CN101781364A - Interleukin-1 receptor antagonist - Google Patents
Interleukin-1 receptor antagonist Download PDFInfo
- Publication number
- CN101781364A CN101781364A CN201010023159A CN201010023159A CN101781364A CN 101781364 A CN101781364 A CN 101781364A CN 201010023159 A CN201010023159 A CN 201010023159A CN 201010023159 A CN201010023159 A CN 201010023159A CN 101781364 A CN101781364 A CN 101781364A
- Authority
- CN
- China
- Prior art keywords
- receptor antagonist
- interleukin
- gene
- seq
- lra
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention belongs to the biomedical field and in particular discloses an interleukin-1 receptor antagonist containing the amino acid sequence shown in SEQ ID NO: 2. The invention further discloses a preparation method of the interleukin-1 receptor antagonist. Compared with the like products on the market, the interleukin-1 receptor antagonist disclosed by the invention has the advantage of high biological activity.
Description
Technical field
The invention belongs to biomedicine field, more specifically, the invention discloses a kind of biological acceptor antagonist.
Background technology
Interleukin-1 receptor antagonist (IL-1ra) is a kind of protein-based cytokine receptor antagonist that is present in human body, by bind interleukin-1 (IL-1) acceptor, the activity of antagonism IL-1 specifically.The IL-1ra (trade(brand)name Kineret) that food and drug administration (FDA) ratifies Amgen company in November calendar year 2001 goes on the market, the invalid intractable rheumatoid arthritis of treatment conventional medicine.This is after recombinant tumor necrosis factor acceptor (trade(brand)name Enbrel) listing of American I mmunex company, the genetically engineered drug of the treatment rheumatoid arthritis of second listing.
Nineteen ninety, the people such as Eisenberg of U.S. Synergen company in Britain Nature magazine reported first the result of full-length cDNA of clone IL-1ra, find that IL-1ra and IL-1 structurally have homology, chain with 2 subtype gene of IL-1 in the assignment of genes gene mapping, and reorganization IL-1ra can specific inhibition of IL-6-1 activity, this is first found endogenous cell factor acceptor antagonist, for the treatment diseases associated with inflammation provides new approach.Because the broad spectrum antiphlogistic effect of IL-1ra, it also might bring into play curative effect in the treatment of multiple diseases associated with inflammation.For example, experimentation on animals proves, IL-1ra can effectively treat osteoarthritis, rat cerebral ischemia reperfusion injury, rat enteritis model, guinea pig asthmatic model, mouse pulmonary fibrosis, rat glomerulonephritis, mouse graft-vs-host reaction of dog etc.The paper that Chinese scholar is delivered confirms that also IL-1ra can effectively treat the severe corneal burn of chmice acute injury of lung, rabbit, rat corneal transplantation immunology rejection, rat experiment hepatic fibrosis etc.Thereby IL-1ra has broad clinical application prospect.At present, a major obstacle of IL-1ra exploitation is that its clinical application dosage is very big, and the treatment rheumatoid arthritis needs the dosage of every pin 75-150 milligram, therefore still needs at present active higher interleukin-1 receptor antagonist.
Summary of the invention
The invention discloses a kind of interleukin-1 receptor antagonist, have the aminoacid sequence shown in the SEQ ID NO:2;
The present invention further discloses the dna sequence dna of the above-mentioned aminoacid sequence of coding, shown in SEQ ID NO:1;
The invention also discloses the preparation method of above-mentioned interleukin-1 receptor antagonist, comprise acquisition, IL-1ra expression vector establishment, the expression of goal gene and four steps of purifying of target protein of IL-1ra gene.Wherein the IL-1ra gene obtain step comprise obtain total RNA, design PCR primer, carry out reverse transcription, amplification obtains the IL-1ra gene, PCR primed DNA sequence is shown in SEQ ID NO:3, SEQ ID NO:4, expression plasmid is pET-22b (+) plasmid, and transforming the host bacterium is BL21 (DE3).
The target protein that obtains is carried out active test experience, the result shows, the biological activity of this albumen antagonism IL-1 is held more than 2 times of Kineret of methionine(Met) form abroad for the N that has gone on the market, its immunogenicity and bibliographical information (Scientific discussion, Kineret, ATC Code L04AA14, CPMP/120/02, the unanimity of relevant Kineret Page6/22).
The invention also discloses the purposes of above-mentioned interleukin-1 receptor antagonist in preparation treatment diseases associated with inflammation medicine, wherein diseases associated with inflammation comprises sacroiliitis, enteritis, asthma, pulmonary fibrosis, glomerulonephritis, graft-vs-host reaction, acute lung injury, severe corneal burn, rheumatoid arthritis.Above-mentioned interleukin-1 receptor antagonist disclosed by the invention is preferred for treatment of rheumatoid arthritis.
Description of drawings
Fig. 1: people IL-1ra gene RT-PCR amplification 1.RT-PCR amplified production; 2.DNA Marker is 2,1,0.75,0.5,0.25 from top to bottom, 0.1kb;
Fig. 2: pET-22b (+) physical structure figure: wherein T7 is the T7 promotor, and lacI is the lacI coding region, and ori is a replication origin, and Ap is an ampicillin resistance gene, and f1origin is the f1 replication origin;
Fig. 3: pET-22b (+)/IL-1ra physical structure figure, the same Fig. 2 of corresponding site;
Fig. 4: contain the T carrier double digestion collection of illustrative plates of people IL-1Ra cDNA, wherein 1,2,3 is plasmid double digestion product, and 4 is DNA Marker, is 21,5.1,4.9,1.9,1.38,1.37,0.95 from top to bottom, 0.56kb;
Fig. 5: rhIL-1Ra abduction delivering SDS-PAGE electrophoretic analysis, M: molecular weight standard (be from top to bottom 97.4,66.2,43,31,20.1,14.4kD); 1: thalline whole protein before inducing; 2～6: induce 1,2,3,4,5 hours thalline whole proteins;
Fig. 6: full bacterium of rhIL-1Ra abduction delivering and lysate SDS-PAGE electrophoretic analysis, M: molecular weight standard (be from top to bottom 97.4,66.2,43,31,20.1,14.4kD); 1-2: thalline whole protein; 3-4: supernatant behind the cellular lysate; 5,6: the cellular lysate postprecipitation;
Fig. 7: rhIL-1Ra immunoblotting assay M: molecular weight standard (be from top to bottom 43,29,18,14.4kD); 1: embodiment 3 products; 2:Kineret;
Fig. 8: biological activity is the result relatively, and wherein zero is that import reference substance ■ is a product of the present invention.
Embodiment
Following examples, experimental example only further specify the present invention, should not be construed as limitation of the present invention.
The acquisition of embodiment 1:IL-1ra gene
Get healthy volunteer's peripheral blood 15ml, density gradient centrifugation is removed red corpuscle, and collecting the lymphocyte vitro culture and adding PHA stimulates.Cultivate and finish to collect lymphocyte, with Trizol reagent extracted total RNA.
The IL-1ra gene order of announcing according to Genebank designs the PCR primer:
Primer 1 (SEQ ID NO:3):
5’TTGCCATATGCACCATCATCATCATCATGACGACGACGACAAGCG
CC
TCTGGGAGA
Primer 2 (SEQ ID NO:4):
5’ATTGAAGCTTCTACTCGTCCTCCTGGAA
During implementation sequence, before initiator codon ATG, added the restriction enzyme site of Nde I; After initiator codon, His label protein and EK restriction enzyme site have been added; And in the end after amino acid Glu, TAG is arranged immediately as termination codon, be thereafter the restriction enzyme site of Hind III.The two ends complementation of 152 amino acid gene orders of soluble proteins in primer sequence and the IL-1ra born of the same parents.Changed the 36th, 39 base A, C after the codon ATG into intestinal bacteria preference password T, G respectively during design of primers, because the sub-amino acids coding of degenerate code is constant, therefore the aminoacid sequence to expression product does not have influence.
In 0.5ml micro-reaction pipe, add 3 ' end primer 2 00pmol/L in the 24 μ l reaction solutions, total RNA15 μ g, 70 ℃ of heating add the first chain damping fluid (TAKARA company), RNsin (Progema company), AMV reversed transcriptive enzyme (TAKARA company), dNTPs (TAKARA company) after 5 minutes, mixed reactant was in 42 ℃ of reactions 1 hour.
Reverse transcription finishes the back and add 5 ' end primer, PCR damping fluid, Taq archaeal dna polymerase (TAKARA company) in 20 μ l reaction solution, covers paraffin oil.Amplification condition is: 94 ℃ of sex change 1 minute, and 65 ℃ of annealing 1 minute, 72 ℃ were extended 1.5 minutes, and totally 30 circulations were extended 5 minutes in 75 ℃ at last.Electrophoresis detection amplified fragments size is about 480bp, sees Fig. 1.Amplification gene is packed among the T Vector (Promega company), transform TG1 bacterial strain (Novagen company), sequence verification is errorless.
Embodiment 2:IL-1ra expression vector establishment
Expression plasmid is pET-22b (+) plasmid, and its physical structure figure sees Fig. 2.The peIB homing sequence of former plasmid is substituted behind the insertion goal gene, and synoptic diagram is seen Fig. 2 and Fig. 3.
Picking contains the reorganization TG1 bacterium mono-clonal of the plasmid that checks order in the LB nutrient solution, incubated overnight, the plasmid extraction test kit extracts plasmid in a small amount, contains the intermediate carrier of above-mentioned purpose gene with Nde I and HindIII double digestion, electrophoresis reclaims the small segment about 480bp, the results are shown in Figure 4.Be inserted in pET-22b (+) carrier of cutting with two kinds of identical enzyme enzymes, transformed into escherichia coli BL21 (DE3) (Novagen company) competent cell, carrier is contrast from continuous cropping.
Embodiment 3: the expression of goal gene
The plasmid enzyme restriction collection of illustrative plates with this plasmid transformed competence colibacillus BL21 (DE3) intestinal bacteria, is selected 10 clones after being accredited as correctly, is seeded in respectively in the LB substratum in the small test tube, and 37 ℃ of shaking culture treat that bacterial growth is to OD
600nm=0.6 o'clock, stay a small amount of bacterial suspension after-20 ℃, to add the IPTG that final concentration is 0.5mmol/L (TAKARA company), continue shaking culture, gathered in the crops bacterium until 5 hours every 1 hour.
The bacteriums of observing different clones with 15%SDS-PAGE are before adding IPTG and the protein expression situation of different time points afterwards, and the result shows that whole clones have all increased the protein band about molecular weight 20kDa after inducing.This band molecular weight is consistent with the rhuIL-1ra molecular weight of bibliographical information, sees Fig. 5.Abduction delivering 4 hours, the expression amount of target protein reaches the highest, continues the abduction delivering amount and no longer improves.
The learn from else's experience thalline freeze thawing fragmentation of IPTG abduction delivering, cleer and peaceful precipitation in the centrifugal collection is used the 15%SDS-PAGE electrophoretic analysis, and terminal objective albumen mainly in the supernatant liquor after cytoclasis, shows that IL-1ra expresses with soluble form, sees Fig. 6.Recombinant protein behind a small amount of purifying, with the method for immunoblotting detect (step: 15%SDS-PAGE, (200mA 30min), adds anti-people IL-1Ra monoclonal antibody (R﹠amp with 3%BSA after with membrane closure to the semidrying electrotransfer to cellulose nitrate film; D Systems), wash film behind the incubated at room 1h 3 times, after sheep anti-mouse igg two resistive connections that add peroxidase labelling again close 45min, wash film, colour developing), the property of protein of results suggest IPTG abduction delivering is consistent with import reference substance rhIL-1Ra (Kineret), sees Fig. 7.
Embodiment 4: the purifying of target protein
After fermentation stops, take out bacterium liquid, low-speed centrifugal (5,000rpm, 20 minutes, 4 ℃) is collected thalline, with the physiological saline washing once, discards after all supernatant liquors are subject to sterilization.With the wet thallus weighing, in-20 ℃ of preservations.
Get a certain amount of thalline, be suspended in an amount of 0.01mol/L PBS (pH 7.0) damping fluid (volume ratio of thalline and suspension is 1: 10), ice bath uses high pressure homogenizer to carry out broken bacterium, totally 3 circulations down; Stain smear is carried out in sampling, and test under microscope does not have intact cell substantially, and is centrifugal 20, and 000rpm 20 minutes, 4 ℃, collects supernatant.Supernatant is through having connected Ni
2+The metal-chelating column purification, obtain protein solution based on rough IL-1ra (purity is greater than 70%).
Above-mentioned solution adds a certain amount of recombination ox intestine kinase (rEK) (Shanghai Zhangjiang Biological Technology Co's product), 2mmol/L CaCl
2, put 21 ℃ and hatched 20 hours, the His label protein and the EK restriction enzyme site of N end are removed, obtain the IL-1ra raw product.
The IL-1ra raw product adopts strong cation exchange medium SP-Sepharose FastFlow to carry out ion exchange chromatography at pH 6.2 behind 0.8 μ m membrane filtration, a large amount of solubility bacterium foreign proteins, nucleic acid, intracellular toxin etc. are removed, the purity of target protein can reach 90%, and yield is more than 80%.Improve pH to 8.5, carry out DEAE-Sepharose Fast Flow anion-exchange chromatography, can further remove remaining bacterium foreign protein, bacterial endotoxin, sample purity is reached more than 98%, obtain the IL-1ra highly finished product.
Experimental example 1: biological activity is relatively tested
Material:
Survey viable cell: A375.S2 K-1735 ATCC CRL-1872.
Nutrient solution: for containing 10% newborn calf serum (NBS), RPMI-1640/D ' MEM (1: 1) nutrient solution.
Trypsinase: 0.25% trypsinase is dissolved in cell cultures with among the PBS.
IL-1r α Kineret:R﹠amp; D company product.
Method:
With 10mL nutrient solution dilution IL-1 to final concentration be 4ng/mL.
2. the nutrient solution that contains IL-1 with step 1 dilutes product of the present invention and reference substance Kineret to 800ng/mL respectively, (the initial 150 μ l that add in maximum concentration hole of continuous 3 doubling dilutions in 96 orifice plates, surplus hole respectively adds 100 μ l diluents, then add next hole from maximum concentration hole sucking-off 50 μ l with the multi-channel loading device, blowing even back continues to repeat downwards, 50 μ l of sucking-off abandon to the minimum concentration), multiple hole is set.
3. the A375.S2 cell of taking the logarithm vegetative period, tryptic digestion, counting, common nutrient solution is adjusted cell density to 8 * 10
4/ ml adds in 96 well culture plates 0.1ml/ hole.
4.96 well culture plate places 37 ℃ of 8% CO2gas incubator to cultivate.
5.72h after, add freshly prepared 20: 1 blended MTS/PMS solution (Progema) 20 μ l/ holes, in incubator, continued to hatch 3 hours, measure its A with microplate reader
490-A
630Value.
Result: product E C50:13.2ng/ml of the present invention, import reference substance EC50:28.0ng/ml.
The biological activity of product antagonism IL-1 of the present invention is that the N that has abroad gone on the market holds more than 2 times of Kineret of methionine(Met) form, sees Fig. 8.
Experimental example 2: immunogenicity relatively
According to European Union's bibliographical information (Scientific discussion, Kineret, ATC Code L04AA 14, CPMP/120/02, Page 6/22), in subcutaneous injection IL-1Ra two all administration toxicity research that is carried out with rhesus monkey, experiment the 15th day, nearly all animal all was detected anti-IL-1Ra antibody.
After 1 month the serum of administration treated animal is detected for product of the present invention, the detection data show, all can detect anti-IL-1Ra antibody in the serum of administration treated animal, and the animal of low, middle dosage group and high dose group all has antibody to occur, no dosage correlation, but all do not measured neutralizing antibody.This is consistent with bibliographical information.
Sequence table
＜110〉Antibodies National Engineering Research Center
Shanghai CP Guojian Pharmaceutical Co.,Ltd
＜120〉a kind of interleukin-1 receptor antagonist
<160>4
<170>PatentIn?version?3.2
<210>1
<211>456
<212>DNA
＜213〉dna sequence dna of interleukin-1 receptor antagonist
<400>1
cgtccgtctg?ggagaaaatc?cagcaagatg?caagccttca?gaatctggga?tgttaaccag 60
aagaccttct?atctgaggaa?caaccaacta?gttgctggat?acttgcaagg?accaaatgtc 120
aatttagaag?aaaagataga?tgtggtaccc?attgagcctc?atgctctgtt?cttgggaatc 180
catggaggga?agatgtgcct?gtcctgtgtc?aagtctggtg?atgagaccag?actccagctg 240
gaggcagtta?acatcactga?cctgagcgag?aacagaaagc?aggacaagcg?cttcgccttc 300
atccgctcag?acagtggccc?caccaccagt?tttgagtctg?ccgcctgccc?cggttggttc 360
ctctgcacag?cgatggaagc?tgaccagccc?gtcagcctca?ccaatatgcc?tgacgaaggc 420
gtcatggtca?ccaaattcta?cttccaggag?gacgag 456
<210>2
<211>152
<212>PRT
＜213〉aminoacid sequence of interleukin-1 receptor antagonist
<400>2
Arg?Pro?Ser?Gly?Arg?Lys?Ser?Ser?Lys?Met?Glu?Ala?Phe?Arg?Ile?Trp
1 5 10 15
Asp?Val?Asn?Gln?Lys?Thr?Phe?Tyr?Leu?Arg?Asn?Asn?Gln?Leu?Val?Ala
20 25 30
Gly?Tyr?Leu?Gln?Gly?Pro?Asn?Val?Asn?Leu?Glu?Glu?Lys?Ile?Asp?Val
35 40 45
Val?Pro?Ile?Glu?Pro?His?Ala?Leu?Phe?Leu?Gly?Ile?His?Gly?Gly?Lys
50 55 60
Met?Cys?Leu?Ser?Cys?Val?Lys?Ser?Gly?Asp?Glu?Thr?Arg?Leu?Gln?Leu
65 70 75 80
Glu?Ala?Val?Asn?Ile?Thr?Asp?Leu?Ser?Glu?Asn?Arg?Lys?Gln?Asp?Lys
85 90 95
Arg?Phe?Ala?Phe?Ile?Arg?Ser?Asp?Ser?Gly?Pro?Thr?Thr?Ser?Phe?Glu
100 105 110
Ser?Ala?Ala?Cys?Pro?Gly?Trp?Phe?Leu?Cys?Thr?Ala?Met?Glu?Ala?Asp
115 120 125
Gln?Pro?Val?Ser?Leu?Thr?Asn?Met?Pro?Asp?Glu?Gly?Val?Met?Val?Thr
130 135 140
Lys?Phe?Tyr?Phe?Gln?Glu?Asp?Glu
145 150
<210>3
<211>58
<212>DNA
＜213〉primer
<400>3
ttgccatatg?caccatcatc?atcatcatga?cgacgacgac?aagcgtccgt?ctgggaga 58
<210>4
<211>28
<212>DNA
＜213〉primer
<400>4
attgaagctt?ctactcgtcc?tcctggaa 28
Claims (7)
1. interleukin-1 receptor antagonist, aminoacid sequence is shown in SEQ ID NO:2.
2. the dna sequence dna of coding claim 1 described interleukin-1 receptor antagonist is shown in SEQ IDNO:1.
3. the preparation method of the described interleukin-1 receptor antagonist of claim 1 comprises acquisition, IL-lra expression vector establishment, the expression of goal gene and four steps of purifying of target protein of IL-lra gene.
4. the preparation method of the described interleukin-1 receptor antagonist of claim 3, wherein the IL-lra gene obtain step comprise obtain total RNA, design PCR primer, carry out reverse transcription, amplification obtains the IL-lra gene, PCR primed DNA sequence is shown in SEQ ID NO:3, SEQ ID NO:4.
5. the preparation method of the described interleukin-1 receptor antagonist of claim 3, wherein expression plasmid is pET-22b (+) plasmid in the IL-lra expression vector establishment step, its physical map is as shown in Figure 2.
6. the described interleukin-1 receptor antagonist of claim 1 is preparing the purposes for the treatment of in the diseases associated with inflammation medicine, and wherein diseases associated with inflammation comprises sacroiliitis, enteritis, asthma, pulmonary fibrosis, glomerulonephritis, graft-vs-host reaction, acute lung injury, severe corneal burn, rheumatoid arthritis.
7. the described interleukin-1 receptor antagonist of claim 6 is preparing the purposes for the treatment of in the diseases associated with inflammation medicine, and wherein diseases associated with inflammation is a rheumatoid arthritis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010023159A CN101781364A (en) | 2010-01-22 | 2010-01-22 | Interleukin-1 receptor antagonist |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010023159A CN101781364A (en) | 2010-01-22 | 2010-01-22 | Interleukin-1 receptor antagonist |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101781364A true CN101781364A (en) | 2010-07-21 |
Family
ID=42521526
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201010023159A Pending CN101781364A (en) | 2010-01-22 | 2010-01-22 | Interleukin-1 receptor antagonist |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101781364A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011050709A1 (en) * | 2009-10-26 | 2011-05-05 | 上海交通大学 | Use of interleukin-1 receptor antagonist for preparing medicament for preventing or treating epithelium trauma of intestinal mucosa |
| CN103509100A (en) * | 2012-06-15 | 2014-01-15 | 上海百迈博制药有限公司 | Interleukin-1acceptor antagonist mutant |
| CN111000983A (en) * | 2019-12-25 | 2020-04-14 | 长春生物制品研究所有限责任公司 | Medicinal use of new recombinant human interleukin-1 receptor antagonist |
| CN111875694A (en) * | 2020-05-25 | 2020-11-03 | 北京伟德杰生物科技有限公司 | Interleukin-1 receptor antagonist and fusion protein containing same |
-
2010
- 2010-01-22 CN CN201010023159A patent/CN101781364A/en active Pending
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011050709A1 (en) * | 2009-10-26 | 2011-05-05 | 上海交通大学 | Use of interleukin-1 receptor antagonist for preparing medicament for preventing or treating epithelium trauma of intestinal mucosa |
| CN103509100A (en) * | 2012-06-15 | 2014-01-15 | 上海百迈博制药有限公司 | Interleukin-1acceptor antagonist mutant |
| CN103509100B (en) * | 2012-06-15 | 2017-10-27 | 上海百迈博制药有限公司 | A kind of IL-1 R antagonist mutant |
| CN111000983A (en) * | 2019-12-25 | 2020-04-14 | 长春生物制品研究所有限责任公司 | Medicinal use of new recombinant human interleukin-1 receptor antagonist |
| CN111875694A (en) * | 2020-05-25 | 2020-11-03 | 北京伟德杰生物科技有限公司 | Interleukin-1 receptor antagonist and fusion protein containing same |
| CN111875694B (en) * | 2020-05-25 | 2022-07-05 | 北京伟德杰生物科技有限公司 | Interleukin-1 receptor antagonist and fusion protein containing same |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109306005B (en) | A kind of Epstein-Barr virus specific T-cells antigen receptor and its application | |
| CN106282216B (en) | A kind of preparation method of recombinant long-acting chicken interferon α | |
| CN110590907B (en) | Preparation, separation and purification method of immunoregulatory peptide | |
| Anwer et al. | Detection of immunoactive insulin in Spirulina | |
| CN108066755B (en) | Genetic engineering subunit vaccine for resisting sheep echinococcosis infection and preparation method and application thereof | |
| CN113980145A (en) | Mycobacterium tuberculosis fusion protein and preparation method and application thereof | |
| CN101781364A (en) | Interleukin-1 receptor antagonist | |
| CN101302526A (en) | Recombinant soluble streptococcus hemolyticus haemolysin O gene, recombinant protein and preparation thereof | |
| CN103509100A (en) | Interleukin-1acceptor antagonist mutant | |
| CN109867725A (en) | PD-1-Fc fusion protein and its preparation method and application | |
| CN103360497A (en) | Novel antitumor fusion protein vaccine, and preparation method and application thereof | |
| CN114426955B (en) | Insect-resistant protein Cry3Bb hybridoma cell strain, antibody produced by same and application thereof | |
| CN102241778B (en) | PPA-linker-Thanatin fusion protein and preparation method thereof | |
| CN101870974A (en) | Preparation method of proteinase activated receptors agonist and use thereof | |
| CN109134611B (en) | Polypeptide for inhibiting EGF (epidermal growth factor receptor) promoting tumor cell proliferation by specifically binding EGFR (epidermal growth factor receptor) | |
| CN108314735B (en) | Monoclonal antibody for resisting rat babesia and application thereof | |
| CN103382481B (en) | The expression vector of people source stromal cell derived factor 1α, construction process and application | |
| CN105367663A (en) | Long-acting interleukin-1 receptor antagonist recombinant fusion protein and a preparation method and application thereof | |
| CN100406472C (en) | Fusion and solubility expression of cobratoxin and acidolysis release and purification of recombinant toxin | |
| CN104561022B (en) | Construction of domestic porcine tumor necrosis factor mutant and protein expression purification method | |
| CN104531691A (en) | Primers for obtaining genes of bovine interferon alpha and preparation method for recombinant bovine interferon alpha | |
| CN105085638A (en) | KSHV virus vIRF4 DNA binding domain and polyclonal antibody thereof, and preparation method of polyclonal antibody | |
| CN108864305A (en) | A kind of fusion protein and preparation method thereof being made of sheep albumin, sheep interferon gamma and sheep interferon-tau | |
| CN103232543A (en) | Recombinant protein Tumstatin-CD137L4 with Tumstatin activities as well as preparation method and application thereof | |
| CN103183734B (en) | Mutain containing alpha-non-natural amino acid and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| ASS | Succession or assignment of patent right |
Free format text: FORMER OWNER: SHANGHAI CP GUOJIAN PHARMACEUTICALS CO., LTD. |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20110329 Address after: Shanghai city 201203 libing road Zhangjiang High Tech Park of Pudong New Area No. 399 building 3 Applicant after: Antibodies National Engineering Research Center Address before: Shanghai city 201203 libing road Zhangjiang High Tech Park of Pudong New Area No. 399 building 3 Applicant before: Antibodies National Engineering Research Center Co-applicant before: Shanghai CP Guojian Pharmaceutical Co., Ltd. |
|
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20100721 |