CN103394097A - Primers of transmissible gastroenteritis-porcine epidemic diarrhea combined vaccine and preparation method - Google Patents
Primers of transmissible gastroenteritis-porcine epidemic diarrhea combined vaccine and preparation method Download PDFInfo
- Publication number
- CN103394097A CN103394097A CN2013102426485A CN201310242648A CN103394097A CN 103394097 A CN103394097 A CN 103394097A CN 2013102426485 A CN2013102426485 A CN 2013102426485A CN 201310242648 A CN201310242648 A CN 201310242648A CN 103394097 A CN103394097 A CN 103394097A
- Authority
- CN
- China
- Prior art keywords
- tgev
- epidemic diarrhea
- porcine epidemic
- sequence table
- pedv
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention relates to primers of a transmissible gastroenteritis-porcine epidemic diarrhea combined vaccine and a preparation method. The transmissible gastroenteritis-porcine epidemic diarrhea combined vaccine has a sequence shown as Seq No.1 in a sequence table. Specifically, for the primer pair used for amplification of the transmissible gastroenteritis virus TGEV S2106, the upper primer P1 is shown as Seq No.2 in the sequence table, and the lower primer P2 is shown as Seq No.3 in the sequence table; for the primer pair used for amplification of the porcine epidemic diarrhea virus's S gene PEDV S4155, the upper primer P3 is shown as Seq No.4 in the sequence table, and the lower primer P4 is shown as Seq No.5 in the sequence table. The preparation method of the nucleic acid vaccine is simple, saves time and labor, the cost is low, the vaccine has good stability, and is convenient for storage and transportation. And there exists no virulence loss or virulence reversion phenomenon.
Description
Technical field
The present invention relates to a kind of gene technology field, be specifically related to primer and the preparation method of a kind of transmissible gastroenteritis of swine and epidemic diarrhea two vaccines.
Background technology
Nucleic acid vaccine is directly to import the exogenous gene (DNA or RNA) of certain antigen protein of coding in animal somatic cell, and by the expression system synthetic antigen albumen of host cell, induce the host to produce the immunne response to this antigen protein, to reach the purpose of prevention and treatment disease.
Nucleic acid vaccine is because of its good immune effect, and dangerous low, immunne response is lasting, combined immunization can be provided, and method is easy, and is cheap, be easy to preserve and the characteristics such as transportation have solved the problems that exist in present immune formulation, showed superiority and development potentiality that it is powerful.Traditional vaccine, owing to existing the protection effect undesirable, has the problems such as virus infectivity reply and loose poison, virus pollution.With two kinds of nucleic acid vaccines, easily cause the carrier interaction to affect the stress of destination gene expression and animal during immune animal simultaneously.
Transmissible gastroenteritis of swine (TGE) is the height contact intestinal tract disease of the pig that caused by transmissible gastro-enteritis virus (TGEV), this disease of the equal susceptible of each monthly age pig, but mainly cause 1-2 piglet morbidity in age in week, mortality rate nearly 100%.Porcine epizootic diarrhea (PED) is a kind of Intestinum Sus domestica road transmission disease take vomiting, diarrhoea and dehydration as feature that is caused by Porcine epidemic diarrhea virus (PEDV).The pig at various ages all can fall ill, and 20 ages in days are with interior piglet mortality rate nearly 100%.This two-strain all belongs to the coronaviridae coronavirus genus, is two kinds of important infectious disease of harm pig industry, in the world, distributes very wide, to pig industry, brings huge economic loss.The spike protein (S albumen) that has been reported two-strain all is positioned at tissue tropism and the antigenicity that viral outermost is determining virus.And the S albumen of two-strain all can induce body to produce neutralizing antibody.Therefore can utilize this gene preparation nucleic acid vaccine.
