CN103343163A - PCR-DHPLC detection primer and detection method for transgenic rice line CRY1C - Google Patents
PCR-DHPLC detection primer and detection method for transgenic rice line CRY1C Download PDFInfo
- Publication number
- CN103343163A CN103343163A CN2013102228501A CN201310222850A CN103343163A CN 103343163 A CN103343163 A CN 103343163A CN 2013102228501 A CN2013102228501 A CN 2013102228501A CN 201310222850 A CN201310222850 A CN 201310222850A CN 103343163 A CN103343163 A CN 103343163A
- Authority
- CN
- China
- Prior art keywords
- dhplc
- cry1c
- primer
- pcr
- detection method
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a PCR-DHPLC detection primer and a detection method for a transgenic rice line CRY1C. The primer possesses stronger specificity, and can be used in PCR, and helps to specifically amplifying DNA fragments of the transgenic rice line CRY1C, and the amplified product is suitable for subsequent DHPLC analysis. The detection method of the transgenic rice line Cry1C is simple and convenient to operate, good in expansion performance and strong in specificity. The PCR amplified products are analyzed by DHPLC, the fragment size resolution can reach multiple bases, and the resolution ratio is high. The primer and the detection method for the transgenic rice line CRY1C have the advantages that the detection method is simple, convenient, effective, reliable and especially suitable for port inspection and quarantine department and the like.
Description
Technical field
The application relates to the detection of transgenic product, and the PCR-DHPLC that particularly relates to a kind of transgenic paddy rice CRY1C strain detects primer and detection method.
Background technology
Since first transgenic paddy rice in 1988 came out, the transgenic paddy rice development was rapid, and has obtained a series of achievements; The consequent also becomes the focus of various countries to the detection of transgenic paddy rice.Detection method to transgenic paddy rice mainly adopts conventional PCR, real-time fluorescence PCR, southern blotting technique method, RNA blotting and gene chips etc. at present.Traditional conventional PCR detection method has certain limitation aspect platform extension, along with the increase of target to be checked, need consumption and the ratio of the every cover primer in the system be optimized again, and take into account factors such as amplification efficiency, and workload is bigger; On the other hand, the method for the common gel electrophoresis analysis amplified production that adopts, it is not high to distinguish efficient, and detected result is undesirable.More multiple conventional PCR detection method has superiority though real-time fluorescence PCR is at aspects such as detection sensitivities, but because the restriction of present instrument self and fluorescence dye development, non-interfering 4 fluorescence channels only can be provided simultaneously, also limit this technology and detected the flux expansion, and detected the cost height.Southern blotting technique method and RNA blotting need to change film, hybridization, and complex operation, expense height, detection time are long, and practical application is also less.Based on the gene chip detection methods of overlapping PCR of routine more, need many cover primers to increase, complex operation step, and be not suitable for large-scale high throughput testing.
(Denaturing High-performance Liquid Chromatography is a kind of method for nucleic acid analysis of simple, quick, non-gel DHPLC) to the sex change high-efficient liquid phase chromatogram technology, has advantages such as good resolution, extendability are strong, sensitivity height.This method is at 50 ℃ of condition analysis samples, and the wash-out at sample peak is only determined by the quantity of base pair that the base pair different amts elution order of sample is also different, thereby produces different sample peaks.Concrete, the acetonitrile concentration that has served as post improves, and nucleic acid fragment can be come out by wash-out according to molecular weight order from small to large.Relatively determine the molecular weight size by elution peak and the DNA marker that obtains, thereby judge in the sample whether contain the target detect gene.PCR-DHPLC is the technology that PCR is combined with DHPLC, namely adopts pcr amplification to go out target sequence earlier, and then amplified production is carried out DHPLC analyze, thereby improve sensitivity and the specificity that detects.At present, the detection method that does not still have the PCR-DHPLC of transgenic paddy rice CRY1C strain.
Summary of the invention
The application's purpose provides the primer that a kind of new PCR-DHPLC that is used for transgenic paddy rice CRY1C strain detects, and based on the PCR-DHPLC detection method of the transgenic paddy rice CRY1C strain of this primer.
