CN103374578B - Gene G13 for regulating length and weight of rice grains and application - Google Patents

Abstract

The invention provides a gene G13 for regulating length and weight of rice grains and an application, and belongs to the technical field of plant genetic engineering. Through gene location, a major gene G13 for regulating length and weight of rice grains and an allelic gene G13-NYZ are obtained by separation and cloning. The nucleotide sequences of the major gene and the allelic gene are SEQ ID NO 1 and NO 3 as shown in sequence tables. Through QTL (quantitative trait loci) location and a published correlation analysis result of whole genome, the gene for regulating the shape of grains is located between a third chromosome RM6881 and a marker RM6283, and a gene OsMYB3 influencing the seed development is contained, and is used as the candidate gene. The lengths of grains of nonglutinous rice variety containing the major gene G13 and the allelic gene G13-NYZ are greatly different by utilizing natural population of the rice and through comparative sequencing and correlation analysis. The carrier is interfered by RNAi technology to convert the rice varieties, and the result shows that the length of the grain of the transformation plant is increased to 9.60 mm from 7.85 mm, the thousand seed weight is increased to 34.11g from 28.33g, and a significance level is achieved. The gene cloned by the invention provides new gene resources for production and quality breeding of the rice.

Description

A kind of adjusting and controlling rice grain grain length and heavy gene Gl3 and the application of grain

Technical field

The present invention relates to plant gene engineering technology field.Be specifically related to one and be positioned near control grain grain length and a gene clone of heavy major gene Gl3 paddy rice trisome kinetochore.Utilize QTL positioning result and the whole-genome association result delivered to combine, by gene Primary Location between trisome RM6881 and RM6283.By middle gene function between positioning area is predicted, determine that a MYB family gene OsMYB3 relevant to development of plants is candidate gene.Recycle a natural population this gene is compared to order-checking and association analysis, determined the function of this gene in natural population.Finally, utilize RNAi perturbation technique, by agriculture bacillus mediated genetic transformation, the function of this gene is verified.

Background technology

The size of rice grain is the main determining factor that grain is heavy, and grain heavy be one of three Components of rice yield, therefore, grain size is the important factor (Xing and Zhang 2010) that affects output.In addition, with wheat, barley, other food crop are not both corns etc., the grain size of paddy rice is directly presented in face of human consumer, be an important Appearance Quality of Paddy Rice proterties, and human consumer from different cultures have preference (Fitzgerald et al.2009) to the grain of different sizes.Therefore, illustrate the yield and quality that the hereditary basis of grain size and molecule mechanism are conducive to improve paddy rice simultaneously.

The size of rice grain is typical quantitative character, hereditary basis more complicated.Utilize the QTL (Quantitative Trait Loci) that molecular marking technique can paired domination number amount proterties decompose and locate.In this way, the QTLs of multiple control grain sizes has been located and cloned in a lot of research groups to profit in recent years.The for example wide gene GW2 of impact grain, qSW5/GW5, GS5 (Li et al.2011; Shomura et al.2008; Song et al.2007; Weng et al.2008), and near a gene GS3 who affects grain length (Fan et al.2006) who is positioned at trisome kinetochore.In addition, still there are many trisomic QTL that are positioned at that affect particle shape to be positioned to (Xing et al.2002 by near isogenic line; Thomson et al.2003; Li et al.2004).In recent years, along with the progress of genome sequencing technology, paddy rice whole-genome association has been obtained important breakthrough, has navigated to many sites that are associated with particle shape proterties (Huang et al.2010; Huang et al.2012; Zhao et al.2011).These results show, except the particle shape gene of having cloned, still have the major gene of a lot of control particle shapes to exist.Gl3 gene involved in the present invention, to be positioned at trisomic second particle shape gene, encode one with the myb transcription factor of plant seed related to development, contriver has utilized method separating clone that the map based cloning assignment of genes gene mapping, association analysis and genetic transformation combine this gene.Gl3 hereditary effect is remarkable, has huge application potential and prospect for the improvement of rice yield and varietal character, for the yield and quality breeding of paddy rice provides new genetic resources.

Summary of the invention

The present invention's trisome of separating clone from paddy rice is controlled grain grain length, a heavy major gene, utilizes this gene can improve yield and quality of rice, and applicant is Gl3 (Grain length3) gene by this unnamed gene.

The present invention utilizes the positioning result of particle shape gene QTL on the trisome that three research groups have delivered, and be combined in the site being associated with particle shape on trisome in the whole-genome association result of delivering, downstream by Gl3 Primary Location at GS3 gene, between mark RM6881 and RM6283, by the function prediction to 2 genes within the scope of this interval 17.7kb, the gene (LOC_Os03g29614 is OsMYB3) of having determined one of them MYB structural domain that contains complete R2R3 type is candidate gene.This candidate gene 342 amino acid of encoding altogether, with respect to " river 7 " genotype, there is the insertion of a 12bp in " Nan Yang accounts for " genotype at termination codon place, cause the amino acid whose change in 7, its termination codon place and 20 amino acid whose disappearances.Compare order-checking by the natural population of containing 118 parts of conventional varieties to one and find that this gene contains two kinds of genotype at rice variety, association analysis finds that containing its grain length between these two kinds of genotypic kinds has utmost point significant difference.And, utilize RNAi perturbation technique, by agriculture bacillus mediated genetic transformation, the reduction of finding this gene expression amount can make the grain length of transformation receptor paddy rice " in spend 11 " rise to 9.60mm from 7.85mm; Thousand seed weight is increased to 34.11g from 28.33g.Reach extremely significant difference.

