CN103382212B - 5 ' position modified purine mycin compounds and its production and use - Google Patents
5 ' position modified purine mycin compounds and its production and use Download PDFInfo
- Publication number
- CN103382212B CN103382212B CN201310282277.3A CN201310282277A CN103382212B CN 103382212 B CN103382212 B CN 103382212B CN 201310282277 A CN201310282277 A CN 201310282277A CN 103382212 B CN103382212 B CN 103382212B
- Authority
- CN
- China
- Prior art keywords
- modified purine
- puromycin
- purine mycin
- react
- add
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P20/00—Technologies relating to chemical industry
- Y02P20/50—Improvements relating to the production of bulk chemicals
- Y02P20/55—Design of synthesis routes, e.g. reducing the use of auxiliary or protecting groups
Abstract
The invention belongs to Chemical Invention technical field, relate to a kind of 5' position modified purine mycin compound, synthetic method and the purposes in drug screening thereof.The structural formula of 5' position of the present invention modified purine mycin compound is as follows:Wherein: R1For blocking group Fmoc, Boc or Cbz, R2For blocking group Ac, Bz or Pv.The compounds of this invention can be connected to the 5' end of oligonucleotide chain by solid phase phosphoramidite triester method, and for the screening of polypeptide drug, its preparation method is easy, and combined coefficient is high, it is easy to commercialization synthesizes.
Description
Technical field
The invention belongs to Chemical Invention technical field, be specifically related to 5' position modified purine mycin compound and its production and use.
Background technology
In recent years, the in-vitro screening technology of protein has obtained quick development, includes phage display in early days among these
(Phage display), plasmid display (Plasmic display) and cell display (Cell display), but due to phage display
Being directed to cell transfecting when building library and screening, library capacity is affected by transfection efficiency is limited in 109～1010, fall
Low library screening efficiency, it addition, phage display library once builds up, is difficult to carry out effective external sudden change and restructuring again,
And then limit the diversity of library Middle molecule heredity.Under this background, the J.W.Szostak of Harvard Medical School of the U.S. sets up
A kind of being referred to as the protein triage techniques that mRNA shows, this technology can mainly by puromycin during expression
Enter ribosomal A site and newly-generated polypeptide and form this characteristic of covalent bond, by by 3' end with puromycin
DNA with mRNA expresses after being connected in vitro, has been built into the polypeptide libraries that can be used in protein medicaments screening.But
This method is with RNA as template, and the RNA-fusion formed is difficult to withstand harsh screening requirement, special
It is not susceptible to the degraded of RNase, thus affects whole screening process.
It is proposed that DNA display technique be a kind of Novel screen choosing method that can carry out in vitro, except not by cell transfecting
Outside efficiency impact, the DNA-protein fusions that it is formed is the most more stable.Therefore, DNA shows as a kind of
Emerging protein triage techniques, will be at new drug development, and the aspect such as protein interaction and proteomics demonstrates more
It is widely applied space.The realization of DNA display technique needs to be connected to puromycin the 5' end of DNA, and existing
Puromycin can only be connected to the 3' end of DNA by method.
Summary of the invention
An object of the present invention is to provide 5' position modified purine mycin compound.
The two of the purpose of the present invention are to provide the synthetic method of 5' position modified purine mycin compound.
The three of the purpose of the present invention are to provide the purposes of 5' position modified purine mycin compound.
It is an object of the invention to be achieved through the following technical solutions:
The 5' position modified purine mycin compound of the present invention, its structural formula is as follows:
Advantages of the present invention: the compounds of this invention can be coupled to the 5'-end of DNA, is built into more stable protide medicine
Thing screening system, and the preparation of this compound is easy, efficiently, it is easy to commercialization.
Below in conjunction with embodiment, the present invention is specifically described.As known by the technical knowledge, the present invention can by other not
The embodiment departing from its spirit essence or essential feature realizes.Therefore, following embodiment, for each side, all only
It is to illustrate, is not only.All changes within the scope of the present invention or in equivalent the scope of the present invention are all by the present invention
Comprise.
Accompanying drawing explanation
Fig. 1 is the schematic flow sheet of specific embodiment 1 puromycin chemical modification.
Fig. 2 is the schematic diagram of specific embodiment 2 puromycin and oligonucleotides coupling reaction.
Fig. 3 is the schematic flow sheet of specific embodiment 3 in-vitro screening albumen.
Fig. 4 is the expression of results figure of specific embodiment 4.