For achieving the above object, the application has adopted following technical scheme:
The application discloses the primer that a kind of PCR-DHPLC for transgenic paddy rice CRY1C strain detects, and the upstream primer of this primer contains sequence shown in the Seq ID No.1, and downstream primer contains sequence shown in the Seq ID No.2;
Seq?ID?No.1:5’-CCAATCATGGAGCAACAAACC-3’
Seq?ID?No.2:5’-TGACCCTCGAGTTTCTCCATAAT-3’。
Need to prove, the application's primer is the Auele Specific Primer that designs at transgenic paddy rice CRY1C strain, can carry out specific amplification to transgenic paddy rice CRY1C strain, therefore, be appreciated that this primer except the PCR-DHPLC that is used for the application detects, be equally applicable to conventional PCR and detect, and the detection of other PCR-based amplification, as real-time fluorescent PCR, gene chip etc.
The application's another side also discloses a kind of PCR-DHPLC detection method of transgenic paddy rice CRY1C strain, this detection method comprises the primer that adopts the application's design, DNA with detected sample is that template is carried out pcr amplification, and the product of pcr amplification is carried out dhplc analysis.
Need to prove, the primer of the application's design is the Auele Specific Primer at transgenic paddy rice CRY1C strain, therefore, be appreciated that, if contain the transgenic paddy rice CRY1C product set member of capacity in the detected sample, can amplify corresponding target fragment, and when DHPLC analyzes, produce corresponding elution peak.In addition, the application's primer also is simultaneously to design according to the specific demand that DHPLC analyzes, and the product that this primer amplification comes out can be good at being applicable to that DHPLC analyzes.
Further, it is that reference standard is carried out dhplc analysis that the application's detection method also comprises with DNA marker, and the dhplc analysis result of pcr amplification product and the dhplc analysis result of DNA marker are compared.
Preferred the application's detection method comprises the steps:
(A) adopting the application's primer, is template with the DNA of detected sample, carries out pcr amplification;
(B) pcr amplification product with step (A) is that sample carries out the DHPLC analysis, is that reference standard is carried out the DHPLC analysis with DNA marker simultaneously;
(C) the DHPLC analytical results of pcr amplification product in the step (B) and the DHPLC analytical results of DNA marker are compared, determine the molecular weight size of pcr amplification product, thereby judge whether to contain the target sequence of detection.
Need to prove, in theory, the application's primer is the Auele Specific Primer according to the design of transgenic paddy rice CRY1C strain, can amplify the fragment of about 285bp to the transgenic paddy rice CRY1C product set member in the detected sample, therefore, can analyze the elution peak of 285bp by DHPLC; And other composition is not had amplification, namely do not have other elution peak and occur.Among the application, judge whether to contain transgenic paddy rice CRY1C strain target sequence foundation namely, whether the elution peak of 285bp is arranged.
Because adopt above technical scheme, the application's beneficial effect is:
The application's transgenic paddy rice CRY1C strain detects primer and has stronger specificity, can be used in follow-up multiplex PCR amplification and DHPLC and analyzes.The application combines PCR at traditional undesirable problem of electrophoretic analysis pcr amplification result with DHPLC, a kind of easy and simple to handle, scalability good, resolving power is high transgenic paddy rice CRY1C strain detection method is provided.Utilize the pcr amplification product of DHPLC to analyze, can reach several bases to different big or small PCR product fragment differentiation rates, even can distinguish the fragment of 1 base difference in size.The application's primer and detection method are particularly suitable for department's uses such as Check and Examination of Port quarantine for the detection of transgenic paddy rice CRY1C strain provides a kind of simple, convenient, effective, reliable detection method.
Description of drawings
Fig. 1: the partial results figure that is the DHPLC analysis of pcr amplification product in the embodiment of the present application;
Wherein, top-down curve is respectively, and M representation DNA marke, 1 represents non-transgenic paddy rice, 2 and represents transgenic paddy rice Bt63 strain, 3 and represent Kemingdao 1,4 and represent transgenic paddy rice section and represent for rich No. 6,5 Cry1C, 6 and represent KF8 strain, 7 and represent MON88017,8 and represent Bt176,9 and represent MON863,10 and represent RRS, 11 and represent soybean A2704-12,12 and represent non-transgenic rape, 13 and represent non-transgenic cotton, 14 and represent potato EH92-527-1,15 and represent pawpaw, the blank water contrast of 16 representatives.Each peak value of DNA marker is followed successively by 80bp, 102bp, 174bp, 257bp, 267bp, 296bp, 434bp, 458bp, 587bp from left to right.
Embodiment
The application provides the primer of the PCR-DHPLC detection that is used for transgenic paddy rice CRY1C strain, and this primer designs at the distinguished sequence of transgenic paddy rice CRY1C strain, and the specific amplification that can be used in transgenic paddy rice CRY1C strain detects.The application also provides the PCR-DHPLC detection method based on the transgenic paddy rice CRY1C strain of the application's primer on this basis.