The present invention compared with prior art, has the following advantages and effect:

(1) the present invention has cloned major gene Gl3 and an allelotrope Gl3-NYZ thereof for adjusting and controlling rice grain length and grain principal characteristic shape in paddy rice, for the high yield and high quality breeding of paddy rice provides new genetic resources;

(2) the present invention is in conjunction with the assignment of genes gene mapping, the method for association analysis and genetic transformation, and rapidly and efficiently clone gene, provides technological borrowing for cloning genes involved in other crop.

Brief description of the drawings

SEQ ID NO:1 is the nucleotide sequence of Gl3 gene, and sequence total length is 5097bp.

SEQ ID NO:2 is the aminoacid sequence of the protein of Gl3 gene, 342 amino acid of encoding.

SEQ ID NO:3 is the nucleotide sequence of the allelotrope Gl3-NYZ of Gl3 gene, and sequence total length is 5130bp

SEQ ID NO:4 is the aminoacid sequence of the protein of the allelotrope Gl3-NYZ of Gl3 gene, 321 amino acid of encoding

SEQ ID NO:5 is that the two strands of Gl3 gene suppresses fragment, total length 411bp.

Fig. 1: be near molecule marker schematic diagram paddy rice trisome kinetochore.

SSR flag sequence is referring to http://www.gramene.org/; GS09 flag sequence is referring to Fan et al., 2006; The physical location of molecule marker is referring to database Rice Genome Annotation Project Rice Genome Browser-Release 7http: //rice.plantbiology.msu.edu/cgi-bin/gbrowse/rice/.

Fig. 2: for the aminoacid sequence comparison of major gene Gl3 and allelotrope Gl3-NYZ, represent identical aminoacid sequence No. *.

Fig. 3: for one suppresses expression vector pds1301 collection of illustrative plates.

Preparation method: pMCG161 (GenBank ID:AY572837.1) is cut to rear recovery external source fragment with EcoRI and HindIII (all purchased from precious biotechnology Dalian company limited) enzyme, then be connected in pCAMBIA1301 (purchased from CAMBIA company) and obtain expression vector pds1301.

Fig. 4: suppress to express T0 and detect schematic diagram for the expression amount of Gl3 gene in transfer-gen plant for a kind of.

In figure: dsGl3-2; DsGl3-3 represents that respectively two T0 are for transgenosis family, the negative contrast strain of CK.

Fig. 5: T1 weighs with grain for the grain length of plant and the phenotype difference comparison diagram of negative control plant for inhibition transforms.

In two comparison diagrams in left and right: T1 representative transforms the average grain length/thousand seed weight of positive plant.CK represents average grain length/thousand seed weight of the negative plant of transgenosis.Each 50 strains of the plant that detects.

Fig. 6: for a kind of T1 that suppresses to express after Gl3 gene is for the phenotype of rice plant.

In figure: after Gl3 is suppressed, grain grain length becomes large (in figure: above arrange grain into transgenic positive strain, the negative strain contrast of lower row's grain), and transfer-gen plant grain number per spike reduces, granule density diminish (left negative strain contrast, the right side is transgenic positive strain).Transfer-gen plant plant height becomes short (left negative contrast, the right side is transgenic positive strain).

Embodiment

The location of embodiment 1:Gl3 gene and candidate gene are determined

With Bai etc. with large grain kind " Nan Yang accounts for ", granule kind " river 7 " is parent's RIL, repeated in experiment at 2006 and 2007 2 years, between near two the SSR mark RM6080 and RM156 trisome kinetochore, location obtains one affects grain grain length simultaneously, grain is wide, the main effect QTL (seeing Bai et al.2010) that grain is heavy.Mark position as shown in Figure 1.In addition, there are a lot of research groups near this interval, also to locate the gene having obtained with particle shape and grain re-correlation.Li etc. are by the filial generation colony of a wild-rice and cultivated rice, between RZ452 (be RM632, see http://www.gramene.org/) and RM156, navigate to a main effect QTL (gw3.1) (seeing Li et al.2004) that affects seed size and thousand seed weight.Liu etc. utilize the F2 colony of an another name for Sichuan Province extensive 881 and Y34, and a major gene Mit (3) for a particle shape and grain weight is positioned between RM282 and RM6283 and (sees Liu et al.2005).What jointly navigate in these 3 research groups affects among seed particle shape and the interval RM632 of a heavy QTL and RM6283, Fan etc. are by the hybrid Population in 9311 and river 7, locate and cloned a major gene GS3 (seeing Fan et al.2006), it is between GS09 and RM6881 mark.But these affect seed particle shape and the heavy QTL effect of grain may not be controlled separately by GS3 gene.Huang in 2010 etc. carry out whole-genome association discovery by 517 natural populations, in the scope of GS3 gene downstream 0.3MB, also exist second and weigh relevant gene (seeing Huang et al.2010) with particle shape and grain.In conjunction with the QTL positioning result of 3 research groups, applicant thinks in the scope of 17.7kb between the RM6881 in GS3 gene downstream and RM6283, exist second with particle shape and grain re-correlation gene, applicant is by its called after Gl3 (Grain length 3) gene.

