresponding with upstream primer is in 1～60:

GGCCCAGCCGGCCATGGCCGCCATGCACCACCACCACCACCACG AGGTG CAG CTCGAGG A；

392～430 is the linker sequence, and 770～801 is the sequence corresponding with downstream primer.

1.4, yeast great expression scFv-No.7 and purifying:

For the ease of the purifying of scFv-No.7, the sequence that design contains the His-tag primer is:

HuE2/back

TTTTGGCCCAGCCGGCCATGGCCGCCATGCACCACCACCACCA

CCACSAGGTSCASCTCGAGSA

HuE2/for

TTTTGCGGCCGCAGTTCGATTGATCTCCACCTT

With the scFv-No.7 of above-mentioned primer PCR amplification, purpose is in order to introduce restriction enzyme site Eco I and the Not I identical with carrier PPIC9K, after connecting the product enzyme and cutting and identify that correct electricity turns the GS115 pichia spp, and the methanol concentration abduction delivering with 0.5%.

After ScFv albumen great expression, purify with Ni-NTA, after purifying, protein content is about 500 μ g/ml.

1.5, the detection of ScFv-No.7 and antigen-binding activity:

By Western-blot, analyze the immunocompetence of scFv-No.7 and AEG-1, about 20 μ g A549(lung carcinoma cells), SiHa(breast cancer cell) total protein, and BEAS-2B(people's normal lung epithelial cell) total protein is as negative control, carry out the 12%SDS-PAGE gel electrophoresis, by 5% skim-milk room temperature, seal 2h after transferring film.With scFv-No.7(1 μ g/ml) and anti-AEG-1mAb(positive control) as primary antibodie, anti-6 * His mouse mAb(1:2000) as two anti-, the sheep anti-mouse igg (1:5000) that detects antibody and be the HRP mark is anti-as three, develops with chemoluminescence method.

Detected result is as shown in Fig. 2-1～Fig. 2-2, wherein Fig. 2-1 is with scFv-No.7, the Western-blot of total protein of cell AEG-1 to be analyzed, Fig. 2-2 are for analyzing the Western-blot of total protein of cell AEG-1 with anti-AEG-1mAb, M:maker wherein, swimming lane 1 is A549 lung carcinoma cell total protein, swimming lane 2 is SiHa breast cancer cell total protein, and swimming lane 3 is BEAS-2B people's normal lung epithelial cell total protein;

Result shows that A549, SiHa total protein of cell all have purpose band (due to the Partial Protein glycosylation) clearly at 60kD and 80kD place, and the negative BEAS-2B cell of AEG-1 expression has no band, confirmed that scFv-No.7 and AEG-1 have special combination active.

1.6, immunocytochemistry dyeing:

By immunochemistry dye further analyze scFv-N o.7 with tumour cell on the immunologic opsonin of AEG-1 albumen and expression and the distribution of AEG-1.By A549 cell (lung carcinoma cell), SiHa cell (breast cancer cell) with BEAS-2B cell (people's normal lung epithelial cell) creep plate with 3%H ₂O ₂Blocking-up cell endogenous peroxydase, every kind of cell divides three groups, add respectively AEG-1 to resist (positive control more, 1:500), scFv-No.7(sample, 10 μ g/ml) with the PBS(negative control) as primary antibodie, 4 ℃ are spent the night, and then after scFv-No.7, add anti-6 * His mouse mAb(1:500) as two anti-, finally add 37 ℃ of universal antibody (for mouse, rabbit) and hatch 45min.As shown in Figure 3, it is how anti-during as primary antibodie that A549 cell, SiHa cell add respectively scFv-No.7, AEG-1 for mounting after DAB colour developing, result, and the coloration result positive, be brown in after birth and born of the same parents; And BEAS-2B cell dyeing result is negative.

Result shows, scFv-N o.7 can be specific with tumour cell on the identification of AEG-1 albumen, combination.