Detailed description of the invention
Below in conjunction with the accompanying drawings, the present invention is further illustrated by example.It should be understood by those skilled in the art that these examples are only used
In the explanation present invention, rather than limit the scope of the present invention.
Embodiment 1 (synthesis step)
The chemical modification reaction step of puromycin sees Fig. 2.Concrete operation step is as follows:
A. weigh 100mg puromycin to be placed in eggplant-shape bottle, add the acetonitrile that 2ml newly distills, little with ultrasonic echography half
Time, obtained solution is placed in ice-water bath stirring and is cooled to 0 DEG C, be slowly added to 60ul triethylamine under nitrogen protection, treat
After solution clarification, being dissolved in 1ml acetonitrile by 72mg fluorenes methoxy carbonyl acyl succinimide (Fmoc-Osu), 0 DEG C drops to
Stating in reactant liquor, continue stirring, after 30min, solution becomes white opacity liquid, sluggish is warmed to room temperature and stirs 1h, directly
Complete to TLC monitoring reaction, obtain white solid crude product with filtered on buchner funnel；Obtained crude product passes through silica gel column layer
Analysis is further purified acquisition P1, eluant, eluent dichloromethane: methyl alcohol=8:1.
B. being placed in eggplant-shape bottle by 150mg product P1, the pyrido stirrer that addition 2ml processes through distillation fully stirs evenly,
Add 200ul triethylamine at 0 DEG C, after 15min, 400mg DMTrCl is dissolved in 2ml pyridine, the most slowly
Joining in reactant liquor, stirring is to room temperature, until TLC monitoring reaction completes.By obtained reactant liquor by reduced pressure concentration,
Dry method mixes sample, obtains product P2 by silica gel column chromatography, and eluant, eluent is petroleum ether: ethyl acetate=1:3.(produce when TLC analyzes
Object point is owing to containing DMT group, can be analyzed by baking sheet, and the product of band DMT can become Chinese red, sample through baking sheet
The pyridine of middle residual can spread apart through high temperature, this makes it possible to distinguish product mutually with other impure point)
C. 420mg P2 is dissolved in the pyridine that 6ml processes through distillation, adds 10mg DMAP (DMAP), ice
Water-bath is cooled to 0 DEG C, is slowly added to 0.6ml aceticanhydride under nitrogen protection, and after 3h, TLC monitoring reaction completes, at 0 DEG C
Adding methyl alcohol cancellation reaction, obtain product P3 by silica gel column chromatography, eluant, eluent is petroleum ether: ethyl acetate=1:3.
D. being dissolved in 380mg P3 being dried through anhydrous CaCl2 and process and distilled dichloromethane (5ml), ice-water bath cools down
To 0 DEG C, adding 0.2ml dichloroacetic acid, 0 DEG C of stirring, to room temperature, terminates after reaction 2h, and this operation is relatively simple, instead
Obtaining product P4 through dry method loading by silica gel column chromatography after should terminating, eluant, eluent is petroleum ether: ethyl acetate=1:3.
E. claiming 30mg P4, under N2 protects, add 250ul pyridine, 35 DEG C of stirring 15min make P4 be completely dissolved, dissolve
Rear solution is faint yellow, reactant liquor is cooled to 0 DEG C and continues stirring, and add 35ul DIPEA and 20ul phosphorous acyl chlorides, 1h
After, reaction is warming up to 15 DEG C of continuation reaction 4h, TLC plate monitoring reactions and completes, purify through alkaline silica gel post and obtain product P5,
The preparation process of its neutral and alkali post is as follows: take 200ml triethylamine: pillar is washed into alkalescence by the mixed liquor of dichloromethane=3:97,
Pillar is washed to washing out again with 100ml dichloromethane.
Table 1: the yield of representative compound and mass spectrometric data
Embodiment 2, Fig. 2 are that the DNA of modified puromycin and one section of fixed sequence program is attached, and reactions steps is with now
Widely used solid phase phosphoramidite triester method is essentially identical, and coupled product is separated to purify by high-efficient liquid and obtains.Such as institute in figure
Show: representing the polyethylene glycol containing 12 carbon near the Spacer18 of DNA 5' end, rC represents 5'-3' on oligonucleotide chain
The base turned round in direction.
Embodiment 3, carry out the in-vitro screening of polypeptide by 5' position modified purine mycin
The flow process of in-vitro screening albumen is shown in Fig. 3.
(1) the double-stranded DNA library comprising random sequence is built.By being chemically synthesized the single stranded DNA with random sequence
Library, adds isocyatic downstream primer and carries out the PCR amplification of two circulations, final obtain comprise T7 promoter, enhancer,
Initiation codon, random sequence, the double-stranded DNA random library of affinity purification label coding sequence.