Need to prove, the application's primer is to detect and design at the PCR-DHPLC of transgenic paddy rice CRY1C strain, but, be appreciated that, itself also uses this primer as pcr amplification, the pcr amplification of therefore, can be used for conventional pcr amplification, real-time fluorescence PCR amplification equally, being combined with gene chip etc.
Also by reference to the accompanying drawings the application is described in further detail below by concrete experimental example.Following experimental example only is further detailed the application, should not be construed as the restriction to the application.
Embodiment 1DNA extracts
(1) DNA extraction with reference to plant genome DNA extract test kit (QIAGEN, the method that Cat.No.69104) provides makes improvements slightly extracts DNA, the concrete operations step is as follows:
1. the AP1 solution of 65 ℃ of preheatings and Buffer AE;
2. the liquid nitrogen grinding sample is got an amount of sample and is gone in the centrifuge tube of 1.5mL after Powdered;
3. add the AP1 solution of 400 μ L preheatings and the RNA enzyme of 4 μ L100mg/mL in the centrifuge tube, fully behind the mixing, 65 ℃ of water-bath 10min-15min, during vibration mixing 2-3 time;
4. after water-bath is finished, directly add 130 μ LAP2 solution, can not shake during ice bath 5min ice bath behind the mixing that fully vibrates, then the centrifugal 5min of 14000r/min;
5. draw supernatant and join in the QIA shredder Mini spin column pillar, be i.e. purple pillar in the test kit, the centrifugal 2min of 14000rpm/min, the volume number of the supernatant liquor that record is drawn;
6. abandon top pillar, add the Buffer AP3/E solution of 1.5 times of volumes in the solution after filter, with liquid-transfering gun mixing gently;
7. get the solution of 650 μ L steps mixing 6. at every turn and transfer in the DNeasy Mini spin column pillar, i.e. the pillar of white in the test kit, the centrifugal 1min of 14000rpm/min abandons filtrate, has filtered fully until the solution of step mixing 6.; Need to prove, the volume that DNeasy Mini spin column post can hold when filtering is about 650 μ L, and therefore step solution 6. is generally all greater than 650 μ L,, 650 μ L solution can only be got at every turn, rest solution could be added again after filtering, abandon filtrate;
8. abandon following collection tube, spin column post is put into a new 2mL collection tube, add 500 μ LBuffer AW solution, the centrifugal 1min wash-out of 14000rpm/min impurity, repeat the operation of wash-out impurity once, abandon filtrate, the centrifugal 1min of 12000rpm/min blank pipe;
9. abandon following collection tube, change a new 1.5mL centrifuge tube, add the Buffer AE dissolving DNA after the 100 μ L preheatings, room temperature leaves standstill 5min deposit D NA, the centrifugal 1min of 12000rpm/min, the solution of collecting is dna solution, need to prove that the Buffer AE after the 100 μ L preheatings can add at twice or repeatedly;
10. abandon top pillar, preserve dna solution for-20 ℃.
(2) DNA purifying: when the amount that contains impurity such as protein among the DNA was higher, its purity can not satisfy requirement of experiment, need carry out purifying to it, and concrete purification step is as follows:
1. after the dna solution that extracts being diluted to 500 μ L-700 μ L, add isopyknic phenol and chloroform, fully mixing;
2. the centrifugal 10min of 14000rpm/min gets supernatant liquor;
3. add the Virahol of 0.6 times of volume in supernatant liquor ,-20 ℃ leave standstill more than the 30min;
4. the centrifugal 10min of 14000rpm/min under 4 ℃ of conditions abandons supernatant;
5. to 70% the ethanol that adds 1mL4 ℃ of precooling during step is abandoned the precipitation of supernatant liquor in 4., the centrifugal 10min of 14000rpm/min abandons supernatant, and repetitive operation once;
6. will be air-dry through being deposited under the aseptic condition of step washing with alcohol 5., add an amount of AE Buffer dissolving DNA, namely obtain the higher dna solution of purity.Need to prove, the add-on of AE Buffer is decided according to concrete requirement of experiment, if wish that the concentration of acquisition dna solution is higher, then can add more a spot of AE Buffer, as 10 μ L-50 μ L, also can directly add 100 μ LBuffer AE again, then before DNA concentration and the purifying quite, perhaps add the Buffer AE of volume more to obtain the dna solution of low concentration.