1.7, immunofluorescent staining:

By the immunological characteristic of flow cytometry vitro detection scFv-No.7 to tumour cell.After being digested, A549 cell (lung carcinoma cell) and BEAS-2B cell (normal lung segmental bronchus ciliated cell) suspend (1 * 10 with PBS ⁶Cells), 0.4% paraformaldehyde fixedly seals 1h by the 3%BSA room temperature after 15min, every kind of cell adds respectively the AEG-1mAb(positive control, 1:500), scFv-No.7(sample, 10 μ g/ml) with the PBS(negative control) as primary antibodie, 4 ℃ are spent the night, and then after scFv-No.7, add anti-6 * His mouse mAb(1:500) as two anti-, finally add sheep anti-mouse igg (1:500) the incubated at room 30min of FITC mark.Flow cytometer detects, and as shown in Figure 4, scFv-No.7 has targeting to the A549 cell to result, and about 80.79%A549 cell is caught green fluorescence, and the BEAS-2B cell almost is not colored.Result shows, scFv-No.7 can specific tumor cell on AEG-1 albumen, show targeting.

2, the scFv-No.7 gene sequencing of anti-AEG-1:

Institute is obtained to recombinant plasmid pHEN1-scFv-No.7 and transform HB2151, choose the clone and shake bacterium, bacterium liquid is delivered Shanghai biotechnology Services Co., Ltd and is completed gene sequencing, V _HThe gene order of variable region of heavy chain as shown in SEQ ID NO.3, V _LThe gene order of variable region of light chain is as shown in SEQ ID NO.4.

3, the nucleotide sequence of ScFv-No.7 light chain and variable region of heavy chain and homology analysis:

3.1, determine that order-checking is errorless after, in the GenBank+EMBL+DDBJ+PDB database, carry out nucleotide sequence homology analysis (Blastn).

The ScFv-No.7 heavy chain variable region gene be numbered Sequence ID: Ref|NW001838121.1|People Ig heavy chain variable region gene homology the highest, be 283/286(99%), as shown in Figure 5.

The ScFv-No.7 chain variable region gene be numbered Sequence ID: Ref|NW004078005.1|People Ig chain variable region gene homology the highest, reach 245/261(94%), as shown in Figure 6.

Homology analysis shows, the nucleotide sequence of light, the variable region of heavy chain of coding scFv-No.7, although with other gene order, certain homology is arranged, find and the identical gene order of the present invention, shows that the present invention has uniqueness on gene order.

3.2, variable region gene is translated into to aminoacid sequence, carry out amino acid sequence analysis:

The aminoacid sequence of ScFv-No.7 variable region of heavy chain is as shown in SEQ ID NO.1, and the aminoacid sequence of variable region of light chain is as shown in SEQ ID NO.2.

In non-redundant Genbank CDS translations+PDB+SwissProt+PIR+PRF Protein Data Bank, carry out amino acid sequence homology analysis (Blastp).

Analytical results shows, the scFv-No.7 heavy chain amino acid sequence be numbered TR: A2J1N4HUMAN A2J1N4The homology of people Ig variable region of heavy chain albumen the highest, be 90/96(93%), as shown in Figure 7.

The ScFv-No.7 light-chain amino acid sequence be numbered SP: KV313HUMAN? P18136The homology of people Ig variable region of light chain albumen the highest, be 94/109(86%), as shown in Figure 8.

Homology analysis shows, scFv-No.7 is heavy, the aminoacid sequence of variable region of light chain, although with other Argine Monohydrochloride sequence, certain homology is arranged, do not find and the identical aminoacid sequence of the present invention, show that the present invention also has uniqueness on aminoacid sequence.

3.3, utilize IMGT/V-QUEST to analyze the variable region structure, determine the CDR district:

To check order gained scFv-No.7 heavy chain and light chain variable region sequence, (http://imgt.cines.fr/IMGT_vquest/vquest) analyzes in the IMGT/V-QUEST website, draws its CDR district.

3 complementary determining regions (CDR) sequence of described variable region of heavy chain, as shown in SEQ.ID.NO.1 line part, is specially:

CDR1：Gly-Phe-Thr-Phe-Asp-Asp-Tyr-Ala;

CDR2：Ile-Ser-Trp-Asn-Ser-Gly-Ser-Ile；

CDR3：Ala-Ser-Val-Ala-Ser-Ser-Thr-His-Tyr；

3 complementary determining regions (CDR) sequence of variable region of light chain, as shown in SEQ.ID.NO.2 line part, is specially:

CDR1：Gln-Ser-Val-Ser-Ser-Gly-Tyr；

CDR2：Gly-Ala-Ser；

CDR3：His-Gln-Ser-Ser-Ser-Leu-Pro-Trp-Thr。

4, genetic engineering antibody design:

Based on expression, purifying and the sequential analysis of anti-AEG-1 Humanized single chain antibody scFv-No.7, the following biological products of design construction:

1) structure of bi-specific antibody: can be by Humanized single chain antibody scFv-No.7 of the present invention, with effector cell's heavy chain of antibody, variable region of light chain, be connected by linker, for the preparation of can, for the bispecific single-chain antibody of AEG-1, carrying out targeted therapy to tumour patient.

2) structure of targeting vector: can, by Humanized single chain antibody scFv-No.7 of the present invention, be connected the Image Location diagnosis for tumour with radionuclide.To clean up speed fast due to scFv, and penetration power is strong, and when the radiation video picture, radionuclide is got rid of very fast, little to health harm, is therefore comparatively desirable Image Location diagnosis carrier.

3) structure of intrabody: Humanized single chain antibody scFv-No.7 gene of the present invention can be carried after entering target cell and expresses antibody protein by carrier, this at intracellular antibody by the antigen-antibody specific combination, the biological activity of blocking-up target protein AEG-1, thus the performance of its biological function affected and the inhibition tumor cell growth.

4) can be according to the aminoacid sequence of gene order of the present invention and coding thereof, preparation is for other biological products of AEG-1 functional epitope.

Content of the present invention is not limited in embodiment cited, and the conversion of any equivalence that those of ordinary skills take technical solution of the present invention by reading specification sheets of the present invention, be claim of the present invention and contain.

Claims (6)

1. the anti-AEG-1 single-chain antibody of humanization, comprise heavy chain and light chain, it is characterized in that:

3 complementary determining region sequences of the variable region of described heavy chain are respectively:

CDR1：Gly-Phe-Thr-Phe-Asp-Asp-Tyr-Ala；

CDR2：Ile-Ser-Trp-Asn-Ser-Gly-Ser-Ile；

CDR3：Ala-Ser-Val-Ala-Ser-Ser-Thr-His-Tyr；

3 complementary determining region sequences of the variable region of described light chain are respectively:

CDR1：Gln-Ser-Val-Ser-Ser-Gly-Tyr；

CDR2：Gly-Ala-Ser；

CDR3：His-Gln-Ser-Ser-Ser-Leu-Pro-Trp-Thr。

2. the anti-AEG-1 single-chain antibody of humanization according to claim 1 is characterized in that:

The aminoacid sequence of the variable region of described heavy chain is as shown in SEQ ID NO.1;

The aminoacid sequence of the variable region of described light chain is as shown in SEQ ID NO.2.

3. the anti-AEG-1 single-chain antibody of a kind of high-affinity according to claim 1 is characterized in that:

Encode the gene order of variable region of described heavy chain as shown in SEQ ID NO.3;

Encode the gene order of variable region of described light chain as shown in SEQ ID NO.4.

4. the gene of the anti-AEG-1 single-chain antibody of the humanization of encoding, it is characterized in that: its nucleotide sequence is as shown in SEQ ID NO.5.

5. the application of the anti-AEG-1 single-chain antibody of humanization claimed in claim 1 in preparing diagnosis of malignant tumor, treatment and prognosis judgement reagent.

6. the application of the gene of the anti-AEG-1 single-chain antibody of coding humanization claimed in claim 4 in preparing diagnosis of malignant tumor, treatment and prognosis judgement reagent.

Images