CN114349861B

CN114349861B - anti-PD 1 nano antibody and preparation method and application thereof

Info

Publication number: CN114349861B
Application number: CN202210011915.7A
Authority: CN
Inventors: 华子春; 李淑锋
Original assignee: Targetpharma Laboratories Jiangsu Co ltd; Hua Tangsiyuan
Current assignee: Targetpharma Laboratories Jiangsu Co ltd; Hua Tangsiyuan
Priority date: 2022-01-06
Filing date: 2022-01-06
Publication date: 2023-07-07
Anticipated expiration: 2042-01-06
Also published as: CN114349861A

Abstract

The invention discloses an anti-human PD1 nanometer antibody, a coding sequence, a preparation method and application thereof, and relates to an anti-PD 1 nanometer antibody, wherein the VHH chain of the anti-PD 1 nanometer antibody has an amino acid sequence shown as SEQ ID NO. 2 or SEQ ID NO. 11. Compared with the prior art, the invention has the following advantages: (1) The anti-PD 1 nano antibody has high specificity, high affinity and high detection sensitivity; (2) The antibody can be efficiently expressed in escherichia coli, so that a foundation is provided for subsequent mass production of the immunoreagent and tumor pharmaceutical composition. The invention discloses an anti-human PD1 nanometer antibody, a coding sequence, a preparation method and application thereof, and relates to an anti-PD 1 nanometer antibody, wherein the VHH chain of the anti-PD 1 nanometer antibody has an amino acid sequence shown as SEQ ID NO. 2 or SEQ ID NO. 11. Compared with the prior art, the invention has the following advantages: (1) The anti-PD 1 nano antibody has high specificity, high affinity and high detection sensitivity; (2) The antibody can be efficiently expressed in escherichia coli, so that a foundation is provided for subsequent mass production of the immunoreagent and tumor pharmaceutical composition.

Description

anti-PD 1 nano antibody and preparation method and application thereof

Technical Field

The invention relates to the technical field of biomedicine, in particular to a novel PD1 antibody or a functional fragment thereof, and specifically relates to an anti-PD 1 nano antibody, a preparation method and application thereof.

Background

Programmed death molecule 1 (pd1), also known as CD279, is widely expressed on the surface of immune cells and is an important immunosuppressive molecule. PD-1 belongs to immunoglobulin superfamily CD28/B7, is type I transmembrane glycoprotein composed of 288 amino acids, and is an immunosuppressive receptor. It has at least two ligands, PDL1 and PDL 2. Under normal conditions, PD-1 on the surface of T cells can inhibit the function of T lymphocytes, thereby inhibiting autoimmune responses and preventing the occurrence of autoimmune diseases. However, in the tumor, after PD-L1 expressed by tumor cells is combined with PD-1 on the surface of T cells, the proliferation of the T cells is down-regulated by inhibiting the T lymphocytes, even the apoptosis of the T cells is induced, and the immune escape of the tumor is promoted. And the PD-1/PD-L1 negative regulation and control channel is blocked, so that the function of an immune system can be activated, and tumor cells can be killed. There are a variety of PD 1-targeting monoclonal antibodies currently available on the market, including nano Wu Liyou mab (Nivolumab), palbociclizumab (Pembrolizumab), cimipp Li Shan antibody (Cemiplimab), terlipp Li Shan antibody (Toripalimab), singdi Li Shan antibody (Cindilimab), and the like. These PD1 mabs have been successfully used in the clinic. However, monoclonal antibodies have the disadvantages of long development period, high production cost, large molecular weight, difficulty in penetrating tissues, and the like. These factors limit the popularization of the nano-antibody in clinical application, and the nano-antibody is the smallest antibody molecule at present, and has the advantages of good stability, low cost, good water solubility, and the like, and can penetrate through the blood brain barrier.

Disclosure of Invention

In order to overcome the defects of the prior art, the invention provides a nano antibody with high detection sensitivityA kind of electronic deviceAn anti-PD 1 nanometer antibody, a preparation method and application thereof.

In order to solve the problems in the prior art, the invention provides the following technical scheme: the VHH chain of the anti-PD 1 nanobody has an amino acid sequence shown as SEQ ID NO. 2 or SEQ ID NO. 11.

Further, the VHH chain of the anti-PD 1 nanobody comprises a framework region and a complementarity determining region, wherein the framework region has the amino acid sequences shown in SEQ ID No.3, 5, 7 and 9, and the complementarity determining region has the amino acid sequences shown in SEQ ID No.4, 6 and 8;

alternatively, the framework regions have the amino acid sequences shown in SEQ ID Nos. 12, 14, 16, 18, and the complementarity determining regions have the amino acid sequences shown in SEQ ID Nos. 13, 15, 17.

A nucleic acid molecule of the invention encoding an anti-PD 1 nanobody according to

claim

1 or 2.

Further, it has the nucleotide sequence shown as SEQ ID NO.1 or SEQ ID NO. 10.

A recombinant vector of the present invention comprising the nucleic acid according to

claim

3 or 4.

A host cell of the invention comprising a nucleic acid according to claim 3 or 4 or a vector according to claim 5.

The preparation method of the anti-PD 1 nanometer antibody comprises the following steps:

(1) Constructing an anti-PD 1 nano antibody phage library;

(2) Selecting nanobody phage having specific binding to PD 1;

(3) Culturing a host comprising a vector encoding an anti-PD 1 nanobody nucleic acid;

(4) Purifying from host cell to obtain the anti-PD 1 nanometer antibody.

The invention relates to application of an anti-PD 1 nano antibody in preparation of a kit for detecting PD 1.

The anti-PD 1 nano antibody of the invention is applied to the preparation of a medicine for treating tumors.

The anti-PD 1 nanobody is applied to the preparation of medicines or methods used in combination with other anti-tumor medicines or treatment methods.

The experimental principle of the anti-PD 1 nano antibody provided by the invention is as follows: and (3) displaying a heavy chain antibody variable region gene in the camel serum after PD1 immunization on the surface of a T7 phage, screening nano antibodies which specifically identify the phage surface of the PD1 from a phage antibody library by using PD1, and obtaining phage nano antibodies which specifically identify the PD1 by using the displayed nano antibodies and genes corresponding to the displayed nano antibodies in the same recombinant phage, and then carrying out PCR amplification on DNA of the phage, and sequencing to obtain the nano antibody corresponding genes in the recombinant phage.

The beneficial effects are that: the detection sensitivity is high, the stability is good, the cost is low, and the practical application is easy. The anti-PD 1 nano antibody provided by the invention has high specificity and high detection sensitivity. Can be efficiently expressed in escherichia coli, thereby providing a foundation for the subsequent mass production of the immunoreagent and the tumor pharmaceutical composition.

Drawings

FIG. 1A is a agarose gel electrophoresis diagram of a nest-PCR1 product of the present invention, wherein M is a DNA marker;1 is a nest-PCR1 product;

FIG. 1B is a diagram of agarose gel electrophoresis of a nest-PCR2 product of the present invention, wherein M is a DNA marker;1 is a nest-PCR2 product;

FIG. 1C is a diagram showing the identification of the diversity of anti-PD 1 nanobody library of the invention, wherein M is a DNA molecular standard; 1-10 are randomly selected monoclonal phage PCR products from an anti-PD 1 nanobody library.

FIG. 2 shows the soluble nanobody of the invention purified by SDS-PAGE analysis. Lane 1: VHH1, lane 2: VHH2.

FIG. 3A shows the binding affinity of Nbs of the invention to VHH1 as determined by non-competitive ELISA. Plates were coated with three concentrations of PD1 protein: 5mg/mL, 2.5mg/mL, and 1.25mg/mL. The experimental dose response curves for VHH1 at three different PD1 coating concentrations are depicted.

FIG. 3B shows the binding affinity of Nbs of the invention to VHH2 as determined by non-competitive ELISA. Plates were coated with three concentrations of PD1 protein: 5mg/mL, 2.5mg/mL, and 1.25mg/mL. The experimental dose response curves for VHH2 at three different PD1 coating concentrations are depicted.

FIG. 4 is a graph showing the specificity of the enzyme-linked immunosorbent assay for identifying nanobody according to the present invention.

Detailed Description

The following examples further illustrate the invention but are not to be construed as limiting the invention. Modifications and substitutions to the method, steps or conditions of the invention without departing from the spirit and nature of the invention are intended to be within the scope of the invention. The technical means used in the examples are conventional means well known to those skilled in the art unless otherwise indicated.

Example 1

The VHH chain of the anti-PD 1 nanobody has an amino acid sequence shown as SEQ ID NO. 2 or SEQ ID NO. 11.

claim

1 or 2.

Further, it has the nucleotide sequence shown as SEQ ID NO.1 or SEQ ID NO. 10.

claim

3 or 4.

A host cell of the invention comprising a nucleic acid according to

claim

3 or 4 or a vector according to claim 5.

(1) Constructing an anti-PD 1 nano antibody phage library;

(2) Selecting nanobody phage having specific binding to PD 1;

(4) Purifying from host cell to obtain the anti-PD 1 nanometer antibody.

In view of the fact that currently, in clinical use, there are thousands of anti-PD 1 antibodies used in combination with other drugs or therapeutic methods, the anti-PD 1 nanobody of the present invention is used in the preparation of drugs or methods used in combination with other anti-tumor drugs or therapeutic methods.

Example 2

Construction of anti-PD 1 nanobody library

(1) Immunizing a healthy dromedary with 0.5mg of human PD1 protein once a week for 7 times, and stimulating B cells to express antigen-specific nanobodies;

after the immunization is finished, 100mL camel peripheral blood lymphocytes are extracted and total RNA is extracted;

reverse transcription PCR

Reverse transcription of total RNA of peripheral blood lymphocyte into cDNA by RT-PCR kit,

and II, amplifying cDNA by a nest-PCR to obtain VHH fragments of the camel heavy chain antibody.

A first round of PCR amplification was performed using the cDNA obtained above as a template, and the post-PCR 1up (SEQ ID NO: 19) and post-PCR 1down (SEQ ID NO: 20) as primers. After the PCR reaction is finished, detecting the PCR product by agarose gel electrophoresis, and the gel electrophoresis result shows that the amplified gene fragment has a specific band at 700 bp. The cut adhesive retrieves the destination tape (see FIG. 1A).

The second round of PCR amplification was performed using the recovered product as templates, and the post-PCR 2up (SEQ ID NO: 21) and post-PCR 2down (SEQ ID NO: 22) primers. After the PCR reaction is finished, the PCR product is detected by agarose gel electrophoresis, and the amplified gene fragment has a specific band at 500 bp. The target band is recovered by cutting gel, namely the VHH fragment (see FIG. 1B). The primers used were as follows:

primer(s)	Primer sequences
		nest-PCR1up	5 '>GTCCTGGCTGCTCTTCTACAAGG<3 '
nest-PCR1down	5 '>GGTACGTGCTGTTGAACTGTTCC<3 '
		nest-PCR2up	5 '>CCGGAATTCTCAGGTGCAGCTGGTGGAGTCTGG<3 '
nest-PCR2down	5 '>GCCCAAGCTTTGAGGAGACGGTGACCTGGGT<3 '

Double cleavage of VHH fragments

Double digestion with EcoRI and HindIII was performed for 3 hours, and after agarose gel electrophoresis, the cut gel was recovered.

Construction of T7 phage antibody library

The nanobody library was constructed using the T7Select10 kit from Novagen. The VHH fragment and the T7 vector were ligated and packaging of the T7 phage was performed. The titers of the constructed nanobody libraries were approximately 1×10 as determined by plaque titers ⁷ pfu/ml。

Amplification of T7 phage antibody library

The T7 phage antibody library was amplified using a liquid lysis method.