Summary of the invention
The object of the present invention is to provide that a kind of production cost is low, good immune effect, the combined immunization vaccine that the immunne response persistent period is long.The S genetic fragment that the two-strain immunoreactivity is stronger utilizes gene recombination technology to prepare two nucleic acid vaccines.Another object of the present invention is to provide a kind of recombination method of above-mentioned two nucleic acid vaccines.
Purpose of the present invention is achieved through the following technical solutions:
Two nucleic acid vaccines of a kind of transmissible gastro-enteritis virus and Porcine epidemic diarrhea virus (pIRES-TGEV S2106-PEDV S4155), sequence is as shown in sequence table Seq No.1.
The present invention also has following technical characterictic:
1, two nucleic acid vaccines of a kind of transmissible gastro-enteritis virus and Porcine epidemic diarrhea virus, primer pair for the transmissible gastro-enteritis virus TGEV S2106 that increases, upper primer P1: as shown in sequence table Seq No.2, lower primer P2: as shown in sequence table SeqNo.3.
2, two nucleic acid vaccines of a kind of transmissible gastro-enteritis virus and Porcine epidemic diarrhea virus, the primer pair of S gene PEDV S4155 for the Porcine epidemic diarrhea virus of increasing, upper primer P3: as shown in sequence table Seq No.4, lower primer P4: as shown in sequence table Seq No.5.
3, the construction method of two nucleic acid vaccines of a kind of transmissible gastro-enteritis virus and Porcine epidemic diarrhea virus (pIRES-TGEV S2106-PEDV S4155), comprise the steps:
(1) with the nucleotide sequence design primer pair of the recombiant plasmid (EasyT-S) that contains the pig infectious gastroenteritis virus S full length gene, upper primer, sequence is as shown in sequence table Seq No.2, and lower primer is as shown in sequence table SeqNo.3;
(2) with the nucleotide sequence design primer pair of the recombiant plasmid (EasyT-S) that contains Porcine epidemic diarrhea virus S full length gene, upper primer, sequence is as shown in sequence table Seq No.4, and lower primer is as shown in sequence table Seq No.5;
(3) carry out conventional chain polymerization enzyme reaction increase respectively TGEV S2106 and PEDV S4155 gene;
(4) construction recombination plasmid pIRES-TGEV S2106-PEDV S4155.
4, the construction method of two nucleic acid vaccines of a kind of transmissible gastro-enteritis virus as above and Porcine epidemic diarrhea virus (pIRES-TGEV S2106-PEDV S4155): described step (3) adopts the concrete steps of conventional chain polymerization enzyme reaction amplification TGEV S2106 gene as follows: by mixed liquor in 94 ℃ of 5min, 94 ℃ of 60s, 53.1 ℃ 60s, 72 ℃ of 150s, 30 circulations; 72 ℃ of 10min.Described mixed liquor is composed as follows:
5, the construction method of two nucleic acid vaccines of a kind of transmissible gastro-enteritis virus as above and Porcine epidemic diarrhea virus (pIRES-TGEV S2106-PEDV S4155), described step (3) adopt the concrete steps of conventional chain polymerization enzyme reaction amplification PEDV S4155 gene as follows: by mixed liquor in 94 ℃ of denaturation 5min; Then 94 ℃ of 60s, 56.8 ℃ of 60s, 72 ℃ of 4m15s, 30 circulations; Last 72 ℃ of 10min.
Described mixed liquor is composed as follows:
6, the construction method of two nucleic acid vaccines of a kind of transmissible gastro-enteritis virus as above and Porcine epidemic diarrhea virus (pIRES-TGEV S2106-PEDV S4155): the construction method concrete steps of described step (4) recombiant plasmid pIRES-TGEV S2106-PEDV S4155 are as follows: first by PCR product TGEV S2106 gene through Nhe I and EcoR I enzyme action, utilize glue to reclaim test kit and reclaim purification genes of interest fragment, genes of interest after purification is cloned into to Nhe I and the EcoR I site construction recombination plasmid pIRES-TGEV S2106 of expression vector pIRES, again by PCR product P EDV S4155 gene through Sal I and Not I enzyme action, utilize glue to reclaim test kit and reclaim purification genes of interest fragment, the genes of interest after purification is cloned into to Sal I and the Not I site of recombiant plasmid pIRES-TGEV S2106.Correct recombiant plasmid called after pIRES-TGEV S2106-PEDV S4155 will be identified
This method, first by the preparation of the S gene of TGEV and PEDV for combined nucleic acid vaccine, is transformed into JM109 clone bacterium by recombinant vector pIRES-TGEV S2106-PEDV S4155 and can obtains great expression.This preparation method of nucleic acid vaccine is simple, and is time saving and energy saving, and cost is low, good stability, and the immunne response persistent period is long, stores and convenient transportation.And do not have virulence to lose and the phenomenon of virulence reversion.Due to this nucleic acid vaccine, can produce simultaneously the protective capability of two-strain; on practical clinical, both avoid the interactional probability of different carriers generation between duration of immunity also to avoid repeatedly immune waste and the Animal stress phenomenon that causes, and can also reach the purpose of two kinds of diseases of a kind of vaccine prevention of inoculation.Safety in zoopery is assessed to the pIRES carrier simultaneously, for its later clinical practice provides reference.
The accompanying drawing explanation
Fig. 1 is the evaluation figure of recombiant plasmid pIRES-TGEV S2106
(A) TGEV S2106 gene PCR amplification figure;
Wherein, M:DNA marker; 1:TGEV S2106 gene amplification result;
(B) be Nhe I and the EcoR I double digestion evaluation figure of recombiant plasmid pIRES-TGEV S2106;
Wherein, M:DNAmarker; 1: recombiant plasmid Nhe I and EcoR I double digestion are identified.
Fig. 2 is the evaluation figure of recombiant plasmid pIRES-TGEV S2106-PEDV S4155;
(A) PEDV S4155 gene PCR amplification figure;
Wherein, M:DNA marker; 1:PEDV S4155 gene amplification result;
(B) be Sal I and the Not I double digestion evaluation figure of recombiant plasmid pIRES-TGEV S2106-PEDV S4155;
Wherein, M:DNAmarker; 1: recombiant plasmid Sal I and Not I double digestion are identified.
Fig. 3 is the structure schematic diagram of recombiant plasmid pIRES-TGEV S2106-PEDV S4155;
Fig. 4 is the external transient transfection result of indirect immunofluorescene assay eukaryon expression plasmid.
Wherein, A: ghost contrast; The contrast of B:pPIRES empty carrier; C:TGEV S multi-resistance detects the in-vitro transfection of recombiant plasmid pIRES-TGEV S2106-PEDV S4155; D:PEDV totivirus multi-resistance detects the in-vitro transfection of recombiant plasmid pIRES-TGEV S2106-PEDV S4155.
Fig. 5 is immune mouse peripheral blood CD4+T cell subsets number change figure.
Fig. 6 is immune mouse peripheral blood CD8+T cell subsets number change figure.
Fig. 7 is the dynamic change of the anti-TGEV S of mouse peripheral blood IgG antibody content.
Fig. 8 is the dynamic change of the anti-PEDV S of mouse peripheral blood IgG antibody content.
The specific embodiment
The present invention is described in further detail below in conjunction with embodiment and accompanying drawing:
The structure of recombiant plasmid pIRES-TGEV S2106
1, take the recombiant plasmid (EasyT-S) that contains the pig infectious gastroenteritis virus S full length gene as template, TGEV S2106 fragment is carried out to pcr amplification, design primer P1 and P2:
P1:GGGG
GCTAGCCCATGAAAAAACTATTTG (underscore represents that restriction enzyme site is Nhe I)
P2:CCCC
GAATTCTTAGTTTGTCTAATAA (underscore represents that restriction enzyme site is EcoR I)
2, carry out conventional chain polymerization enzyme reaction amplification TGEV S2106 gene
Take the recombiant plasmid (EasyT-S) that contains the pig infectious gastroenteritis virus S full length gene as template, take P1 and P2 as primer, carry out pcr amplification: by mixed liquor in 94 ℃ of denaturation 5min; Then 94 ℃ of 60s, 53.1 ℃ of 60s, 72 ℃ of 150s, 30 circulations; Last 72 ℃ of 10min.The PCR product is identified in 1% agarose gel electrophoresis.Result is as shown in Fig. 1 (A).
Described mixed liquor is composed as follows:
3, the structure of recombiant plasmid pIRES-TGEV S2106 and evaluation
With restricted enzyme Nhe I and EcoR I difference enzyme action PCR purified product and pIRES carrier, obtain respectively TGEV S2106 genetic fragment and linear carrier pIRES, by product 1% agarose gel electrophoresis, according to Shanghai hundred Tyke glue, reclaim the test kit description and reclaim.Connect, transform, choose bacterium, the upgrading grain carries out the double digestion evaluation with restricted enzyme Nhe I and EcoR I, double digestion is identified as shown in Fig. 1 (B).The plasmid of the doubtful positive is checked order, order-checking is accredited as to positive recombiant plasmid called after pIRES-TGEVS2106.
The structure of recombinant expression carrier pIRES-TGEV S2106-PEDV S4155
1, take the recombiant plasmid (EasyT-S) that contains Porcine epidemic diarrhea virus S full-length gene as template, PEDV S4155 fragment is carried out to pcr amplification, design primer P3 and P4:
P3:5 '-GGGG
GTCGACATGGATGTCACTAGGTGCC-3 ' (underscore represents that restriction enzyme site is Sal I)
P4:5 '-CCCC
GCGGCCGCTCATCTCTGCACGTGGAC-3 ' (underscore represents that restriction enzyme site is Not I)
2, carry out conventional chain polymerization enzyme reaction amplification PEDV S4155 gene
Take the recombiant plasmid (EasyT-S) that contains Porcine epidemic diarrhea virus S full-length gene as template, take P3 and P4 as primer, carry out pcr amplification: by mixed liquor in 94 ℃ of denaturation 5min; Then 94 ℃ of 60s, 56.8 ℃ of 60s, 72 ℃ of 4m15s, 30 circulations; Last 72 ℃ of 10min.The PCR product is identified in 1% agarose gel electrophoresis.Result is as shown in Fig. 2 (A).
Described mixed liquor is composed as follows:
3, the structure of pIRES-TGEV S2106-PEDV S4155 carrier
With restricted enzyme Sal I and Not I, process PCR purified product and pIRES-TGEV S2106 carrier, obtain respectively PEDV S4155 genetic fragment and linear carrier pIRES-TGEV S2106, by product 1% agarose gel electrophoresis, according to Shanghai hundred Tyke glue, reclaim the test kit description and carry out.Connect, transform, choose bacterium, upgrading grain restricted enzyme Sal I and Not I evaluation, double digestion is identified as shown in Fig. 2 (B).The plasmid of the doubtful positive is checked order, order-checking is accredited as to positive recombiant plasmid called after pIRES-TGEVS2106-PEDV S4155.The building process of recombiant plasmid pIRES-TGEV S2106-PEDV S4155 as shown in Figure 3.
Recombinant expression carrier pIRES-TGEV S2106-PEDV S4155 vivoexpression situation
Recombinant expression carrier pIRES-TGEV S2106-PEDV S4155 is transfected in the BHK-21 cell, after 24 hours, with TGEV S multi-resistance and PEDV totivirus multi-resistance, detect its expression in eukaryotic cell, destination protein has obtained expression, and expression of results as shown in Figure 4.
Embodiment 4
Immune mouse
(1) according to " molecular cloning test guide ", with alkaline lysis, prepare in a large number recombiant plasmid, PEG-MgCl
2After purification, be dissolved in sterilizing TE, with ultraviolet spectrophotometer, carry out plasmid concentration mensuration, with appropriate sterilizing 0.1M PBS, final concentration is adjusted to 1 μ g/ μ L.
(2) get 18-25g, the kunming mice in age in 6-8 week, be divided at random 4 groups: called after PBS group, empty plasmid pIRES organize respectively, recombiant plasmid pIRES-TGEV S2106-PEDV S4155 organizes, TGEV/PEDV bigeminal live vaccine group (positive control), 28 every group.The first inject salt lidocaine hydrochloride of leg muscle 50 μ L/ only, after 15min, by above grouping leg muscle, only inject PBS, empty plasmid pIRES, recombiant plasmid, TGEV/PEDV bigeminal live vaccine 100 μ L/ respectively, respectively called after PBS group, PIRES group, plasmid group, vaccine group.At interval of two week immunity 1 time, immunity is 3 times altogether, respectively at before immunity and the 7d after immunity, and 14d, 21d, 28d, 35d, every group of 42d get 3 mices, and eyeball is got blood and is prepared the quantity that serum detects antibody and detection t lymphocyte subset group.
The detection of t lymphocyte subset group quantity
(1) separation of peripheral blood lymphocyte
The eyeball of mouse blood sampling, a part does not add the anticoagulant separation of serum, another part adds 3.8% sodium citrate anticoagulant and prepares anticoagulation, with the dilution in 1: 1 of PBS (pH7.4) diluent, slowly add in the test tube that the 2mL lymphocyte separation medium is housed, this moment, upper strata was blood, and lower floor is lymphocyte separation medium, with 2000rpm horizontal centrifugal 20min.With 2000rpm horizontal centrifugal 20min.Collect the nebulous buffy coat that is between plasma layer and lymphocyte separation medium layer, put into the test tube that contains incomplete RPMI1640 (namely not containing hyclone and two anti-) culture fluid 3mL, after fully mixing, with the centrifugal 15min of 1500rpm.Abandon the supernatant precipitation and with the centrifugal 15min of 1500rpm, wash twice with the incomplete RPMI1640 culture fluid of 3mL cleaning mixture, the gained precipitation is namely lymphocyte.Cell precipitation suspends with the nutritional solution of the complete RPMI1640 of 1mL, and the vigor that carries out detects and counting.
(2) detection of lymphocyte subpopulation quantity
By the blood lymphocytes suspension of preparation in (1), and by its concentration furnishing 1 * 10
7Every milliliter, individual cell, every duplicate samples are got 500 μ L, the centrifugal 5min precipitation of 3000 * g lymphocyte.With cold PBS buffer (pH7.4), wash 2 times the centrifugal 5min of each 3000 * g.Then add respectively the CD4+-FITC labelling of dilution in 1: 1000, the pre-cooling PBS100 μ L of CD8+-FITC traget antibody to react, 4 ℃ hatch 30min after, with cold PBS buffer (pH7.4), wash 2 times, add 500 μ L buffer resuspended, flow cytometer detects.Testing result as shown in Figure 5,6.
Embodiment 6
ELISA detects antibody
(1) respectively with in the coated ELISA ELISA Plate of TGEV and PEDV200 μ l/ hole, 4 ℃ of standing coated spending the night;
(2) with PBST (PBS, the pH7.4 that contain 0.5%Tween-20), wash plate 3 times, each 5min, then add the confining liquid (0.5% skimmed milk) in 200 μ L/ holes, 37 ℃ of effect 2h;
(3) with PBST, wash plate 3 times, each 5min, add the tested blood serum sample of 50 times of dilutions, 100 μ L/ holes, 37 ℃ of effect 1h;
(4) with PBST, wash plate 3 times, add the mountain sheep anti-mouse igg enzyme labelled antibody 100 μ L of the HRP labelling of 5000 times of dilutions, 37 ℃ of effect 1h, washing;
(5) add the nitrite ion OPD100 μ L of new preparation, 37 ℃ of black out effect 10min, add 2mol/L sulphuric acid 50 μ L cessation reactions, in the OD value that reads successively on enzyme-linked immunosorbent assay instrument under 490nm.According to following formula, calculate P/N value: P/N=(sample OD value to be checked-blank OD value)/(negative control OD value-blank OD value), result is judged, with P/N value >=2.0, is judged to the positive, P adds<be judged to feminine gender at 2.0 o'clock.The antibody test result as shown in Figure 7,8.