Single stranded DNA random sequence:
TAATACGACTCACTATAGGAGGACGAAATG(NNN)9CACCACCACCATCATCATCAGC
TGCGTAACTC
Downstream primer: GAG TTA CGC AGC TGA TGA
Reaction system and PCR condition:
PCR condition is: 95 DEG C of preheating 1min；95 DEG C of sex change 30s, 45 DEG C of renaturation 45s, 72 DEG C of extension 45s, 2
Circulation.
(2) in-vitro transcription.With double-stranded DNA as template, transcribing acquisition mRNA under polymerase effect, reaction system is as follows:
(3) vivoexpression of polypeptide.First make it with end with puromycin before carrying out polypeptide translation with mRNA for template
Oligonucleotide chain Annealing complementary, adds rabbit reticulocyte lysate and expresses, and reaction adds potassium chloride, magnesium chloride after terminating
Make K+、Mg2+Ion concentration respectively reaches 500mM and 50mM and places 50min in room temperature.As a example by a small amount of expression system,
Whole reactions steps and system are as follows:
When carrying out great expression, reaction system scales up as required.
The electrophoresis result that embodiment 4, Fig. 4 process with Proteinase K after being by expression of polypeptides.First isotope 32P is used
Mark one section with the DNA with mRNA template complementary series, and produce with the coupling in embodiment 3 in the presence of clamping plate
Thing is attached, and obtains the band puromycin primer Pu16-L1 that can be used for catching polypeptide, then makes itself and mRNA template
Carry out the expression of polypeptide after Annealing complementary, obtain DNA-polypeptide fusion (band above swimming lane 2), at Proteinase K
After reason, this fusion is degraded (swimming lane 4).Swimming lane 1 is the expression of results catching primer without puromycin.Swimming lane 3
Show experiment for mRNA, be used as the positive control of vivoexpression, the mRNA-polypeptide fusion (swimming formed in expression
Band above road 3) after Proteinase K processes, (swimming lane 5) can be degraded equally.
Claims (2)
1. a 5' position modified purine mycin compound, its structural formula is as follows:
Wherein: R1For blocking group Fmoc, Boc or Cbz, R2For blocking group Ac, Bz or Pv.
2. the method for the 5' position modified purine mycin compound that a kind is prepared described in claim 1 is: a. in organic solvent, divides
Jia Ru fluorenes methoxy carbonyl acyl succinimide and natural puromycin not react, it is thus achieved that the protected preliminary modification of amino
Puromycin product；B. add dimethoxytrityl chloromethanes to react, obtain 5' position by dimethoxy three
The puromycin of phenyl protection；C. add aceticanhydride to react, it is thus achieved that the modified purine mycin that 2' position is protected by acetyl group；
D. the dimethoxytrityl group of 5' position sloughed by addition dichloroacetic acid or trichloroacetic acid, obtains the modification that 5' position is hydroxyl
Puromycin；E. add phosphorous acyl chlorides to react, it is thus achieved that 5' position is the modified purine mycin target of phosphoramidite protection
Product.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310282277.3A CN103382212B (en) | 2013-07-06 | 2013-07-06 | 5 ' position modified purine mycin compounds and its production and use |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310282277.3A CN103382212B (en) | 2013-07-06 | 2013-07-06 | 5 ' position modified purine mycin compounds and its production and use |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103382212A CN103382212A (en) | 2013-11-06 |
| CN103382212B true CN103382212B (en) | 2016-08-31 |
Family
ID=49490162
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310282277.3A Active CN103382212B (en) | 2013-07-06 | 2013-07-06 | 5 ' position modified purine mycin compounds and its production and use |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103382212B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5824793A (en) * | 1996-02-21 | 1998-10-20 | Lynx Therapeutics, Inc. | Solid phase synthesis of oligonucleotide N3'-P5' phosphoramidates |
| CN1373768A (en) * | 1999-09-10 | 2002-10-09 | 杰龙公司 | Oligonucleotide N3'-P5' thiophosphoramidates, their synthesis and use |
| CN101870717A (en) * | 2010-05-28 | 2010-10-27 | 中国人民解放军军事医学科学院放射与辐射医学研究所 | Oligonucleotide direct condensation method reagent and application thereof |