Detection of recombination Rate of PD1 protein nanobody library

Randomly picking the plaque in (5) to extract phage DNA; and taking the DNA as a template, performing PCR reaction according to the specification of a T7Select10 kit, detecting a PCR product by agarose gel electrophoresis, and displaying that the recombination positive rate of the constructed PD1 protein nano antibody library is 100% (see figure 1C).

2 Ni ion metal chelate affinity chromatography medium Ni-NTA elutriation anti-PD 1 nano antibody

(1) Cleaning of Ni-NTA medium:

100ml of Ni-NTA medium was taken in a 1.5 ml EP tube, and 1ml of sterilized water was added for 5 times, and the sterilized water was replaced with 0.05% TBST for the last time.

(2) Closing:

adding 1ml BSA blocking solution into the washed Ni-NTA medium, and blocking for 1h; after the end of the blocking, TBST was washed 4 times.

(3) Negative screen removes non-specifically bound phage:

diluting phage library to 1ml with TBST, adding into the closed Ni-NTA medium, placing on a turnover shaking instrument, and combining at room temperature for 30min; centrifuging, and obtaining the supernatant which is the T7 phage library after negative screening.

(4) Screening of phages specifically binding to PD1 protein:

20mg of PD1 protein was added to the phage library after negative screening and allowed to bind for 30min at room temperature. Then adding the mixture into a closed Ni-NTA medium, and combining for 30min at room temperature; centrifuging and discarding the supernatant. Washing the obtained precipitate with TBST for 5 times; centrifuging, and discarding the supernatant; 400ul of TB medium was added and mixed evenly, and the average was divided into two parts, one for determining the titer of the phage after screening and one for amplifying the phage after screening.

(5) Amplification of phages after screening:

adding the screened phage into 50ml of host bacteria, shake culturing at 37 ℃ until white flocculent precipitate appears, and stopping culturing; centrifuging, wherein the supernatant is amplified phage after the first round of screening and is used for the next round of screening; 3-4 rounds of screening were performed according to the same screening procedure.

3 ELISA to identify specific phages against PD1

Culturing the phage obtained in the last round on a 150mm TB solid medium, selecting 70 monoclonal plaques in BLT5403 host bacteria for liquid lysis method amplification, centrifuging, and obtaining the supernatant as the monoclonal phage;

ELISA plates were coated with 1mg of PD1 (extracellular fraction) protein per well, overnight at 4℃and the following day of BSA blocking at room temperature for 1h; adding monoclonal phage into each hole of the experimental group, adding wild type T7 phage in the control group, and incubating for 1h at room temperature; TBST washes away unbound phage, then adds rabbit anti-T7 phage 10A antibody and incubates for 1h at room temperature; washing with TBST for 3 times, adding HRP-labeled goat anti-rabbit antibody, and incubating for 1h at room temperature; washing TBST for 3 times, adding a color development liquid, placing an ELISA plate on an enzyme-labeled instrument, reading a light absorption value, and judging that the ELISA plate is positive clone when the ratio of an experimental hole to a control Kong Xiguang value is more than 2; DNA from positive clone phage was extracted for sequencing analysis.

Finally obtaining 2 nucleotide sequences; the amino acid sequences were analyzed and all three sequences have typical nanobody structures consisting of framework regions (FR 1, FR2, FR 4) and complementarity determining regions (CDR 1, CDR2 and CDR 3). The nucleotide sequences and amino acid sequences of the two phages are as follows: anti-PD 1-VHH1 nucleotide sequence (SEQ ID NO: 1); anti-PD 1-VHH1 amino acid sequence (SEQ ID NO: 2): framework region (FR 1-FR 4) and complementarity determining region (CDR 1-CDR 3) amino acid sequences: FR1 (SEQ ID NO: 3), CDR1 (SEQ ID NO: 4), FR2 (SEQ ID NO: 5), CDR2 (SEQ ID NO: 6), FR3 (SEQ ID NO: 7), CDR3 (SEQ ID NO: 8), FR4 (SEQ ID NO: 9), anti-PD 1-VHH2 nucleotide sequence (SEQ ID NO: 10), anti-PD 1-VHH2 amino acid sequence (SEQ ID NO: 11), framework regions (FR 1-FR 4) and complementarity determining region (CDR 1-CDR 3) amino acid sequences: FR1 (SEQ ID NO: 12), CDR1 (SEQ ID NO: 13), FR2 (SEQ ID NO: 14), CDR2 (SEQ ID NO: 15), FR3 (SEQ ID NO: 16), CDR3 (SEQ ID NO: 17), FR4 (SEQ ID NO: 18).

Example 3

Vector construction, expression and purification of 1 anti-PD 1 nanobody protein

(1) Vector construction and expression purification of anti-PD 1-VHH nanobodies (anti-PD 1Nb1, anti-PD 1Nb 2).

Double digestion is carried out on the nucleotide sequence of the anti-PD 1 nano antibody by EcoRI and HindIII, the digestion product is recovered by agarose gel electrophoresis gel digestion, and is inserted into PET32a to construct an expression vector of the anti-PD 1 nano antibody; transformation into BL21 (DE 3), IPTG induces expression. And (3) centrifuging the bacterial liquid to obtain bacterial precipitate, re-suspending with a lysis buffer, performing ultrasonic crushing, and centrifuging to collect the supernatant. The purified anti-PD 1 nanometer antibody is obtained by a Ni-IDA affinity chromatography method. Then detected by SDS-PAGE electrophoresis (see FIG. 2).

2. Determination of affinity constant of anti-PD 1 nanobody

Affinity constants for nanobody binding to PD1 were determined by ELISA. The concentration of antibody producing 50% of the maximum absorbance at the three antigen coating concentrations was measured separately and designated as [ Ab ]]t. Three [ Ab's are obtained]the t value and is used to calculate three K values according to the Beatty formula. The final affinity constant is the average of three K values. Affinity constants for nanobody binding to PD-1 were determined by ELISA. The affinity diagram of nanobody is shown in fig. 3. Kaff was calculated for VHH1 (see fig. 3A) and VHH2 (see fig. 3B). PD1 VHH1 kaff=0.82×10 ⁷ M ^- ，PD1 VHH2 kaff=1.54×10 ⁷ M ^- 。

Identification of the specificity of purified nanobodies by enzyme-linked immunosorbent assay (ELISA)

Coated antigen proteins PD1 (human), PD1 (murine), PD1 (monkey), CTLA4 (human), CD28 (human), BSA was used as control, 0.5mg per well overnight at 4 ℃; the next day, wash 3 times with PBST, block with 1% bsa for 2 hours at room temperature; diluting each nano antibody to 10mg/mL, respectively taking 100mL to incubate with each hole, and reacting for 1 hour at room temperature; unbound antibody was washed off with PBST, and 1:1000 dilution of rabbit anti-HA monoclonal antibody was added and incubated for one hour at room temperature. Plates were washed 3 times with TBST, and HRP-labeled goat anti-rabbit secondary antibody diluted 1:2000 was added and incubated for one hour at room temperature. TBST plates were washed 3 times, color development solution was added, and ELISA plates were placed on an ELISA reader to read the absorbance. The specificity of the nano-antibodies is judged according to the absorption value, and the detection result shows that the two nano-antibodies can interact with human-source and monkey-source PD1, and the nano-antibodies have better specificity. FIG. 4 shows the specificity of a representative anti-iPD 1 Nb.

The foregoing is only a preferred embodiment of the present invention, but the scope of the present invention is not limited thereto, and any person skilled in the art, who is within the scope of the present invention, should make equivalent substitutions or modifications according to the technical scheme of the present invention and the inventive concept thereof, and should be covered by the scope of the present invention.

Sequence listing

<110> Hua Shang Sai round, jiangsu target biological medicine research all Co., ltd

<120> an anti-PD 1 nanobody, and preparation method and application thereof

<130> 2021

<160> 22

<170> SIPOSequenceListing 1.0

<210> 1

<211> 360

<212> DNA

<213> Artificial sequence (anti-PD 1-VHH1 nucleotide sequence)

<400> 1

caggtgcagc tggtggagtc tgggggaggc tcggtgcagg ctggagggtc tctgagactc 60

tcctgcgcag cctctggata cgccagcagt agctactcca tgggctggtt ccgccaggct 120

ccagggaagg agcgcgaggc ggtcgcaggt gttaatcgtg atggtagtac aagatacgca 180

gactccgtga aggaccgatt caccatctcc aaagacaacg ccaagaacac tctgtatctc 240

caaatgaaca gcctgaaacc tgaggacact gccatgtatt actgtgcggc agatcggggt 300

tgggtactcc cccgtcgacc ggaatactgg ggccagggga cccaggtcac cgtctcctca 360

<210> 2

<211> 119

<212> PRT

<213> Artificial sequence (anti-PD 1-VHH1 amino acid sequence)

<400> 2

Gln Val Gln Leu Val Glu Ser Gly Gly Gly Ser Val Gln Ala Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Tyr Ala Ser Ser Ser Tyr

20 25 30

Ser Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Ala Val

35 40 45

Ala Gly Val Asn Arg Asp Gly Ser Thr Arg Tyr Ala Asp Ser Val Lys

50 55 60

Gly Arg Phe Thr Ile Ser Lys Asp Asn Ala Lys Asn Thr Leu Tyr Leu

65 70 75 80

Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Met Tyr Tyr Cys Ala

85 90 95

Ala Asp Arg Gly Trp Leu Pro Arg Arg Pro Asp Tyr Trp Gly Gln Gly

100 105 110

Thr Gln Val Thr Val Ser Ser

115

<210> 3

<211> 25

<212> PRT

<213> Artificial sequence (framework region FR1 amino acid sequence)

<400> 3

Gln Val Gln Leu Val Glu Ser Gly Gly Gly Ser Val Gln Ala Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser

20 25

<210> 4

<211> 10

<212> PRT

<213> Artificial sequence (framework region CDR1 amino acid sequence)

<400> 4

Gly Tyr Ala Ser Ser Ser Tyr Ser Met Gly

1 5 10

<210> 5

<211> 15

<212> PRT

<213> Artificial sequence (framework region FR2 amino acid sequence)

<400> 5

Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Ala Val Ala Gly

1 5 10 15

<210> 6

<211> 7

<212> PRT

<213> Artificial sequence (framework region CDR2 amino acid sequence)

<400> 6

Val Asn Arg Asp Gly Ser Thr

1 5

<210> 7

<211> 38

<212> PRT

<213> Artificial sequence (framework region FR3 amino acid sequence)

<400> 7

Arg Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Lys Asp Asn

1 5 10 15

Ala Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Lys Pro Glu Asp

20 25 30

Thr Ala Met Tyr Tyr Cys

35

<210> 8

<211> 13

<212> PRT

<213> Artificial sequence (framework region CDR3 amino acid sequence)

<400> 8

Ala Ala Asp Arg Gly Trp Leu Pro Arg Arg Pro Asp Tyr

1 5 10

<210> 9

<211> 11

<212> PRT

<213> Artificial sequence (framework region FR4 amino acid sequence)

<400> 9

Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser

1 5 10

<210> 10

<211> 360

<212> DNA

<213> Artificial sequence (anti-PD 1-VHH2 nucleotide sequence)