In this section, contain two predicted genes, wherein have a myb transcription factor gene OsMYB3 (LOC_Os03g29614).Myb gene family is family maximum in plant, main relevant with development of plants and secondary metabolism.The homologous gene TT2 of OsMYB3 in Arabidopis thaliana, participates in regulating the accumulation of seed maturity early stage anthocyanidin, and strictly at the early expression (Nesi et al.2001) of seed fetal development.In corn, the homologous gene C1 of OsMYB3, participates in the biosynthesizing (Cone et al.1986) of anthocyanidin in corn.Homologous gene GAMYB in barley, can specificly be attached to GARE motif, regulate the expression of alpha-amylase gene in during Seed Germination, the homologous gene PHMYB3 of petunia, the transcription factor of expressing as a petal specific epiderm, can be incorporated on similar AACA motif.This AACA motif is similar with GARE motif, in the specific promotor that is present in gluten (a kind of seed storage protein) gene.Due to synthesizing of OsMYB3 and these participation rice paddy seed albumen, regulate the gene of seed development to have very high homology, therefore applicant thinks that OsMYB3 gene is Gl3 gene.

To large grain kind " Nan Yang accounts for " (grain length 12.2mm; Thousand seed weight 43.3g), granule kind " river 7 " (grain length 5.8mm; Thousand seed weight 11.4g) the full genome of Gl3 gene of (the above kind is so kind as to give by Raleigh army of Shanghai City Agricultural biological Gene Center) comprise promotor altogether the scope of 5.2kb check order, to confirm in two kinds, whether Gl3 gene contains the difference between allelotype.

Sequence measurement is specially: first, above-mentioned two the total DNA of rice varieties plant leaf of extracting, DNA method for extracting (is shown in Zhang etc. with reference to CTAB method, genetic diversity and differentiation of indica an japonica rice detected by RFLP analysis, 1992, Theor Appl Genet, 83,495-499).Utilize 7 pairs of mutual partly overlapping primers of PCR product (seeing lower described), (PCR reaction is totally 20 μ l to adopt Hi-Fi LA-Taq from the genome of these two kinds, to carry out pcr amplification, specifically joining method is: DNA the first chain template 1 μ l, 10xPCR buffer 2 μ l, 10mM dNTP 1.6 μ l, 2.5mM Mg ²⁺1.5 μ l, the each 0.4 μ l of two-way primer, LATaq enzyme 0.2 μ l, adds distilled water to 20 μ l.PCR buffer used, dNTP, Mg ²⁺, LATaq enzyme etc. is all purchased from precious biotechnology Dalian company limited product.PCR reaction conditions is as follows: 1. 94 DEG C 4 minutes, 2. 94 DEG C 30 seconds, 3. 56 DEG C 30 seconds, 4. 72 DEG C 50 seconds, the 5. step be from the step circulation of 2. step-4. 35 times, 6. 72 DEG C 7 minutes, 7. 4 DEG C of preservations).Then the digestion reaction before the PCR product of, getting 5 μ l checks order.Utilize the EXOI (Biolabs company product) of 5U, SAP (the precious biotech firm in Dalian) and the l × PCR buffer (the precious biotech firm in Dalian) of 0.13U, 37 DEG C of C reactions, make PCR product digestion 1 hour.Finally, utilize the sequencing kit BigDye Terminator Cycle Sequencing v2.0 of PE company of the U.S. and ABI 3730 sequenators (American AB I company product, to specifications operation) to check order from each PCR product two ends respectively.In order to ensure the accuracy of order-checking, each amplified fragments is surveyed 3-4 repetition.The order-checking fragment obtaining re-uses Sequencher 3.1.2 software (Gene Codes Corporation, the U.S.) and carries out respectively sequence assembly.

The DNA sequence dna of sequencing primer is synthetic by Shanghai Sheng Gong biotech firm, and described combination of primers is as follows:

MICF 1CACGCTTCCCAAGCTATGAT

M1CR1 CCGTGCTTGGCGATGTAG

M1CF2 CGCCATTGGCATTGTTTGTA

M1CR2 CTCCCAATGCTGCCTGTCC

M1CF3 CCAAACTCCGATGCTAAACTC

M1CR3 CTCATCTCATGGAGCAGACAGA

M1CF4 TCTGAGAATATCACCGAGAA

M1CR4 AGTTCCCTCGCTTCGTAC

M1CF5 TCTAATGTGATGCCTATCAT

M1CR5 GCTTGCTGAGGGTGCT

M1CF6 CCGTCTGTATCGACCTTGACTT

LR4 GATCGGATGGGACTAATCCTAAT

LF7 CGGGTCATGCCATGTTTG

LR4 GATCGGATGGGACTAATCCTAAT

Result shows: " river 7 " obtaining and " Nan Yang accounts for " sequence, its nucleotide sequence is as shown in SEQ IDNO:1 (sequence length is 5097bp) and SEQ IDNO:3 (sequence length is 5130bp), and allelotrope " Nan Yang accounts for " genotype of finding Gl3 gene has respectively the insertion of a 38bp and a 12bp in the intron of gene and coding region.In conjunction with the QTL positioning result of above-mentioned multiple groups, association analysis result, and the function in seed development of OsMYB3 gene, the difference between this Gl3 genotype and allelotype thereof, has significant dependency with " river 7 " " Nan Yang accounts for " difference on grain length and grain principal characteristic shape.