| WO2013019794A1 (en) * | 2011-08-01 | 2013-02-07 | The General Hospital Corporation | Protein and peptide libraries |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2005523232A (en) * | 2000-09-11 | 2005-08-04 | アフィメトリックス インコーポレイテッド | Photocleavable protecting group |
| US9212381B2 (en) * | 2011-11-10 | 2015-12-15 | President And Fellows Of Harvard College | Methods and compositions for labeling polypeptides |
-
2013
- 2013-07-06 CN CN201310282277.3A patent/CN103382212B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5824793A (en) * | 1996-02-21 | 1998-10-20 | Lynx Therapeutics, Inc. | Solid phase synthesis of oligonucleotide N3'-P5' phosphoramidates |
| CN1373768A (en) * | 1999-09-10 | 2002-10-09 | 杰龙公司 | Oligonucleotide N3'-P5' thiophosphoramidates, their synthesis and use |
| CN101870717A (en) * | 2010-05-28 | 2010-10-27 | 中国人民解放军军事医学科学院放射与辐射医学研究所 | Oligonucleotide direct condensation method reagent and application thereof |
| WO2013019794A1 (en) * | 2011-08-01 | 2013-02-07 | The General Hospital Corporation | Protein and peptide libraries |
Non-Patent Citations (2)
| Title |
|---|
| A Remarkable Stabilization of Complexes Formed by 2,6-Diaminopurine Oligonucleotide N3′→P5′Phosphoramidates;Tracy Matray等;《Nucleosides, Nucleotides and Nucleic Acids》;20080417;第19卷(第10-12期);第1553-1567页 * |
| 嘌呤霉素;陈代杰;《微生物药物学》;20080531;第250页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103382212A (en) | 2013-11-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Buller et al. | Design and synthesis of a novel DNA-encoded chemical library using Diels-Alder cycloadditions | |
| CN108778345B (en) | Compounds and methods for treating RNA-mediated diseases | |
| WO2002055727A3 (en) | Methods and reagents for the isolation of nucleic acids | |
| Bhadra et al. | Synthesis of phosphorodiamidate morpholino oligonucleotides by H-phosphonate method | |
| Zlatev et al. | Solid‐Phase Chemical Synthesis of 5′‐Triphosphate DNA, RNA, and Chemically Modified Oligonucleotides | |
| Adlington et al. | Synthesis of novel C-nucleosides with potential applications in combinatorial and parallel synthesis | |
| CN117510565A (en) | Ribose ring modified mRNA cap analogue and preparation method and application thereof | |
| CN106399317A (en) | DNA (deoxyribonucleic acid) aptamer of phthalate type plasticizer and screening and expression method and electro-chemical sensor thereof | |
| Weldon et al. | Purification of a GalNAc-cluster-conjugated oligonucleotide by reversed-phase twin-column continuous chromatography | |
| CN103382212B (en) | 5 ' position modified purine mycin compounds and its production and use | |
| CN106543220A (en) | Phosphoramidate compounds and preparation method thereof and crystal | |
| Seth et al. | Synthesis and biophysical characterization of R-6′-Me-α-L-LNA modified oligonucleotides | |
| CN116987137A (en) | Capping compound and application thereof in mRNA capping | |
| Yang | Solid‐Phase Synthesis of Oligodeoxynucleotide Analogs Containing Phosphorodithioate Linkages | |
| CN108997462A (en) | The fluoro- 2`-C- methyl adenine nucleoside phosphoramidites monomer of 2`- deoxidation -2`- and its synthetic method | |
| CN105986020A (en) | Method and device for constructing sequencing library | |
| Timmons et al. | On the synthesis of the 2, 6-dideoxysugar l-digitoxose | |
| CN108997460A (en) | The fluoro- 2`-C- methyluridine phosphoramidite monomer of 2`- deoxidation -2`- and its synthetic method | |
| CN103382579B (en) | A kind of method of in-vitro screening polypeptide | |
| Srinivas et al. | Synthesis of 2, 3-unsaturated glycosides and disaccharides via ruthenium (III) chloride catalyzed Ferrier glycosylation | |
| Pattanayak et al. | Ceric ammonium nitrate-mediated detritylation of tritylated amines | |
| CN114106109A (en) | Cytoplasm-targeted RNA binding protein enrichment reagent and preparation method and application thereof | |
| CN115707966A (en) | Method for purifying fluorescein labeled nucleoside triphosphate | |
| Chen et al. | DNA display for drug discovery | |
| Wang et al. | Antisense oligonucleotides: Efficient synthesis of 2′-O-methoxyethyl phosphorothioate oligonucleotides using 4, 5-dicyanoimidazole. Are these oligonucleotides comparable to those synthesized using 1H-tetrazole as coupling activator? |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |