CN103382481A - Expression vector of human stromal cell-derived factor-1alpha, and construction method and application thereof - Google Patents

Abstract

The invention discloses an expression vector of a human stromal cell-derived factor-1alpha (hSDF-1alpha), and a construction method and an application thereof. The disclosed expression vector of the hSDF-1alpha is a recombinant plasmid pET15b-hSDF-1alpha constructed by inserting an hSDF-1alpha gene into a plasmid pET15b. At the same time, the invention discloses the construction method for the expression vector of the hSDF-1alpha, and also discloses that the constructed expression vector is induced into escherichia coli BL21 (DE3) for expression of the hSDF-1alpha.

Description

Expression vector, construction process and the application of people source stromal cell derived factor 1α

Technical field

The invention belongs to technical field of bioengineering, specifically, what the present invention relates to is expression vector, the construction process of this expression vector and the application of this expression vector of people source stromal cell derived factor 1α.

Background technology

Stromal cell derived factor-1 (stromal cell-derived factor, SDF-1) be the present known the strongest chemokine relevant with stem cell mobilization, it can activate a series of signal path by being combined with its specific receptors CXCR4, thereby plays the effect that stem cell mobilization, induction of vascular regeneration were regulated, promoted to inflammation after tissue ischemia.

SDF-1 belongs to CXC class chemokine, people SDF-1(hSDF-1) encoding sequence is positioned on 10q11.1 karyomit(e), and the form of SDF-1 mainly contains two kinds in vivo, is respectively SDF-1 α and SDF-1 β, take SDF-1 α as main.

Gro-beta-T acceptor 4(CXC chemokine receptor 4 CXCR4) is the specific receptors of SDF-1, it be one by 352 Amino acid profiles and g protein coupled receptor that comprise 7 transbilayer helix body structures.Wide expression is in BMNC and stem cell.SDF-1 can activate a series of signal path after its specific receptors CXCR4 that expresses on target cell is combined, thereby affects the various biological behaviours of target cell, such as growth, motion, chemotactic, secrete, stick, vasculogenesis etc.SDF-1 can impel CXCR4 to form dimer after CXCR4 is combined, its space conformation be changed and internalization.The biological axle of SDF-1/CXCR4 has very important biological function, plays a role in the genesis of various diseases, and is also more and more deep to its research.The main biological function of its that report has in application of stem cells treats the migration of adjusting stem cell in ischemic-hypoxic brain injury and promotes that hyperplasia, the growth course of invading profit transfer, participation embryo of modulate tumor, the mediated immunity inflammatory reaction while of damage zone blood vessel are relevant with the infection of HIV.

Expression study about SDF-1 α in prior art specifically has:

(1) grand the time, Zhang Ping, Wang Chunmei, prokaryotic expression and purifying Deng the .GST-SDF-1 alpha fusion protein. the science and technology engineering, 2007,7 (14): the SDF-1 α gene of clone mouse is disclosed in 3366-3367, purifying the prokaryotic expression product of fusion gene GST-SDF-1 α.

(2) Yao Feng, Zhou Junmei, Wang Zuo waits .SD rat SDF-1 α gene cloning and sequencing. Chinese experimental animal journal, 2008,16 (1): disclose the SDF-1 α gene of EDNRB in 15-18 and its function has been carried out tentative prediction.

(3) Read L R, Cumberbatch J A, Buhr M M, et al.Cloning and characterization of chicken stromal cell derived factor-1.Developmental﹠amp; Comparative Immunology, 2005,29 (2): disclose the SDF-1 gene of recombination chicken in 142-152, used prokaryotic expression system Restruction albumen and used the measuring of calcium flux its activity.

(4) Tan Y, Du J, Cai S X, et al.Cloning and characterizing mutated human stromal cell-derived factor-1 (SDF-1): C-terminal α-helix of SDF-1 α plays a critical role in CXCR4activation and signaling, but not in CXCR4binding affinity.Experimental Hematology, 2006, 34 (11): disclosing in 1553-1562 C is held the people SDF-1 gene of α disappearance is hSDF-154, be cloned into prokaryotic expression carrier pET-30a (+), recombinant plasmid is imported e. coli bl21 (DE3), separation and purification goes out target protein and its activity is studied.

Summary of the invention

The technical problem that the present invention solves is the cDNA sequence according to hSDF-1 α, and design and structure hSDF-1 alpha expression carrier are to realize the expression of hSDF-1 α.For this reason:

One of purpose of the present invention is to provide the expression vector of a kind of people source stromal cell derived factor 1α, and this expression vector is that people source stromal cell derived factor 1α gene is inserted into the recombinant plasmid pET15b-hSDF-1 α that consists of in plasmid pET15b.

Another object of the present invention is to provide the construction process of the expression vector of above-mentioned people source stromal cell derived factor 1α, this construction process comprises:

(1) design of primers:

The hSDF-1 α cDNA primers that biotechnology state-run according to U.S. information center provides removes signal peptide and only clones mature peptide sequence 213bp, and insert the Nco I at two ends, BamH I restriction enzyme site and protection base, design synthetic primer sequence is:

Used during pcr amplification

Upstream primer is: 5 ˊ GATG CCATGGACGGGAAGCCCGTCAGC3 ˊ;

Downstream primer is: 5 ˊ CGC GGATCCTTACTTGTTTAAAGCTTTCTCCAGGT3 ˊ; (2) pcr amplification of hSDF-1 α gene:

The template of PCR is the recombinant plasmid pCMV-SPORT6-SDF1 α with hSDF-1 α cDNA fragment, and template concentrations is 0.2324ng/ μ L;

The concentration of upstream primer, downstream primer is 10 μ mol/L;

Contain in the reaction system of the PCR of 50 μ L: 25 μ L Premix, 1 μ L template plasmid, 1 μ L upstream primer, 1 μ L downstream primer, all the other are sterilized water;

The response procedures of PCR: 98 ℃ of denaturation 5min; 98 ℃ of sex change 30s, 60 ℃ of annealing 30s, 72 ℃ are extended 30s, 30 circulations; 72 ℃ are extended 10min;

Glue reclaims the PCR product;

(3) double digestion PCR product:

The PCR product enzyme of 40 μ L cut contain 1 μ L Nco I, 1 μ L BamH I, 4 μ L10 * KBuffer, 4 μ L0.1%BSA, 30 μ L PCR products in system, all the other are sterilized water;

37 ℃ of enzymes are cut processing;

Glue reclaims the PCR product of double digestion;

(4) double digestion plasmid pET15b:

The plasmid pET15b enzyme of 20 μ L is cut in system and contained: 1 μ L Nco I, 1 μ L BamH I, 2 μ L10 * K Buffer, 2 μ L0.1%BSA, 10 μ L pET15b plasmids, all the other are sterilized water;

37 ℃ of enzymes are cut processing;

Glue reclaims the plasmid pET15b product of double digestion;

(5) being connected of purpose fragment and vector plasmid pET15b:

Double digestion PCR product and double digestion plasmid pET15b product carry out ligation: contain 1 μ L10 * T in 10 μ L reaction systems ₄The plasmid pET15b of the PCR product of DNA Ligase Buffer, 6 μ L double digestions, 2 μ L double digestions, 0.5 μ L T ₄DNA Ligase, all the other are sterilized water;

16 ℃ were reacted 12-24 hour, and got pET-15b-hSDF-1 α.

HSDF-1 α cDNA open reading frame is 270bp, 89 amino acid of encoding, and 19 amino acid of N end are signal peptide sequence, only clone mature peptide sequence 213bp, 70 amino acid of encoding when the design primer.This paper goes out hSDF-1 α gene according to the hSDF-1 α cDNA primers of delivering in NCBI by pcr amplification, it is cloned into pET15b builds nonfusion expression vector pET15b-hSDF-1 α and recombination bacillus coli DH5 α/pET15b-h SDF-1 α.

Another purpose of the present invention is to utilize above-mentioned recombinant vectors pET-15b-hSDF-1 α to carry out the abduction delivering of hSDF-1 α.Specifically the expression vector of described people source stromal cell derived factor 1α is imported in e. coli bl21 (DE3) competent cell people source stromal cell derived factor 1α is carried out abduction delivering.

Above-mentioned abduction delivering process comprises:

(1) utilize the expression vector of described people source stromal cell derived factor 1α and e. coli bl21 (DE3) to build recombinant bacterium BL21 (DE3)/pET15b-hSDF-1 α;

(2) recombinant bacterium is carried out BL21 (DE3)/pET15b-hSDF-1 α and induce processing, to hSDF-1 α abduction delivering.

In above-mentioned steps (two), recombinant bacterium BL21 (DE3)/pET15b-hSDF-1 а is inoculated in the LB liquid nutrient medium that contains Amp 37 ℃ of shaking culture; Next day, by volume 1% inoculum size inoculation bacterium liquid to the LB liquid nutrient medium that contains Amp, 37 ℃ of shaking culture to OD600 be 0.4-0.6, add inductor IPTG, the ultimate density that makes IPTG is 1.0mmol/L, after inducing processing under 30 ℃ of conditions, and centrifugal collection thalline.

The present invention is with recombinant vectors pET15b-hSDF-1 α transformation receptor bacterium E.Coli BL21 (DE3), built engineering bacteria E.Coli BL21 (DE3)/pET15b-hSDF-1 α, bacterial strain is through the IPTG abduction delivering, SDS-PAGE analyzes, can obviously observe the target protein band about the 10kD place greatly, realize the expression to target protein.

HSDF-1 α of the present invention exists with the inclusion body form in e. coli bl21 (DE3).

Above-mentioned abduction delivering process further comprises following steps:

Under condition of ice bath, recombinant bacterium BL21 (DE3) after processing/pET15b-hSDF-1 α, centrifugal collection afterwards induced in ultrasonication Throw out, ultrasonication lysate used during ultrasonication is comprised of 10mmol/L Tris-HCL, 5mmol/L EDTA, and pH is 8.0, and every gram recombinant bacterium BL21 (DE3)/pET15b-hSDF-1 α uses 10mL ultrasonication lysate;

Throw outFirst use washings A resuspended, afterwards collecting precipitation; Then use the resuspended throw out of washings B, collecting precipitation is again Inclusion bodyWherein washings A is that 1% Triton-X100,10mmol/L Tris-HCL, 5mmol/L EDTA form by volume ratio, and pH is 8.0; Washings B is by 0.5mol/L Guanidinium hydrochloride, 10mmol/L Tris-HCL, and 5mmol/L EDTA forms, and pH is 8.0;

Utilize sex change liquid resuspended Inclusion body, 20-30 ℃ of standing 40-60min, centrifugal collection afterwards Supernatant liquorWherein said sex change liquid is to be that 6mol/L Guanidinium hydrochloride, volume ratio are 7/10 by concentration ⁵Beta-mercaptoethanol, 10mmol/L Tris-HCL, 5mmol/L EDTA form, and pH is 8.0; Every gram Inclusion bodyUse 5mL sex change liquid;

Supernatant liquorIn add renaturation solution to get the renaturation sample, described renaturation solution is comprised of 1mmol/L reduced glutathion, 0.2mmol/L Sleep-promoting factor B, 10mmol/L Tris-HCL, 5mmol/L EDTA, and pH is 8.0; Every volume Supernatant liquor Use 20 volume renaturation solutions; Renaturation solution adds in the dropping mode Supernatant LiquidIn, and dripped at 12-48 hour;

Collect the renaturation sample is centrifugal Supernatant samples, with cationic exchange coloum SP Sepharose F.F.1mL prepacked column pair Supernatant samplesCarrying out purifying obtains Target proteinDuring separation and purification, the component of balance liquid A liquid used has 20mmol/L Tris-HCL, 0.3～0.4mol/L NaCl, and pH is 8.5, and with 0.45 μ m water-based membrane filtration; Elutriant B liquid: add 1mol/L NaCl in balance liquid A liquid, and with 0.45 μ m water-based membrane filtration; Elution requirement: gradient 0% elutriant B liquid～100% elutriant B liquid, elution volume 20mL, elution flow rate 1.0mL/min, ultraviolet detection wavelength 280nm.

Utilize Sepherdex G-25 post pair Target proteinCarry out desalination, collect isolate corresponding to 280nm chromatographic peak; During desalination, damping fluid used is: 10mmol/L PB, pH7.0.

The present invention carries out ultrasonication to the bacterial strain after inducing, and the centrifugal rear cleer and peaceful precipitation of getting is respectively analyzed through Tris-tricine-SDS-PAG, and target protein mainly is present in somatic cells with the form of inclusion body.To inclusion body wash, sex change and dilution refolding process the supernatant that obtains through strong cat ion exchange column SP Sepharose F.F. initial gross separation purifying, obtains target recombinant albumen hSDF-1 α.The protein solution of high salt is carried out desalination and vacuum lyophilization through gel permeation chromatography, loosened, white byssaceous target protein hSDF-1 α.

Description of drawings

Fig. 1 is the electrophoretic analysis figure as a result of PCR product in embodiment 1, and wherein, the M swimming lane represents that DL2000,1-4 swimming lane represent the PCR product;

Fig. 2 is detected through gel electrophoresis that in embodiment 1, glue reclaims PCR product figure as a result, and wherein, the M swimming lane represents that DL2000,1 swimming lane represent the hSDF-1 α gene that glue reclaims;

Fig. 3 is the electrophoresis detection figure as a result of PCR product double digestion in embodiment 1, and wherein, the M swimming lane represents that DL2000,1-3 swimming lane represent that enzyme cuts the PCR product;

Fig. 4 is the electrophoresis detection figure as a result of plasmid pET15b double digestion in embodiment 1, and wherein, the M swimming lane represents that Middle Marker, 1-3 swimming lane represent that double digestion PET15b, 4 swimming lanes represent that enzyme is not cut PET15b

Fig. 5 is the double digestion qualification result figure of recombinant plasmid pET15b-SDF1 α in embodiment 1, and wherein, the M swimming lane represents that Middle Marker, 1-4 swimming lane represent the pET-15b-SDF1 α of double digestion;

Fig. 6 is the order-checking qualification result figure of recombinant plasmid pET15b-SDF1 α in embodiment 1;

Fig. 7 is the electrophoresis detection figure as a result of the abduction delivering of embodiment 2 recombinant bacterium E.Coli BL21 (DE3)/pET15b-SDF1 α, and in this figure, the 1-2 swimming lane is not for inducing thalline; The 3-4 swimming lane is the thalline after IPTG induces, and the M swimming lane is that albumen Marker(is followed successively by 100,30,25,20,15,10 from top to bottom, 5and3.4kD);

Fig. 8 induces and is the soluble analysis electrophoresis detection of embodiment 2 expression product hSDF-1 α figure as a result, and the 1-2 swimming lane is broken precipitation, and the 3-4 swimming lane is broken supernatant, and the M swimming lane is that albumen Marker(is followed successively by 100 from top to bottom, 30,25,20,15,10,5and3.4kD);

Fig. 9 is the separating spectrums of embodiment 2 renaturation samples on SP Sepharose F.F chromatographic column;

Figure 10 be embodiment 3 through the SDS-PAGE analytical results figure of SP Sepharose F.F. chromatography gained protein ingredient, the 1-2 swimming lane is Liu Chuan peak I in Figure 10; 3,4,5 and 6 swimming lanes are chromatographic peak II in Figure 10; The M swimming lane is that albumen Marker(is followed successively by 100,30,25,20,15,10 from top to bottom, 5and3.4kD);

Figure 11 is that embodiment 3 is the desalination chromatographic peak through the SDS-PAGE of Sepherdex G-25 chromatography gained protein ingredient analysis 1-2 swimming lane; The M swimming lane is that albumen Marker(is followed successively by 100,30,25,20,15,10 from top to bottom, 5and3.4kD);

Figure 12 is the THP-1 cytological map;

Figure 13 is the chemotactic activity figure of the external short THP-1 cell of restructuring hSDF-1 α, and wherein (a) is 0ng/mL hSDF-1 α group; (b) be 10ng/mL hSDF-1 α group; (c) be 100ng/mL hSDF-1 α group; (d) be 500ng/mL hSDF-1 α group;

Figure 14 is the multiple clone site figure of pET-15b.

Embodiment

With reference to Figure 14, the present invention selects plasmid pET15b to build the not non-fusion recombinant expression vector of tape label, upstream primer can select the Nco I as restriction enzyme site, downstream primer can select Nde I, Xho I or BamH I as restriction enzyme site, under the same conditions the recombinant bacterium with plasmid recombinant is expressed, found that when selecting Nco I and two restriction enzyme sites of BamH I, the target protein expression amount is higher.Therefore, determine that finally Nco I, BamH I are the optimal double restriction enzyme site.

Below in conjunction with specific embodiment, the present invention is further explained explanation.

Embodiment 1:

This embodiment material therefor:

With the recombinant plasmid pCMV-SPORT6-SDF-1 α of hSDF-1 α cDNA fragment available from Gene Copoeia company; PET15b prokaryotic expression carrier, bacillus coli DH 5 alpha are available from the prosperous biotech firm of Beijing ancient cooking vessel state.

This embodiment used medium and reagent preparation:

The LB solid medium: peptone 1.0g, sodium-chlor 1.0g, agar 1.5g, yeast extract 0.5g are dissolved in 100mL distilled water, 121 ℃ of high pressure steam sterilization 20min.

LB liquid nutrient medium: take peptone 1.0g, sodium-chlor 1.0g, yeast extract 0.5g, be dissolved in 100mL distilled water, 121 ℃ of high pressure steam sterilization 20min.

100mg/mL Amp:1.0g Amp is dissolved in 8mL distilled water, is settled to 10mL, with the super worry of 0.22 μ m filter degerming, stores in 4 ℃ of refrigerators standby after packing.

50 * TAE electrophoretic buffer (2mol/L Tris-HAC, 100mmol/L EDTA, pH8.0): Tris alkali 121.15g, EDTANa ₂2H ₂O18.6g adds approximately 300mL distilled water in beaker in beaker, stir, and adds the glacial acetic acid of 57.1mL, and fully dissolving after adding distil water is settled to 1L, is transferred pH to 8.0, room temperature preservation.

The structure of this embodiment expression vector pET15b-hSDF-1 α specifically comprises following operation steps:

(1) hSDF-1 α cDNA sequence pcr primer thing design

Biotechnology information center NCBI(NM_199168 state-run according to the U.S.) the hSDF-1 α cDNA primers that provides; remove signal peptide and only clone mature peptide sequence 213bp; and insert the Nco I at two ends, and BamH I restriction enzyme site and protection base, design synthetic primer sequence is:

Upstream primer: 5 ˊ GATG CCATGG(underscore is Nco I restriction enzyme site to ACGGGAAGCCCGTCAGC3 ˊ, 27bp)

Downstream primer: 5 ˊ CGC GGATCC(underscore is BamH I restriction enzyme site to TTACTTGTTTAAAGCTTTCTCCAGGT3 ˊ, 35bp)

(2) pcr amplification of hSDF-1 α gene

The template of pcr amplification is the recombinant plasmid pCMV-SPORT6-SDF1 α with hSDF-1 α cDNA fragment, and template concentrations is 0.2324ng/ μ L;

Upstream primer, downstream primer concentration are 10 μ mol/L;

PCR reaction system 50 μ L:25 μ L Premix, 1 μ L template plasmid, 1 μ L upstream primer, 1 μ L downstream primer, sterilized water complement to 50 μ L;

Then the reaction solution of PCR is placed on the PCR instrument and reacts in preparation on ice.

PCR response procedures: 98 ℃ of denaturation 5min; 98 ℃ of sex change 30s, 60 ℃ of annealing 30s, 72 ℃ are extended 30s, 30 circulations; 72 ℃ are extended 10min;

Pcr amplification product identifies through 1.5% agarose gel electrophoresis, and result shows to amplify the purpose band as shown in Figure 1, and big or small approximately 230bp conforms to theory.

(3) glue of PCR product reclaims

Reclaim the PCR product with Gel Extraction Kit, at first the PCR product is run agarose gel electrophoresis, gum concentration 1.5%, power supply 80V constant voltage electrophoresis.

Run position stop electrophoresis to 1/2nd at index strip, observe electrophoretic band under gel imaging instrument ultraviolet lamp and take pictures.

Downcut with blade the gel that contains the purpose fragment and put into centrifuge tube under ultraviolet lamp, the Binding Buffer that adds 1ml according to every gram gel calculates, and adds wherein the Binding Buffer of corresponding amount, and 60 ℃ of heating in water bath 7min melt gel fully;

Mixed solution is added in the separator column that balance is good, and the capacity of separator column is 700 μ l, and the centrifugal 1min of 10000g outwells the liquid in collection tube; Add 700uL SPW Wash Buffer(to add the 100mL dehydrated alcohol in separator column), the centrifugal 1min of 10000g abandons lower liquid, and this washing process is repeated; The 13000g sky is thoroughly removed remaining ethanol in separator column from 2min;

Separator column is put on the 1.5mL centrifuge tube, added 40 μ L Elution Buffer, room temperature is placed the 2min eluted dna, the centrifugal 1min of 13000g, and the solution that centrifuge tube is collected is the PCR product of purifying.

Downcut the gel that contains the purpose fragment under ultraviolet lamp, glue recovery sample two pipes, 40 μ L/ pipes, getting 5 μ L detects with 1.5% agarose gel electrophoresis, result only has an objective band at the 230bp place as shown in Figure 2, and its molecular weight is consistent with the theoretical molecular of goal gene, and then illustrated and amplify goal gene, the PCR production concentration that utilizes simultaneously micro-ultraviolet spectrophotometer to record after purifying is 35.4ng/ μ L.

(4) contain the preparation of the pET15b plasmid of anti-Amp gene

The single bacterium colony access of the DH5 α 5mL that chooses plasmid pET15b contains in the LB substratum of Amp, 37 ℃, 220r/min shaking culture 12h; Draw 3mL bacterium liquid in centrifuge tube, the centrifugal 5min of 6000g abandons nutrient solution and collects thalline.

The equilibrium separation post: get 750 μ L GPS damping fluids and add in separator column, standing 4min, the centrifugal 2min of 12000g discards liquid and is the good separator column of balance.

Add 250 μ L solution I (having added RNase A) in thalline, pressure-vaccum disperses it fully, and the glucose sugar composition that the solution I contains can be kept the osmotic pressure of cell, cell is well suspended, not sedimentation immediately; Then add 250 μ L solution II, standing 2min after mixing makes the abundant cracking of cell to obtain the cell pyrolysis liquid of clarification; Add 350 μ L solution III, rock centrifuge tube the solution III is uniformly dispersed, until produce white precipitate; The centrifugal 10min of 12000g draws supernatant to the good separator column of balance, and the centrifugal 1min of 10000g abandons lower liquid; Add 500 μ L Buffer HB, the centrifugal 1min of 10000g abandons lower liquid; Add 500 μ L DNA Wash Buffer, the centrifugal 1min of 10000g abandons lower liquid, repeats this step; The centrifugal 2min of void column 13600g;

Add 40 μ L Elution Buffer after changing centrifuge tube, place 2min, DNA can be dissolved in Buffer fully, the centrifugal 2min of 13600g collects centrifugate.

(5) double digestion PCR product

PCR product enzyme is cut system 40 μ L:Nco I 1 μ L, BamH I 1 μ L, 10 * K Buffer4 μ L, 0.1%BSA4 μ L, PCR product 30 μ L, sterilized water complements to 40 μ L; Add in 0.2mL PCR pipe, cut 5h in 37 ℃ of (the PCR instrument is hatched) enzymes after mixing.PCR product and the vector plasmid pET15b rear glue recovery of leakage of electricity swimming respectively with double digestion.

PCR product double digestion detects by 1.5% agarose gel electrophoresis, and as shown in Figure 3,2,3 swimming lane bands are very bright, illustrates that the PCR production concentration of double digestion is larger.

(6) double digestion vector plasmid pET15b

Vector plasmid pET15b enzyme is cut system 20 μ L:Nco I 1 μ L, BamH I 1 μ L, 10 * K Buffer2 μ L, 0.1%BSA2 μ L, pET15b plasmid 10 μ L, sterilized water complements to 20 μ L; Add in 0.2mL PCR pipe, cut 5h in 37 ℃ of (the PCR instrument is hatched) enzymes after mixing.PCR product and the vector plasmid pET15b rear glue recovery of leakage of electricity swimming respectively with double digestion.

PET15b plasmid double digestion identifies by 1% agarose gel electrophoresis, and as shown in Figure 4, the pET15b plasmid enzyme restriction is more complete.

The ultraviolet detection result that after table 2PCR product and plasmid pET15b double digestion, glue reclaims

(7) purpose fragment and vector plasmid pET15b's is connected

The enzyme that reclaims is cut the PCR product and vector plasmid pET15b carries out ligation, reaction system 10 μ L:10 * T ₄DNA Ligase Buffer1 μ L, PCR product 6 μ L, plasmid pET15b2 μ L, T ₄DNA Ligase0.5 μ L, sterilized water complement to 10 μ L; Add in 0.2mL PCR pipe, connect in 16 ℃ (the PCR instrument is hatched) after mixing and spend the night, get pET-15b-hSDF-1 α.

The connection product pET-15b-SDF1 α of embodiment 1 is transformed in the bacillus coli DH 5 alpha competent cell, the mono-clonal upgrading grain double digestion on flat board is identified, and to the positive colony of the identifying evaluation of checking order.Detailed process is as follows:

(1) preparation of DH5 α competent cell

Inoculation bacillus coli DH 5 alpha list bacterium colony does not contain to 5mL in the LB liquid nutrient medium of AMP, and 37 ℃, 220rpm shaking culture spend the night;

Next day, getting 100 μ L(1% inoculum sizes) the nutrient solution 10mL that transfers do not contain in the LB liquid nutrient medium of AMP, 37 ℃, 220rpm shaking culture 2～3h (OD ₆₀₀=0.4～0.6), stop cultivating;

Under aseptic condition, bacterium liquid is divided to install in advance in the aseptic 1.5m centrifuge tube of placing on ice, place 10min on ice;

Then 4 ℃, the centrifugal 5min of 6000rpm pour out nutrient solution, and cell precipitation is iced the 0.1mol/L CaCl of precoolings with 200 μ L ₂Solution is resuspended, is placed on 0 ℃ of insulation 30min on ice, obtains competent cell DH5 α suspension;

(2) the pET-15b-SDF1 α that embodiment 1 is built transforms competent escherichia coli cell DH5 α

Add 10 μ L to connect product pET-15b-SDF1 α (positive control pET-15b10 μ L, negative control does not add plasmid) in the competent cell DH5 α suspension of 200 μ L under aseptic condition, mixing, be statically placed in 30min on ice gently;

Centrifuge tube is put into the water-bath thermal shock 90s of 42 ℃, centrifuge tube is transferred on ice, allow its cooling 3min; The LB liquid nutrient medium that adds 790 μ L antibiotic-frees, 180r/min, 37 ℃ of shaking culture 60min, the antibiotics resistance marker gene that thalline recovery and expression plasmid are encoded;

Then get 200 μ L bacterium liquid and be uniformly applied on the LB flat board that contains microbiotic Amp, do simultaneously following contrast:

Contrast 1: be with pET15b Plasmid Transformation competent cell, be coated on resistance LB flat board, at 37 ℃ of incubator incubated overnight 16～24h.

The contrast 2: be to get 100 μ L competent cells, with its be coated on resistance LB flat board, 37 ℃ of incubator incubated overnight 16～24h.

The contrast 3: with 100 μ L competent cells be coated on the flat board that there is no resistance, 37 ℃ of incubator incubated overnight 16～24h.

20 several mono-clonals (connecting the flat board that product transforms) have been grown in containing the resistance plate of Amp; Contrast 1 has grown a hundreds of mono-clonal, does not grow mono-clonal on contrast 2 flat boards, and contrast 3 has bacterium colony to overgrow with whole flat board close and numerously.

(3) import the cultivation of the competent escherichia coli cell DH5 α that pET-15b-SDF1 α is arranged

Choose mono-clonal on successful flat board and be inoculated in the LB liquid nutrient medium that contains Amp, 37 ℃, 220rpm shaking culture 12h transforming.

(4) extraction of recombinant plasmid

Extract plasmid from previous step gained bacterium liquid, the extracting method in extracting method and embodiment 1 in " containing the preparation of the pET15b plasmid of anti-Amp gene " is identical.

(5) double digestion of this embodiment 1 recombinant plasmid is identified

Enzyme is cut system 40 μ L:Nco I 1 μ L, BamH I 1 μ L, 10 * K Buffer4 μ L, 0.1%BSA4 μ L, the recombinant plasmid 20 μ L of extraction, sterilized water complements to 40 μ L;

The several mono-clonals of picking in the flat board that connects the product conversion extract plasmid, and double digestion is identified, result such as Fig. 5 can see that 2,3,4 swimming lanes have band about 230bp, and preliminary illustration purpose gene is insertion vector pET-15b.

(6) 1 recombinant plasmid order-checking is identified to embodiment

Enzyme is cut identified that positive mono-clonal sends to the order-checking of Shanghai bio-engineering corporation, adopt the T7promoter universal primer as the unidirectional order-checking of initial primers.

Sequencing adopts T7promoter as initial primers, sequencing result such as Fig. 6, and base pair and goal gene that the sequence alignment result is presented between the 61-276 of order-checking plasmid match fully, and the recombinant vectors sequence of structure, reading frame are correct.

HSDF-1 α cDNA sequence:

ATGGACGGGAAGCCCGTCAGCCTGAGCTACAGATGCCCATGCCGATTCTTCGAAAGCCATGTTGCCAGAGCCAACGTCAAGCATCTCAAAATTCTCAACACTCCAAACTGTGCCCTTCAGATTGTAGCCCGGCTGAAGAACAACAACAGACAAGTGTGCATTGACCCGAAGCTAAAGTGGATTCAGGAGTACCTGGAGAAAGCTTTAAACAAGTAA

The corresponding protein amino acid sequence of hSDF-1 α gene:

Met?Asp?Gly?Lys?Pro?Val?Ser?Leu?Ser?Tyr?Arg?Cys?Pro?Cys?Arg?Phe?Phe?Glu

Ser?His?Val?Ala?Arg?Ala?Asn?Val?Lys?His?Leu?Lys?Ile?Leu?Asn?Thr?Pro?Asn

Cys?Ala?Leu?Gln?Ile?Val?Ala?Arg?Leu?Lys?Asn?Asn?Asn?Arg?Gln?Val?Cys?Ile

Asp?Pro?Lys?Leu?Lys?Trp?Ile?Gln?Glu?Tyr?Leu?Glu?Lys?Ala?Leu?Asn?Lys

Embodiment 2:

The recombinant plasmid pET15b-hSDF-1 α that utilizes embodiment 1 to prepare in this embodiment carries out the abduction delivering of hSDF-1 α, simultaneously the expression product of this embodiment gained is carried out the correlation test analysis.

This embodiment material therefor:

E. coli bl21 (DE3) competent cell; Fast flow velocity SP sepharose Sulphopropyl Sepharose Fast Flow(SP Sepharose F.F.; 0.7 * 2.5cm i.d.) prepacked column and dextran G-25 gel exclusion post Sephadex G-25(Sephadex G-25; 5 * 150mm i.d.) available from GE company.

This embodiment used medium and main agents preparation:

(1) preparation of 100mg/mL Amp: 1000mg Amp is dissolved in 8mL water, is settled to 10mL, the super worry of 0.22 μ m filter degerming, packing is stored in 4 ℃ of refrigerators standby.

(2) preparation of 400mmol/L IPTG: take 0.952g IPTG and be dissolved in the 8mL deionized water, be settled to 10mL, the super worry of 0.22 μ m filter degerming, packing is stored in 4 ℃ of refrigerators standby.

(3) Amp+(contains Amp's) the LB liquid nutrient medium: yeast extract 0.5g, an albumen 1g, NaCl1g is dissolved in the 100mL deionized water.Prepare rear gauze newspaper sealing, 121 ℃ of high pressure steam sterilization 20min.The 100mg/mL Amp that adds after cooling 100 μ L to prepare, the final concentration that makes Amp is 100ug/mL.Be placed in Cool Room 4℃ standby.

(4) 10mmol/L PB pH7.0 preparation: measure 61.0mL0.2mol/L Na ₂HPO ₄, 39.2mL0.2mol/L Na ₂HPO ₄Be placed in beaker, add water and be settled to 2000mL.When crossing gel-filtration column with 0.45 μ m water film filtering.

The main operational steps of this embodiment is as follows:

(1) cultivation of bacterial classification and abduction delivering

CaCl ₂Conversion method builds engineering bacteria BL21 (DE3)/pET15b-hSDF-1 α with recombinant plasmid transformed 200 μ L BL21 (DE3) competent cells of 10 μ L;

The picking mono-clonal is inoculated in the LB liquid nutrient medium that 5mL contains Amp on the flat board that transforms, and 37 ℃, 220rpm shaking culture 12h; Next day, to the fresh LB substratum that contains Amp of 100mL, 37 ℃, it is 0.4-0.6 that 220rpm is cultured to OD600 by the bacterium liquid of 1% inoculum size inoculation 1mL, and adding final concentration is the IPTG of 1.0mmol/L, and 30 ℃, 220rpm induces 5h, centrifugal collection thalline.

These embodiment 2 gained expression products are carried out SDS-PAGE to be analyzed

Get respectively 1mL and do not induce and the bacterium liquid of inducing, the centrifugal 5min of 6000g, collecting precipitation carry out respectively SDS-PAGE and analyze.Recombinant vectors pET-15b-hSDF-1 α transforms e. coli bl21 (DE3), bacterial classification after abduction delivering is analyzed through SDS-PAGE, as shown in Figure 7, induces with the thalline of not inducing and compares, can observe significantly the purpose band at 10kD place, its molecular size range is consistent with theoretical molecular.

Expression-form to these embodiment 2 gained recombinant proteins is identified

Recombinant E. coli Fermentation Broth is in 4 ℃, the centrifugal 15min of 4500r/min, collects bacterial sediment and weighs, and adds ultrasonication lysate (pH8.0 according to the ratio of 1g:10mL, 10mmol/L Tris-HCL, 5mmol/L EDTA), mixing, ultrasonication (400W under condition of ice bath, super 10S stops 10S, 60 times * 2) limpid to bacterium liquid, with suspension in 4 ℃, the centrifugal 30min of 10000r/min, collect respectively upper cleer and peaceful precipitation, the expression-form of SDS-PAGE Analysis deterrmination target protein.

The soluble analysis of recombinant protein as shown in Figure 8, in the precipitation after recombinant expressed cellular lysate, there is obvious purpose band at the 10kD place, illustrate hSDF-1 α at e. coli bl21 (DE3) mainly with the soluble formal representation of inclusion body.

Embodiment 3:

In this embodiment, the fermented liquid of embodiment 2 gained is handled as follows:

(1) preparation of inclusion body and washing

0.85L the escherichia coli fermented broth of inducing culture, 4 ℃, the centrifugal 15min of 4500r/min, discard nutrient solution and bacterial sediment is weighed, ratio according to 1g:10mL adds ultrasonication lysate (10mmol/L Tris-HCL, 5mmol/L EDTA, pH8.0), fully stirring and evenly mixing avoids block thalline to produce.

Ultrasonication under condition of ice bath (400W, super 10S stops 10S, 60 times * 2) is limpid to bacterium liquid, ultrasonic grind at 4 ℃, the centrifugal 30min of 10000r/min, collecting precipitation.

Precipitation is first used washings A(volume ratio 1%Triton-X100,10mmol/L Tris-HCL, 5mmol/L EDTA, pH8.0) resuspended, pressure-vaccum washing, 4 ℃, the centrifugal 30min of 10000r/min, collecting precipitation; Use again washings B(0.5mol/L Guanidinium hydrochloride, 10mmol/L Tris-HCL, 5mmol/L EDTA, pH8.0) resuspended, the pressure-vaccum washing, 4 ℃, the centrifugal 30min of 10000r/min, collecting precipitation is the inclusion body after washing.

(2) denature and renature of inclusion body

Inclusion body after washing adds sex change liquid (to contain 6mol/L Guanidinium hydrochloride, volume ratio 7/10 according to the ratio of 1g:5mL ⁵Beta-mercaptoethanol, 10mmol/L Tris-HCL, 5mmol/L EDTA, pH8.0), resuspended mixing, standing 40-60min under room temperature, 4 ℃, the centrifugal 30min of 10000r/min collects supernatant liquor,

Adopt the method for dilution refolding, in supernatant liquor in 1:20(V/V) ratio add renaturation solution (contain 1mmol/L reduced glutathion, 0.2mmol/Lization type gsh, 10mmol/L Tris-HCL, 5mmol/L EDTA, pH8.0), renaturation solution slowly is added dropwise to supernatant with the system of similar transfusion bottle, and slowly stir renaturation spend the night (48h drips) with magnetic stirring apparatus.

(3) purifying of restructuring hSDF-1 α

With the centrifugal collection supernatant samples of renaturation sample, with strong cat ion exchange column SP Sepharose F.F.1mL prepacked column, supernatant samples is carried out purifying.

Balance liquid A liquid: component has 20mmol/L Tris-HCL, 0.3～0.4mol/L NaCl, pH8.5,0.45 μ m water-based membrane filtration solution after configuring.

Elutriant B liquid: add 1mol/L NaCl in balance liquid A liquid, 0.45 μ m water-based membrane filtration solution after configuring.

Elution requirement: gradient 0%B～100%B, elution volume 20mL, elution flow rate 1.0mL/min, ultraviolet detection wavelength 280nm.

When using ion exchange column, guarantee that balance liquid A liquid electricity is led higher than the sample electricity to lead 5～10mS.

Gradient elution separates, and at first flow velocity 1mL/min uses the A liquid equilibrium separation post of 5～10 column volumes, until that 280nm uv-absorbing baseline and electricity are led is stable; The pH of sample is transferred to 8.5, be loaded on separator column, before loading, ultraviolet 280nm baseline is made zero; With the A liquid equilibrium separation post of 5～10 column volumes, until that Liu Chuan peak I ultraviolet baseline and electricity are led is stable, namely all not binding substance all be rinsed out separator column; Gradient with 10～20 column volumes is carried out wash-out, and the setting flow velocity is 1.0mL/min, 0%～100%B20min.Ultraviolet detection wavelength 280nm.Collect the chromatographic peak II; 100%B liquid with 5 column volumes rinses separator column with any residual ionic binding substance of wash-out; With the A liquid reequilibrate separator column of 5～10 column volumes, until baseline and electricity are led the arrival desirable value.SDS-PAGE analysis stream river peak I and chromatographic peak II.Collect sample corresponding to chromatographic peak II by above-mentioned ion exchange column.

As Fig. 9, in the elution process of 0%B～100%B, a peak II only appears, analyze as Figure 10 through SDS-PAGE, stream wear the peak I at 10kD place without band, the chromatographic peak II has one to be with than the bright wisp band and without mixing, due to larger through the collected protein solution salt concn of ion exchange chromatography, so traction is arranged.Result shows through SP Sepharose F.F. post initial gross separation purifying, can obtain target protein.

(3) desalination of recombinant protein and freeze-drying

The target protein solution that separation is obtained carries out desalination with Sepherdex G-25 post.

Damping fluid: pH7.010mmol/L PB.

With damping fluid balance chromatography column, until that ultraviolet 280nm baseline and electricity are led is stable; Loading (sample that the chromatographic peak II is corresponding), the loading volume can not surpass 30% of column volume; Use again the buffer solution elution sample, collect the 280nm chromatographic peak, rinse the pillar electricity with damping fluid always and lead stable.SDS-PAGE analyzes chromatographic peak, as Figure 11, target stripe is arranged at the 10kD place and without assorted band, the purity of protein of separation is higher.100mg restructuring hSDF-1 α will can be obtained after the 100mL protein solution vacuum lyophilization of collecting after desalination.

Recombinant protein solution after desalination is spent the night in-40 ℃ of refrigerator overnight are frozen in the 10cm culture dish, and inferior daily vacuum freeze drier freeze-drying is stored in loft drier with the powder of freeze-drying.

Adopt Transwell cell migration experiment that embodiment 3 gained protein actives are identified:

The test material:

Human THP-1 monocyte (available from ATCC), modified form RPMI-1640 substratum is available from HyClone company; Foetal calf serum is available from Hangzhou folium ilicis chinensis company; 8 μ m polycarbonate membrane Transwell cells are available from Corning company; Penicillin-Streptomycin sulphate is two anti-available from the prosperous biotech firm of Beijing ancient cooking vessel state.

Test is prepared with substratum and reagent:

(1) cell culture fluid: get basic medium 164044.5mL and be placed in the 100mL reagent bottle, foetal calf serum 5mL, two anti-500 μ L, it is standby that mixing is placed on 4 ℃ of refrigerators.

(2) frozen storing liquid: 10%DMSO+90% foetal calf serum, mixing are placed on 4 ℃ of Refrigerator stores.

Test method:

The determination of activity of restructuring hSDF-1 α detects restructuring hSDF-1 α chemotactic monocyte THP-1 with the Transwell migration experiment in 8 μ m apertures and moves.THP-1 cell (cultivated 3～5 generations) first with the hungry 12h of the serum free medium RPMI-1640 that contains 0.2%BSA, is received cell, and resuspended to decide cell concn be 3 * 10 with the RPMI-1640 that contains 0.5% foetal calf serum ⁵/ mL.

The hSDF-1 α powder of freeze-drying after embodiment 2 desalinations is made into 10ng/mL, 100ng/mL, three kinds of concentration of 500ng/mL, contain the RPMI-1640 of 0.5% foetal calf serum in contrast, every kind of concentration is got respectively 600 μ L and is added 24 orifice plates, in triplicate, the insert cell is put into 24 orifice plates, and every hole adds the cell suspension of 200 μ L.Put into CO ₂Hatch 10h in incubator, take out cell, celliferous number in each hole solution of 200 * microscopically counting, 24 orifice plates.

Test-results shows:

In 3～5 generations of cultivation THP-1 cell cultures of THP cell, under low power lens (10 * 10), cell is bright, is single spherical, big or small homogeneous, and as Figure 12, cell state is good.

Adopt the transwell cell migration to test to measure restructuring hSDF-1 α to the chemotactic activity of THP-1 cell.With the RPMI-1640 that contains 0.5% foetal calf serum that do not add hSDF-1 α in contrast, the cell count that moves to lower chamber when adding hSDF-1 α concentration to be respectively 10ng/mL, 100ng/mL, 500ng/mL illustrates that significantly more than control group the restructuring hSDF-1 α after purifying has chemotactic activity to the THP-1 cell.Result as shown in figure 13.

Claims (7)

1. the expression vector of a people source stromal cell derived factor 1α, is characterized in that, this expression vector is that people source stromal cell derived factor 1α gene is inserted into the recombinant plasmid pET15b-hSDF-1 α that consists of in plasmid pET15b.

2. the construction process of the expression vector of people claimed in claim 1 source stromal cell derived factor 1α, is characterized in that, construction process comprises:

(1) design of primers:

The hSDF-1 α cDNA primers that biotechnology state-run according to U.S. information center provides removes signal peptide and only clones mature peptide sequence 213bp, and insert the Nco I at two ends, BamH I restriction enzyme site and protection base, design synthetic primer sequence is:

Upstream primer is: 5 ˊ GATGCCATGGACGGGAAGCCCGTCAGC3 ˊ;

Downstream primer is: 5 ˊ CGCGGATCCTTACTTGTTTAAAGCTTTCTCCAGGT3 ˊ; (2) pcr amplification of hSDF-1 α gene:

The template of PCR is the recombinant plasmid pCMV-SPORT6-SDF1 α with hSDF-1 α cDNA fragment, and template concentrations is 0.2324ng/ μ L;

The concentration of upstream primer, downstream primer is 10 μ mol/L;

Contain in the reaction system of the PCR of 50 μ L: 25 μ L Premix, 1 μ L template plasmid, 1 μ L upstream primer, 1 μ L downstream primer, all the other are sterilized water;

The response procedures of PCR: 98 ℃ of denaturation 5min; 98 ℃ of sex change 30s, 60 ℃ of annealing 30s, 72 ℃ are extended 30s, 30 circulations; 72 ℃ are extended 10min;

Glue reclaims the PCR product;

(3) double digestion PCR product:

The PCR product enzyme of 40 μ L is cut in system and contained: 1 μ L Nco I, 1 μ L BamH I, 4 μ L10 * KBuffer, 4 μ L0.1%BSA, 30 μ L PCR products, all the other are sterilized water;

37 ℃ of enzymes are cut processing;

Glue reclaims the PCR product of double digestion;

(4) double digestion plasmid pET15b:

The plasmid pET15b enzyme of 20 μ L is cut in system and contained: 1 μ L Nco I, 1 μ L BamH I, 2 μ L10 * K Buffer, 2 μ L0.1%BSA, 10 μ L pET15b plasmids, all the other are sterilized water;

37 ℃ of enzymes are cut processing;

Glue reclaims the plasmid pET15b product of double digestion;

(5) being connected of purpose fragment and vector plasmid pET15b:

Double digestion PCR product and double digestion plasmid pET15b product carry out ligation: contain 1 μ L10 * T in 10 μ L reaction systems ₄The plasmid pET15b product of the PCR product of DNA Ligase Buffer, 6 μ L double digestions, 2 μ L double digestions, 0.5 μ L T ₄DNA Ligase, all the other are sterilized water; 16 ℃ were reacted 12-24 hour, and got pET-15b-hSDF-1 α.

3. the application of the expression vector of people as claimed in claim 1 or 2 source stromal cell derived factor 1α, it is characterized in that, this application is that the expression vector with described people source stromal cell derived factor 1α imports in e. coli bl21 (DE3) competent cell people source stromal cell derived factor 1α is carried out abduction delivering.

4. application as claimed in claim 3, is characterized in that, this application comprises:

(1) utilize the expression vector of described people source stromal cell derived factor 1α and e. coli bl21 (DE3) to build recombinant bacterium BL21 (DE3)/pET15b-hSDF-1 α;

(2) recombinant bacterium is carried out BL21 (DE3)/pET15b-hSDF-1 α and induce processing, to hSDF-1 α abduction delivering.

5. application as claimed in claim 4, is characterized in that, in step (two), recombinant bacterium BL21 (DE3)/pET15b-hSDF-1 α is inoculated in the LB liquid nutrient medium that contains Amp 37 ℃ of shaking culture; Next day, be by volume 1% inoculum size inoculation bacterium liquid to the LB liquid nutrient medium that contains Amp, 37 ℃ of shaking culture to OD600 be 0.4-0.6, add inductor IPTG, the ultimate density that makes IPTG is 1.0mmol/L, after inducing processing under 30 ℃, and centrifugal collection thalline.

6. application as described in claim 4 or 5, is characterized in that, hSDF-1 α exists with the inclusion body form in e. coli bl21 (DE3).

7. application as claimed in claim 6, is characterized in that, further comprises:

Under condition of ice bath, recombinant bacterium BL21 (DE3) after processing/pET15b-hSDF-1 α, centrifugal collection afterwards induced in ultrasonication Throw out, ultrasonication lysate used during ultrasonication is comprised of 10mmol/L Tris-HCL, 5mmol/L EDTA, and pH is 8.0, and every gram recombinant bacterium BL21 (DE3)/pET15b-hSDF-1 α uses 10mL ultrasonication lysate;

Throw outFirst use washings A resuspended, afterwards collecting precipitation; Then use the resuspended throw out of washings B, collecting precipitation is again Inclusion bodyWherein washings A is that 1% Triton-X100,10mmol/L Tris-HCL, 5mmol/L EDTA form by volume ratio, and pH is 8.0; Washings B is by 0.5mol/L Guanidinium hydrochloride, 10mmol/L Tris-HCL, and 5mmol/L EDTA forms, and pH is 8.0;

Utilize sex change liquid resuspended Inclusion body, 20-30 ℃ of standing 40-60min, centrifugal collection afterwards Supernatant liquorWherein said sex change liquid is to be that 6mol/L Guanidinium hydrochloride, volume ratio are 7/10 by concentration ⁵Beta-mercaptoethanol, 10mmol/L Tris-HCL, 5mmol/L EDTA form, and pH is 8.0; Every gram Inclusion bodyUse 5mL sex change liquid;

Supernatant liquorIn add renaturation solution to get the renaturation sample, described renaturation solution is comprised of 1mmol/L reduced glutathion, 0.2mmol/L Sleep-promoting factor B, 10mmol/L Tris-HCL, 5mmol/L EDTA, and pH is 8.0; Every volume Supernatant liquorUse 20 volume renaturation solutions; Renaturation solution adds in the dropping mode Supernatant LiquidIn, and dripped at 12-48 hour;

Collect the renaturation sample is centrifugal Supernatant samples, with cationic exchange coloum SP Sepharose F.F.1mL prepacked column pair Supernatant samplesCarrying out purifying obtains Target proteinDuring separation and purification, the component of balance liquid A liquid used has 20mmol/L Tris-HCL, 0.3～0.4mol/L NaCl, and pH is 8.5, and with 0.45 μ m water-based membrane filtration; Elutriant B liquid: add 1mol/L NaCl in balance liquid A liquid, and with 0.45 μ m water-based membrane filtration; Elution requirement: gradient 0% elutriant B liquid～100% elutriant B liquid, elution volume 20ml, elution flow rate 1.0ml/min, ultraviolet detection wavelength 280nm.

Utilize Sepherdex G-25 post pair Target proteinCarry out desalination, collect isolate corresponding to 280nm chromatographic peak; During desalination, damping fluid used is: 10mmol/L PB, pH7.0.

Images