The association analysis of the protein polymorphisms of embodiment 2:Gl3 gene and it and grain grain length

1.Gl3 the separation of gene cDNA

The corresponding Gl3 gene of the present invention (LOC_Os03g29614), has announced the transcript D88619 (http://www.ncbi.nlm.nih.gov/nuccore/D88619) of this gene at ncbi database (http://www.ncbi.nlm.nih.gov).By conventional RT-PCR method (referring to J. Pehanorm Brooker, EF is Ritchie not, T Manny A Disi work, Huang Peitang, Wang Jiaxi etc. translate, molecular cloning experiment guide (third edition), Beijing, Science Press, 2002 editions) from rice varieties " river 7 " and " Nan Yang accounts for " loose powder, in the Ear tissues of three days, amplification obtains cDNA sequence.The concrete amplification method of cDNA is as follows:

1) first extracting from paddy rice loose powder after the RNA of three days fringe portions, RNA extracting is used the Trizol extraction agent box (concrete operation step is shown in test kit specification sheets) of Invitrogen company;

2) synthetic cDNA the first chain of reverse transcription in RT-PCR: join mixed solution 1: total RNA 2 μ g, DNaseI 2U, 10x DNAseI buffer1 μ l, add DEPC (diethylpyrocarbonate, the strongly inhibited agent of RNA enzyme) process water (0.01%DEPC) to 10 μ l, after mixing, mixed solution 1 is placed to 20 minutes to remove DNA at 37 DEG C, after 20 minutes, mixed solution 1 is placed in to 65 DEG C of water-bath temperature and bathes 10 minutes to remove DNAseI activity, then be placed in 5 minutes on ice, 3. to the oligdT that adds 1 μ l 500 μ g/ml in mixed solution 1, 4. the mixed solution in cooled on ice 1 being placed in immediately to 65 DEG C of water-bath temperature bathes 10 minutes, thoroughly to make RNA sex change, then be placed in 5 minutes on ice, 5. join mixed solution 2: mixed solution 110 μ l, 5x first strand buffer 4 μ l, 0.1M DTT (mercaptoethanol) 2 μ l, 10mM dNTP mixture 1.5 μ l, DEPC processes water 0.5 μ l, ThermoScript II 2 μ l, after mixing, mixed solution 2 being placed in to temperature in 42 DEG C of water-baths bathes 1.5 hours, 6. reaction is placed in 90 DEG C of dry baths 3 minutes by mixed solution 2 after finishing, 7. preserve reaction final product for-20 DEG C, the reagent of using in reaction is all purchased from Invitrogen company,

3) this full length gene cDNA sequence of then announcing according to ncbi database (http://www.ncbi.nlm.nih.gov), design specific primer PCR amplifying specific fragment.The DNA sequence dna of primer is as described below:

M1LF6 CGCCATTGGCATTGTTTGTA

M1RR1 CGTGCCGATGATCCGACT

PCR reaction is totally 20 μ l, specifically joins method and is: cDNA the first chain template 1 μ l, 10xPCR buffer 2 μ l, 10mM dNTP 1.6 μ l, 2.5mM Mg ²⁺1.5 μ l, the each 0.4 μ l LATaq enzyme 0.2 μ l of two-way primer, 20 μ l (PCR buffer used, dNTP, Mg add water ²⁺, LATaq enzyme etc. is all purchased from precious biotechnology Dalian company limited).PCR reaction conditions is as follows: 1. 94 DEG C 4 minutes, 2. 94 DEG C 30 seconds, 3. 56 DEG C 30 seconds, 4. 72 DEG C 50 seconds, 5. from 2.-4. circulate 35 times, 6. 72 DEG C 7 minutes, 7. 4 DEG C of preservations.

4) pcr amplification obtains the cDNA product of D88619, be connected to T/A cloning vector pGEMT-vector (purchased from Pu Luomaige (Beijing) Bioisystech Co., Ltd, i.e. U.S. Promega company) and go up and use T7 and SP6 primer (primer that carrier pGEMT-vector carries) sequence verification.

The aminoacid sequence comparison of 2.Gl3 gene and allelotrope Gl3-NYZ thereof

Find by the relatively order-checking to " river 7 " and " Nan Yang accounts for " two parent cDNA, in parents' basis, there is very big-difference in its aminoacid sequence, and " Nan Yang accounts for " genotype has the insertion of 12bp at its termination codon place, 7 amino acid whose changes and 20 amino acid whose disappearances (" river 7 ", the aminoacid sequence of the protein of " Nan Yang accounts for " Gl3 gene is as shown in SEQ IDNO:2 and SEQ IDNO:4) are caused.Amino acid more as shown in Figure 2.1 result in conjunction with the embodiments, the protein of described Gl3 gene with and the protein of allelotrope Gl3-NYZ between difference, also to grain length and the grain principal characteristic shape of " river 7 " " Nan Yang accounts for " two rice varieties between difference relevant.

3, the association analysis of Gl3 gene and grain grain length

1) by containing 118 kinds (above-mentioned 118 conventional varieties that are open report with reference to kind to one, above-mentionedly derive from reference to kind part the material that the professor of Shanghai Agricultural biological gene center Raleigh army gives, partial reference kind is the material of State Key Laboratory of Crop Genetic Improvent preservation, clone's gene of the present invention and allelic material) natural population's discovery (sequence measurement is shown in embodiment 1) of relatively checking order, in natural population, contain the Gl3 allelotype of two types, corresponding to major gene Gl3 and allelotrope Gl3-NYZ thereof.Its nucleotides sequence is classified as shown in SEQ ID NO:1 and SEQ ID NO:3.

2) find through sequence alignment, in 75 rice varieties, 37 kinds contain Gl3 genotype, and 38 kinds contain Gl3-NYZ genotype.But, in 43 japonica rice varieties, only contain Gl3-NYZ genotype.

3) consider group structure effect, the only relatively Gl3 in 75 rice varieties and the grain length between the genotype of Gl3-NYZ of applicant, finds differences and reaches extremely significantly (p=7.50E-12), as table 1.Therefore, applicant thinks, the grain length difference of long-grained nonglutinous rice natural population, with Gl3 genotypic difference significant correlation.

Table 1: contain two kinds of grain length differences between genotypic kind in natural population

Gene	Japonica rice variety	Japonica rice variety	Japonica rice variety	Japonica rice variety
						Average grain length	Kind number	Average grain length	Kind number
Gl3	8.04	37	-	0
					Gl3-NYZ	9.05	38	8.48	43

The functional verification of embodiment 3:Gl3 gene

1, the double-stranded structure that suppresses carrier of RNAi

1) utilize combination of primers as described below to increase to the target sequence in SEQIDNO:1.The DNA sequence dna of described primer is as follows:

M1RF3 ACTAGTGGTACCGGTCGCCATGCAACGGAC

M1RR3 GAGCTCGGATCCAGCTCGATGTCGTCCAAGTCAA

The two strands obtaining suppresses fragment, and its sequence is as shown in SEQ ID NO:5.

2) the two strands inhibition fragment BamHI and the KpnI that obtain are first carried out to double digestion (purchased from precious biotechnology Dalian company limited, specifically referring to restriction endonuclease specification sheets), after recovery target fragment, link double-stranded the inhibition on carrier (shown in Fig. 3).Ligase enzyme is purchased from NEB company, and reaction system is referring to specification sheets.

3) (electric conversion instrument is eppendorf company product to the method that connection product transforms by electricity, applied voltage is 1800v, working method is shown in instrument specification sheets) import intestinal bacteria DH10B (purchased from Pu Luomaige (Beijing) Bioisystech Co., Ltd, be Promega company of the U.S.), at the LA that contains 250ppm kantlex (purchased from Roche biotech firm product), (LA fills a prescription referring to J. Pehanorm Brooker, EF is Ritchie not, T Manny A Disi work, Huang Peitang, Wang Jiaxi etc. translate, molecular cloning experiment guide (third edition), Science Press, 2002 editions) be coated with ware on resistance culture base and cultivate,

4) the single bacterium colony growing on LA resistance culture base is inoculated in to the 10ml centrifuge tube of sterilizing at Bechtop, in pipe, adds in advance 3ml to contain the LB resistance culture base of 250ppm kantlex, then on 37 DEG C of shaking tables, cultivate 16-18 hour.According to (" molecular cloning experiment guide ", J. Pehanorm Brooker and D.W. Russell work, Huang Peitang etc. translate, Science Press, 2002) described method extracting plasmid, cut detection with KpnI and BamHI (purchased from precious biotechnology Dalian company limited) enzyme, pMCG-1F and pMCG-1R sequence verification for the positive plasmid obtaining, be inhibited and express the first chain carrier; The DNA sequence dna of the primer is as follows:

pMCG-1F：CTGCTCCACACATGTCCATT

pMCG-1R：CCCACCATCTTGTGGAGCTA

5) by step 2) in method, by method 1) in be connected to after the sequence SacI that obtains and SpeI (purchased from precious biotechnology Dalian company limited) double digestion and suppress to express on the first chain carrier, by pMCG-2F and pMCG-2R sequence verification, the two strands having obtained suppresses expression vector; The DNA sequence dna of the primer is as follows:

pMCG-2F：GGCTCACCAAACCTTAAACAA

pMCG-2R：CTGAGCTACACATGCTCAGGTT

6) by step 5) the method for the method that transforms by electricity of inhibition expression vector (reference, use the parameter of voltage with reference to the step 3 of embodiment 3) carry out) import in Agrobacterium (A.tumefaciens) EHA105 (purchased from Australian CAMBIA laboratory) bacterial strain.

7) by step 6) inhibition express Agrobacterium and transform to paddy rice acceptor kind " in spend 11 " (Institute of Crop Science, Chinese Academy of Agricultural Science openly reports and the open rice varieties of providing), genetic transforming method is as follows

2, the double-stranded conversion that suppresses carrier of RNAi

The method of key step, substratum and the preparation thereof of genetic transformation of the present invention is as described below:

1) reagent and solution abbreviation

In the present invention, the abbreviation of substratum plant hormone used is expressed as follows: 6-BA (6-BenzylaminoPurine, 6-benzyladenine); CN (Carbenicillin, Pyocianil); KT (Kinetin, kinetin); NAA (Napthalene acetic acid, naphthylacetic acid); IAA (Indole-3-acetic acid, indolylacetic acid); 2,4-D (2,4-Dichlorophenoxyacetic acid, 2,4 dichlorophenoxyacetic acid); AS (Acetosringone, Syringylethanone); CH (Casein Enzymatic Hydrolysate, caseinhydrolysate); HN (Hygromycin B, Totomycin); DMSO (Dimethyl Sulfoxide, dimethyl sulfoxide (DMSO)); N6max (N6 macroelement composition solution); N6mix (N6 Trace Elements solution); MSmax (MS macroelement composition solution); MSmix (MS Trace Elements solution)

2) solution formula

A) N6 substratum macroelement mother liquor (according to 10 times of concentrated solutions (10X) preparation):

Mentioned reagent is dissolved one by one, be then settled to 1000 milliliters with distilled water.B) N6 substratum trace element mother liquor (is prepared according to 100 times of concentrated solutions (100X)

Mentioned reagent is dissolved under 20-25 degree Celsius and be settled to 1000 milliliters with distilled water.