Claims (7)
1. two nucleic acid vaccines of a transmissible gastro-enteritis virus and Porcine epidemic diarrhea virus, is characterized in that, sequence is as shown in sequence table Seq No.1.
2. two nucleic acid vaccines of a kind of transmissible gastro-enteritis virus and Porcine epidemic diarrhea virus according to claim 1, the primer pair be used to the transmissible gastro-enteritis virus TGEV S2106 that increases, is characterized in that,
Upper primer P1: as shown in sequence table SeqNo.2,
Lower primer P2: as shown in sequence table Seq No.3.
3. two nucleic acid vaccines of a kind of transmissible gastro-enteritis virus and Porcine epidemic diarrhea virus according to claim 1, the primer pair be used to the S gene PEDV S4155 of the Porcine epidemic diarrhea virus of increasing, is characterized in that,
Upper primer P3: as shown in sequence table SeqNo.4,
Lower primer P4: as shown in sequence table Seq No.5.
4. the construction method of two nucleic acid vaccines of a transmissible gastro-enteritis virus and Porcine epidemic diarrhea virus,
It is characterized in that, comprise the steps:
(1), with the nucleotide sequence design primer pair of the recombiant plasmid EasyT-S that contains the pig infectious gastroenteritis virus S full length gene, upper primer, sequence is as shown in sequence table Seq No.2, lower primer is as shown in sequence table SeqNo.3;
(2), with the nucleotide sequence design primer pair of the recombiant plasmid EasyT-S that contains Porcine epidemic diarrhea virus S full length gene, upper primer, sequence is as shown in sequence table Seq No.4, lower primer is as shown in sequence table SeqNo.5;
(3), carry out conventional chain polymerization enzyme reaction increase respectively TGEV S2106 and PEDV S4155 gene;
(4), construction recombination plasmid pIRES-TGEV S2106-PEDV S4155.
5. the construction method of two nucleic acid vaccines of a kind of transmissible gastro-enteritis virus according to claim 4 and Porcine epidemic diarrhea virus, it is characterized in that: described step (3) adopts the concrete steps of conventional chain polymerization enzyme reaction amplification TGEV S2106 gene as follows: by mixed liquor in 94 ℃ of 5min, 94 ℃ of 60s, 53.1 ℃ 60s, 72 ℃ of 150s, 30 circulations; 72 ℃ of 10min;
Described mixed liquor is composed as follows:
6. the construction method of two nucleic acid vaccines of a kind of transmissible gastro-enteritis virus according to claim 4 and Porcine epidemic diarrhea virus, it is characterized in that, described step (3) adopts the concrete steps of conventional chain polymerization enzyme reaction amplification PEDV S4155 gene as follows: by mixed liquor in 94 ℃ of denaturation 5min; Then 94 ℃ of 60s, 56.8 ℃ of 60s, 72 ℃ of 4m15s, 30 circulations; Last 72 ℃ of 10min;
Described mixed liquor is composed as follows:
7. the construction method of two nucleic acid vaccines of a kind of transmissible gastro-enteritis virus according to claim 4 and Porcine epidemic diarrhea virus, it is characterized in that: the construction method concrete steps of described step (4) recombiant plasmid pIRES-TGEVS2106-PEDV S4155 are as follows: first by PCR product TGEV S2106 gene through Nhe I and EcoR I enzyme action, utilize glue to reclaim test kit and reclaim purification genes of interest fragment, the genes of interest after purification is cloned into to Nhe I and the EcoR I site construction recombination plasmid pIRES-TGEV S2106 of expression vector pIRES; Again by PCR product P EDV S4155 gene through Sal I and Not I enzyme action, utilize glue to reclaim test kit and reclaim purification genes of interest fragment, genes of interest after purification is cloned into to Sal I and the Not I site of recombiant plasmid pIRES-TGEV S2106, will identifies correct recombiant plasmid called after pIRES-TGEV S2106-PEDV S4155.