<400> 10

caggtgcagc tggtggagtc tgggggaggc tcggtgcagg ctggagggtc tctgagactc 60

tcctgtgcgt cctctggata cacctggaat aggtactcca tgggctggtt ccgccaggct 120

ccagggaagg agcgcgaggc ggtcgccggt attaatcgtg atggtagttt aagatacgca 180

gactccgtga agggccgatt caccatctcg aaagacaacg ccaagaacac tctgtatctc 240

caaatgaaca gcctgaaacc tgaggacact gccatgtact attgtgcggc agatcggaat 300

tgggtactcc cccgtcgacc ggactactgg ggccagggga cccaggtcac cgtctcctca 360

<210> 11

<211> 118

<212> PRT

<213> Artificial sequence (anti-PD 1-VHH2 amino acid sequence)

<400> 11

Gln Val Gln Leu Val Glu Ser Gly Gly Gly Ser Val Gln Ala Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Ala Ser Ser Gly Tyr Thr Trp Asn Arg Tyr Ser

20 25 30

Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Ala Val Ala

35 40 45

Gly Ile Asn Arg Asp Gly Ser Leu Arg Tyr Ala Asp Ser Val Lys Gly

50 55 60

Arg Phe Thr Ile Ser Lys Asp Asn Ala Lys Asn Thr Leu Tyr Leu Gln

65 70 75 80

Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Met Tyr Tyr Cys Ala Ala

85 90 95

Asp Arg Asn Trp Leu Pro Arg Arg Pro Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Gln Val Thr Val Ser Ser

115

<210> 12

<211> 24

<212> PRT

<213> Artificial sequence (framework region FR1 amino acid sequence)

<400> 12

Gln Val Gln Leu Val Glu Ser Gly Gly Gly Ser Val Gln Ala Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Ala Ser Ser

20

<210> 13

<211> 10

<212> PRT

<213> Artificial sequence (complementarity determining region CDR1 amino acid sequence)

<400> 13

Gly Tyr Thr Trp Asn Arg Tyr Ser Met Gly

1 5 10

<210> 14

<211> 15

<212> PRT

<213> Artificial sequence (framework region FR2 amino acid sequence)

<400> 14

Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Ala Val Ala Gly

1 5 10 15

<210> 15

<211> 7

<212> PRT

<213> Artificial sequence (complementarity determining region CDR2 amino acid sequence)

<400> 15

Ile Asn Arg Asp Gly Ser Leu

1 5

<210> 16

<211> 38

<212> PRT

<213> Artificial sequence (framework region FR3 amino acid sequence)

<400> 16

Arg Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Lys Asp Asn

1 5 10 15

Ala Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Lys Pro Glu Asp

20 25 30

Thr Ala Met Tyr Tyr Cys

35

<210> 17

<211> 13

<212> PRT

<213> Artificial sequence (complementarity determining region CDR3 amino acid sequence)

<400> 17

Ala Ala Asp Arg Asn Trp Leu Pro Arg Arg Pro Asp Tyr

1 5 10

<210> 18

<211> 11

<212> PRT

<213> Artificial sequence (framework region FR4 amino acid sequence)

<400> 18

Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser

1 5 10

<210> 19

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 19

gtcctggctg ctcttctaca agg 23

<210> 20

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 20

ggtacgtgct gttgaactgt tcc 23

<210> 21

<211> 33

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 21

ccggaattct caggtgcagc tggtggagtc tgg 33

<210> 22

<211> 31

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 22

gcccaagctt tgaggagacg gtgacctggg t 31

Claims

1. An anti-PD 1 nanobody, characterized in that: the VHH chain of the anti-PD 1 nano antibody is an amino acid sequence shown as SEQ ID NO. 2.

2. A nucleic acid molecule encoding the anti-PD 1 nanobody of claim 1.

3. The nucleic acid molecule according to claim 2, wherein the nucleotide sequence is shown in SEQ ID NO. 1.

4. A recombinant vector comprising the nucleic acid of claim 3.

5. A host cell comprising the nucleic acid of claim 3 or the vector of claim 4.

6. Use of the anti-PD 1 nanobody of claim 1 in the preparation of a kit for detecting PD 1.