C) molysite (Fe ₂eDTA) stock solution (according to the preparation of 100X concentrated solution)

By 3.73 grams of b diammonium disodium edta (Na ₂eDTA2H ₂o) and 2.78 grams of FeSO ₄mouth 7H ₂o dissolves respectively, mixes and is settled to 1000 milliliters with distilled water, bathes 2 hours to 70 DEG C of temperature, and 4 DEG C save backup.

D) VITAMIN stock solution (according to the preparation of 100X concentrated solution)

Adding distil water is settled to 1000 milliliters, and 4 DEG C save backup.

E) MS substratum macroelement mother liquor (MSmax mother liquor) (according to the preparation of 10X concentrated solution)

Mentioned reagent is dissolved at 20-25 DEG C of temperature, and be settled to 1000 milliliters with distilled water.

F) MS substratum trace element mother liquor (MSmin mother liquor) (according to the preparation of 100X concentrated solution)

Mentioned reagent is dissolved at 20-25 DEG C of temperature, and be settled to 1000 milliliters with distilled water.

G) 2, the preparation of 4-D stock solution (1 mg/ml):

Weigh 100 milligrams of 2,4-D, with 1 milliliter of 1N potassium hydroxide dissolving 5 minutes, then add after 10 ml distilled waters dissolve completely and be settled to 100 milliliters, at 20-25 DEG C of temperature, preserve.

H) preparation of 6-BA stock solution (1 mg/ml):

Weigh 100 milligrams of 6-BA, with 1 milliliter of 1N potassium hydroxide dissolving 5 minutes, then add after 10 ml distilled waters dissolve completely and be settled to 100 milliliters, 20-25 DEG C of temperature preserved.

I) preparation of naphthylacetic acid (NAA) stock solution (1 mg/ml):

Weigh 100 milligrams of NAA, with 1 milliliter of 1N potassium hydroxide dissolving 5 minutes, then add after 10 ml distilled waters dissolve completely and be settled to 100 milliliters, 4 DEG C save backup.

J) preparation of indolylacetic acid (IAA) stock solution (1 mg/ml):

Weigh 100 milligrams of IAA, with 1 milliliter of 1N potassium hydroxide dissolving 5 minutes, then add after 10 ml distilled waters dissolve completely and be settled to 100 milliliters, 4 DEG C save backup.

K) preparation of glucose stock solution (0.5 grams per milliliter):

Weigh 125 grams of glucose, then dissolve and be settled to 250 milliliters with distilled water, after sterilizing, 4 DEG C save backup.

1) preparation of AS stock solution:

Weigh 0.392 gram of AS, add 10 milliliters of dissolvings of DMSO, divide and be filled in 1.5 milliliters of centrifuge tubes, 4 DEG C save backup.

M) 1N potassium hydroxide stock solution

Weigh 5.6 grams, potassium hydroxide, dissolve and be settled to 100 milliliters with distilled water, 20-25 DEG C of temperature saves backup.

3) for the culture medium prescription of rice transformation

A) inducing culture

Adding distil water to 900 milliliter, 1N potassium hydroxide regulates pH value to 5.9, boil and be settled to 1000 milliliters, divide and install to 50 milliliters of triangular flasks (25 milliliters/bottle), sterilizing according to a conventional method after sealing (sterilizing 25 minutes at 121 DEG C, following medium sterilization method is identical with the sterilising method of basal culture medium).

B) subculture medium

Adding distil water to 900 milliliter, 1N potassium hydroxide regulates pH value to 5.9, boils and is settled to 1000 milliliters, divides and installs to 50 milliliters of triangular flasks (25 milliliters/bottle), sealing, sterilizing as stated above.

C) pre-culture medium

Adding distil water to 250 milliliter, 1N potassium hydroxide regulates pH value to 5.6, sealing, sterilizing as stated above.

Use front heating for dissolving substratum and add 5 milliliters of glucose stock solutions and 250 microlitre AS stock solutions, (25 milliliters/ware) in culture dish are poured in packing into.

D) be total to substratum

Adding distil water to 250 milliliter, 1N potassium hydroxide regulates pH value to 5.6, sealing, sterilizing as stated above.

Use front heating for dissolving substratum and add 5 milliliters of glucose stock solutions and 250 microlitre AS stock solutions, (25 milliliters/every ware) in culture dish are poured in packing into.

E) suspension medium

Adding distil water to 100 milliliter, regulates pH value to 5.4, divides in the triangular flask that installs to two 100 milliliters sealing, sterilizing as stated above.

Before use, add 1 milliliter of aseptic glucose stock solution and 100 microlitre AS stock solutions.

F) select substratum

Adding distil water to 250 milliliter, regulates pH value to 6.0, sealing, sterilizing as stated above.

Before using, dissolve substratum, add 250 microlitre HN (50 mg/ml) and 400 microlitre CN (250 mg/ml) packing to pour (25 milliliters/ware) in culture dish into.(note: selecting for the first time substratum Pyocianil concentration is 400 mg/litre, selecting for the second time and later substratum Pyocianil concentration is 250 mg/litre).

G) pre-division culture medium

Adding distil water to 250 milliliter, 1N potassium hydroxide regulates pH value to 5.9, sealing, sterilizing as stated above.

Before using, dissolve substratum, 250 microlitre HN (50 mg/ml), 250 microlitre CN (250 mg/ml), (25 milliliters/ware) in culture dish are poured in packing into.

H) division culture medium

Adding distil water to 900 milliliter, 1N potassium hydroxide regulates pH value to 6.0.

Boil and be settled to 1000 milliliters with distilled water, point installing to 50 milliliters of triangular flasks (50 milliliters/bottle), sealing, sterilizing as stated above.

I) root media

Adding distil water to 900 milliliter, by 1N potassium hydroxide adjusting pH value to 5.8.

Boil and be settled to 1000 milliliters with distilled water, point installing to and to take root (25 milliliters/pipe) in pipe, sealing, sterilizing as stated above.

4) agriculture bacillus mediated genetic transformation step

A) callus of induce

Ripe rice varieties " in spend 11 " rice paddy seed is shelled, then use successively 70% Ethanol Treatment 1 minute, 0.15% mercury chloride (HgCl ₂) seed-coat sterilization 15 minutes, clean seed 4-5 time with aqua sterilisa; Seed is placed on inducing culture.Postvaccinal substratum is placed in to dark place and cultivates 4 weeks, 25 ± 1 DEG C of temperature.

B) callus subculture

Select the embryo callus subculture of glassy yellow, consolidation and relatively dry, be put in dark lower cultivation 2 weeks on subculture medium, 25 ± 1 DEG C of temperature.

C) preculture

Select the embryo callus subculture of consolidation and relatively dry, be put in dark lower cultivation 2 weeks on pre-culture medium, 25 ± 1 DEG C of temperature.

D) Agrobacterium is cultivated

At the LA substratum of selecting with corresponding resistance, (preparation of LA substratum is with reference to J. Pehanorm Brooker etc., 1998) upper preculture Agrobacterium EHA105 (agrobacterium strains that this bacterial strain openly uses from CAMBIA company) two days, 28 DEG C of temperature; Agrobacterium is transferred in suspension medium, on 28 DEG C of shaking tables, cultivates 2-3 hour.

E) Agrobacterium is infected

Pre-incubated callus is transferred in the bottle of the bacterium of having gone out; Regulate the suspension of Agrobacterium to OD ₆₀₀0.8-1.0; Callus is soaked in agrobacterium suspension 30 minutes; Shift callus blots to the good filter paper of sterilizing; Then be placed on common substratum and cultivate 3 days, temperature 19-20 DEG C.

F) callus washing and selection are cultivated

Aqua sterilisa washing callus is to cannot see Agrobacterium; Be immersed in containing in the aqua sterilisa of 400 milligrams/L Pyocianil (CN) 30 minutes; Shift callus blots to the good filter paper of sterilizing; Shift callus to selecting selection on substratum to cultivate 2-3 time, each 2 weeks.

G) differentiation

Kanamycin-resistant callus tissue is transferred on pre-division culture medium in dark place cultivation 5-7 days; Shift the callus of pre-differentiation culture to division culture medium, under illumination, cultivate, 26 DEG C of temperature.

H) take root

Cut the root that differentiation phase produces; Then transfer them in root media and cultivate 2-3 week under illumination, 26 DEG C of temperature.

I) transplant

Wash the residual substratum on root off, the seedling with good root system is proceeded to greenhouse, kept moisture moistening at initial several days simultaneously.

The T0 obtaining is for transfer-gen plant called after dsGl3-n (n is transfer-gen plant 2 or transfer-gen plant 3, and they represent respectively genetically modified different family).

3, the investigation of transgenosis proterties and expression analysis

1) get T0 for the total DNA of transformed plant blade extracting, DNA method for extracting is CTAB method (Zhang etc., genetic diversity and differentiation ofindica anjaponica rice detected by RFLP analysis, 1992, TheorAppl Genet, 83,495-499).Then by PCR method, T0 is carried out to positive detection for transformed plant primer pMCG-2F and pMCG-2R.

PCR reaction cumulative volume is 20 μ l, specifically joins method and is: template 100ng, 10xPCR buffer 2 μ l, 10mM dNTP 1.6 μ l, 2.5mM Mg ²⁺1.5 μ l, the each 0.3 μ l of left and right primer, Taq enzyme 0.2 μ l adds deionized water to 20 μ l (PCR buffer used, dNTP, Mg ²⁺, rTaq enzyme etc. is all purchased from precious biotechnology Dalian company limited).PCR reaction conditions is as follows: 1. 94 DEG C 4 minutes, 2. 94 DEG C 30 seconds, 3. 56 DEG C 30 seconds, 4. 72 DEG C 1 minute, 5. the walk from 2. walking a 4. step circulation 32 times, 6. 72 DEG C 7 minutes, 7. 4 DEG C of preservations.PCR product is electrophoresis detection on the TBE sepharose of 1% (mass/volume).To T0 for positive plant sowing (T1 generation), for field planting and the proterties investigation in T1 generation are prepared.

2) suppress to express the target gene expression amount in plant in order to detect, extracting T0 for transfer-gen plant loose powder after total RNA of three days Ear tissues, carry out reverse transcription according to the method for embodiment 2, obtain using the method for real-time fluorescence quantitative PCR to detect the expression amount of Gl3 after product.Reagent is purchased from precious biotechnology Dalian company limited, and reaction system is referring to specification sheets.PCR instrument is 7500 of American AB I company, and PCR parameter is 95 DEG C of denaturations 10 seconds, enters the rear 95 DEG C of sex change of circulation 5 seconds, and 60 DEG C of annealing are extended 40 seconds, 40 circulations.The results are shown in Figure 4, compared with negative control, there is significance reduction in the expression amount of the Gl3 gene of two familys.The primed DNA sequence of the Gl3 gene quantification of using is as follows:

M1RTF1 GTGGAATCGAATCAGTCGAGC

M1RTR1 TACGCCTTCTGCGCCTACTTA

3) T1 is carried out to Phenotypic Observation after for plant plantation land for growing field crops, by to 50 strain transgenosis T1 for positive plant and negative control comparison, find that the average grain length of transgenic positive plant is 9.60mm, with respect to transforming negative control grain length 7.85mm, reach utmost point significant difference.The thousand seed weight of transgenic positive plant is increased to 34.11g from 28.33g, reaches extremely significant difference, and comparison diagram is shown in Fig. 5.Meanwhile, be also accompanied by grain number per spike and reduce, spike length is elongated, the features such as granule density reduces, and sees Fig. 6.Fig. 6 shows: the first row grain is transgenosis phenotype, the second behavior negative control.Plant and fringe: the right is transgenosis phenotype, the negative contrast in the left side.

Reference

Bai X，Luo L，Yan W，Kovi MR，Zhan W，Xing Y(2010)Genetic dissection ofrice grain shape using a recombinant inbred line population derived from two contrasting parents and fine mapping a pleiotropic quantitative trait locus qGL7.BMC genetics 11：16

Cone，K.C.，F.A.Burr，et al.(1986).″Molecular analysis of the maize anthocyanin regulatory locus C1.″Proc Natl Acad Sci U S A 83(24)：9631-9635.

Fan，C.，Y.Xing，et al.(2006).″GS3，a major QTL for grain length and weight and minor QTL for grain width and thickness in rice，encodes a putative transmembrane protein.″Theor Appl Genet 112(6)：1164-1171.

Fitzgerald，M.A.，S.R.McCouch，et al.(2009).″Not just a grain of rice：the quest for quality.″Trends Plant Sci14(3)：133-139.

Huang，X.，X.Wei，et al.(2010).″Genome-wide association studies of 14agronomic traits in rice landraces.″Nat Genet 42(11)：961-967.

Huang，X.，Y.Zhao，et al.(2012).″Genome-wide association study of flowering time and grain yield traits in a worldwide collection ofrice germplasm.″Nat Genet 44(1)：32-39.

Li，J.，M.Thomson，et al.(2004).″Fine mapping of a grain-weight quantitative trait locus in the pericentromeric region ofrice chromosome 3.″Genetics 168(4)：2187-2195.

Li，Y.，C.Fan，et al.(2011).″Natural variation in GS5plays an important role in regulating grain size and yield in rice.″Nat Genet 43(12)：1266-1269.

Liu，M.，Y.Liu，et al.(2005).″Genetic Analysis and Mapping of Dominant Minute Grain Gene Mi3(t)in Rice.″Rice Science 2(4)：243-248.

Nesi，N.，C.Jond，et al.(2001).″The Arabidopsis TT2gene encodes an R2R3MYB domain protein that acts as a key determinant for proanthocyanidin accumulation in developing seed.″Plant Cell 13(9)：2099-2114.

Shomura，A.，T.Izawa，et al.(2008).″Deletion in a gene associated with grain size increased yields during rice domestication.″Nat Genet 40(8)：1023-1028.

Song，X.J.，W.Huang，et al.(2007).″A QTL for rice grain width and weight encodes a previously unknown RING-type E3ubiquitin ligase.″Nat Genet 39(5)：623-630.

Thomson，M.J.，T.H.Tai，et al.(2003).″Mapping quantitative trait loci for yield，yield components and morphological traits in an advanced backcross population between Oryza rufipogon and the Oryza sativa cultivar Jefferson.″TheorAppl Genet 107(3)：479-493.

Weng，J.，S.Gu，et al.(2008).″Isolation and initial characterization of GW5，a major QTL associated with rice grain width and weight.″Cell Res 18(12)：1199-1209.

Xing，Y.and Q.Zhang(2010).″Genetic and molecular bases of rice yield.″Annu Rev Plant Biol 61：421-442.

Xing，Z.，F.Tan，et al.(2002).″Characterization of the main effects，epistatic effects and their environmental interactions ofQTLs on the genetic basis ofyield traits in rice.″Theor Appl Genet 105(2-3)：248-257.

Claims (2)

1. The application of 1.Gl3 gene in control rice grain grain length is heavy with grain, is characterized in that, the nucleotide sequence of this gene is as shown in SEQ ID NO:1.
2. 2. the application of Gl3 gene as claimed in claim 1 in control rice grain grain length grain is heavy, the aminoacid sequence of the protein of this gene is as shown in SEQ ID NO:2.