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2013102426485A CN103394097A (en) | 2013-06-09 | 2013-06-09 | Primers of transmissible gastroenteritis-porcine epidemic diarrhea combined vaccine and preparation method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2013102426485A CN103394097A (en) | 2013-06-09 | 2013-06-09 | Primers of transmissible gastroenteritis-porcine epidemic diarrhea combined vaccine and preparation method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103394097A true CN103394097A (en) | 2013-11-20 |
Family
ID=49557940
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2013102426485A Pending CN103394097A (en) | 2013-06-09 | 2013-06-09 | Primers of transmissible gastroenteritis-porcine epidemic diarrhea combined vaccine and preparation method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103394097A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104805106A (en) * | 2014-05-14 | 2015-07-29 | 北京市农林科学院 | Fusion gene containing transmissible gastroenteritis virus (TGEV) and porcine epidemic diarrhea virus (PEDV) protective antigens as well as encoding protein and application thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004089983A2 (en) * | 2003-04-08 | 2004-10-21 | Coronovative B.V. | Severe acute respiratory syndrome (sars) causing coronavirus |
| CN1827172A (en) * | 2005-04-27 | 2006-09-06 | 中国人民解放军军事医学科学院军事兽医研究所 | Pig viral infectious disease gene recombined live vaccine using canine II type adenovirus as carrier and preparation process thereof |
| CN102574897A (en) * | 2009-07-07 | 2012-07-11 | 动物健康研究院 | Chimaeric protein |
| CN102586409A (en) * | 2011-01-14 | 2012-07-18 | 郑世民 | Multiple reverse transcription polymerase chain reaction detection method for swine transmissible gastroenteritis |
| CN102813941A (en) * | 2012-07-27 | 2012-12-12 | 厚朴生物科技（苏州）有限公司 | Application of growth factor gene drug in preventing and treating stress-related gastrointestinal injury |
-
2013
- 2013-06-09 CN CN2013102426485A patent/CN103394097A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004089983A2 (en) * | 2003-04-08 | 2004-10-21 | Coronovative B.V. | Severe acute respiratory syndrome (sars) causing coronavirus |
| CN1827172A (en) * | 2005-04-27 | 2006-09-06 | 中国人民解放军军事医学科学院军事兽医研究所 | Pig viral infectious disease gene recombined live vaccine using canine II type adenovirus as carrier and preparation process thereof |
| CN102574897A (en) * | 2009-07-07 | 2012-07-11 | 动物健康研究院 | Chimaeric protein |
| CN102586409A (en) * | 2011-01-14 | 2012-07-18 | 郑世民 | Multiple reverse transcription polymerase chain reaction detection method for swine transmissible gastroenteritis |
| CN102813941A (en) * | 2012-07-27 | 2012-12-12 | 厚朴生物科技（苏州）有限公司 | Application of growth factor gene drug in preventing and treating stress-related gastrointestinal injury |
Non-Patent Citations (2)
| Title |
|---|
| MENG F.等: "Evaluation on the Efficacy and Immunogenicity of Recombinant DNA Plasmids Expressing Spike Genes from Porcine Transmissible Gastroenteritis Virus and Porcine Epidemic Diarrhea Virus", 《PLOS ONE》 * |
| 张硕等: "抗猪传染性胃肠炎病毒重组S蛋白单克隆抗体的制备与鉴定", 《中国兽医杂志》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104805106A (en) * | 2014-05-14 | 2015-07-29 | 北京市农林科学院 | Fusion gene containing transmissible gastroenteritis virus (TGEV) and porcine epidemic diarrhea virus (PEDV) protective antigens as well as encoding protein and application thereof |
| CN104805106B (en) * | 2014-05-14 | 2018-07-03 | 北京市农林科学院 | The fusion and its coding albumen of the protective antigens containing TGEV and PEDV and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101900731B (en) | ELISA kit for distinctively detecting antibodies of classical swine fever (CSF) vaccine immunity and wild virus infection and preparation method thereof | |
| CN103539842B (en) | Recombinant protein coded by grass carp reovirus (GCRV) type-II S10 gene, polyclonal antibody prepared from recombinant protein and application of recombinant protein | |
| CN103751774B (en) | The recombinant cell lines of stably express CSFV E 2 protein and in the application of preparing in subunit vaccine for swine fever and diagnostic reagent | |
| Chand et al. | Bluetongue in India: A review | |
| CN103301476A (en) | Porcine epizootic diarrhea gene recombinant vaccine as well as constructed primer and construction method thereof | |
| CN101968490A (en) | Indirect ELISA (Enzyme-Linked Immunosorbent Assay) method and kit for detecting haemophilus parasuis antibodies | |
| CN102023217A (en) | Double-antibody biotin-Avidin ELISA (enzyme-linked immuno sorbent assay) detection kit for cattle viral diarrhea virus and application method thereof | |
| CN102731615A (en) | Detection reagent and detection method for PRRSV | |
| CN109001450A (en) | A kind of kit and preparation method detecting chicken Mycoplasma synoviae antibody | |
| CN103751773A (en) | Recombinant BHK cell line for stably expressing classical swine fever virus E0-E1-E2 protein, and applications of the same in preparation of vaccines and diagnosis reagents of classical swine fever | |
| CN107974513A (en) | A kind of bovine viral diarrhea virus detection kit and its application based on RPA | |
| CN106866796A (en) | The recombinant protein of the type S9 gene codes of GCRV II and its application | |
| CN111999497A (en) | Enzyme linked immunosorbent assay kit for detecting rabies virus glycoprotein antigen and application thereof | |
| Fukutomi et al. | Detection of bovine coronaviruses from adult cows with epizootic diarrhea and their antigenic and biological diversities | |
| CN105348386B (en) | The monoclonal antibody cocktail and detection kit of the O-shaped virus of resistant to foot and mouth disease | |
| CN112920268B (en) | ASFV-p54 protein specific nano antibody-HRP fusion protein, preparation method and application | |
| CN101799471A (en) | Indirect ELISA (Enzyme-Linked Immuno Sorbent Assay) method established based on classical swine fever virus NS3 | |
| CN104548087B (en) | Epitope vaccine for resisting A/B subgroup avian leucosis virus infection and preparation method and application of epitope vaccine | |
| CN103394097A (en) | Primers of transmissible gastroenteritis-porcine epidemic diarrhea combined vaccine and preparation method | |
| CN109182248A (en) | A kind of antibody against swine fever virus detection ELISA diagnostic kit | |
| CN104894045A (en) | Recombinant lactobacillus for coexpression of foot and mouth disease virus VP1 gene and immunoadjuvant cattle IL-6 gene, and preparation method and application of recombinant lactobacillus | |
| Mohapatra et al. | Alternate vaccine strain selection in the wake of emerging foot-and-mouth disease virus serotype A antigenic variants in India | |
| CN101955950A (en) | Method for preparing recombinant fibrin-related antigen of egg drop syndrome viruses | |
| CN102680682A (en) | Kit for detecting antibody of reticuloendotheliosis virus (REV) through enzyme-linked immunosorbent assay (ELISA) | |
| CN109762825A (en) | A kind of the chicken virus mycoplasma antibody detection method and its dedicated kit of enzyme-linked aptamer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C05 | Deemed withdrawal (patent law before 1993) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20131120 |