Embodiment 2DNA concentration determination
The sample DNA that extracts is carried out concentration and purity testing; Adopt ultraviolet spectrophotometer to measure 260nm and 280nm place absorption value, calculate purity and the concentration of nucleic acid respectively, calculation formula is as follows:
DNA purity=OD260/OD280
DNA concentration=50 * OD260mg/mL
The purity ratio of DNA is between 1.7~1.9, and concentration is greater than 10ng/ μ L.
Embodiment 3PCR amplification
According to the dna sequence dna design primer (table 1) of transgenic paddy rice CRY1C strain, and the DNA of the following sample of extraction carries out specific detection: transgenic paddy rice KF8 strain, non-transgenic paddy rice, transgenic paddy rice Bt63 strain, Kemingdao 1, rich No. 6 of transgenic paddy rice section, Cry1C strain, MON88017 strain, Bt176 strain, MON863 strain, RRS, soybean A2704-12, non-transgenic rape, non-transgenic cotton, potato EH92-527-1, pawpaw etc.
The detection primer of table 1 transgenic paddy rice CRY1C strain
Title | Sequence 5 '-3 ' | Seq?ID?No. |
CRY1C-F | CCAATCATGGAGCAACAAACC | 1 |
CRY1C-R | TGACCCTCGAGTTTCTCCATAAT | 2 |
PCR reaction system cumulative volume is 50 μ L, each composition is respectively: PCR reaction solution 10 * Buffer5 μ L, 2.5mmol/L dNTP5 μ L, each 1 μ L of the upstream primer of 10 μ mol/L and downstream primer, 5U/ μ L Taq polymerase0.3 μ L, dna solution 1 μ L, supplying with the sterilization distilled water then is 50 μ L.
PCR reaction conditions: 94 ℃ of sex change 1min; Enter 35 circulations then: 94 ℃ of 30s, 58 ℃ of 90s, 72 ℃ of 90s; 72 ℃ are extended 10min after the loop ends.
Embodiment 4DHPLC detects
The PCR product is placed on the automatic sampling platform of DHPLC; Open DHPLC control software Navigator, in detection method, select Multiplex, i.e. multi-disc piecewise analysis, setting upper limit of detection simultaneously is 600bp, is limited to 70bp down; Move two blank, i.e. empty needle, balance chromatographic column; Move a marker, be used for reference to contrast, the nucleic acid fragment size of test sample; Successively sample to be tested is analyzed, partial results is seen Fig. 1.The DNA marker that the application adopts is SSR (pUC18/MspI) DNA Marker, can obtain by commercially available purchase.
From top to bottom curve among Fig. 1, article one, the DHPLC analytic curve that carries out for DNA marke of curve, second curve to second from the bottom curve is the non-transgenic paddy rice in regular turn, transgenic paddy rice Bt63 strain, Kemingdao 1, rich No. 6 of transgenic paddy rice section, the Cry1C strain, the KF8 strain, MON88017, Bt176, MON863, RRS, soybean A2704-12, the non-transgenic rape, the non-transgenic cotton, the DNA of potato EH92-527-1 and pawpaw carries out respectively carrying out the curve that DHPLC analyzes behind the pcr amplification, and the last item curve is to adopt water to carry out the curve that DHPLC analyzes as blank.
The result judges: observe the elution peak that DHPLC obtains, by analyzing the dna fragmentation size of determining the elution peak position automatically with marker comparison and WAVE4500, judge accordingly.
Be that the pcr amplification product of template is that the DHPLC of sample analyzes to the DNA with transgenic paddy rice CRY1C strain, its analytical results shows that this sample contains the elution peak of 285bp; Be that the pcr amplification product of template is that the DHPLC of sample analyzes and all do not have elution peak with the DNA of other sample.As seen, the primer that this example provides has good specificity, can be from plurality of samples the specific transgenic paddy rice CRY1C strain that detects in the transgenic paddy rice of other strains particularly.
Above content be in conjunction with concrete embodiment to further describing that the application does, can not assert that the application's concrete enforcement is confined to these explanations.For the application person of an ordinary skill in the technical field, under the prerequisite that does not break away from the application's design, can also make some simple deduction or replace, all should be considered as belonging to the application's protection domain.
Claims (3)
1. primer that the PCR-DHPLC that is used for transgenic paddy rice Cry1C strain detects, it is characterized in that: described primer comprises upstream primer and downstream primer, described upstream primer contains sequence shown in the Seq ID No.1, and described downstream primer contains sequence shown in the Seq ID No.2;
Seq?ID?No.1:5’-CCAATCATGGAGCAACAAACC-3’
Seq?ID?No.2:5’-TGACCCTCGAGTTTCTCCATAAT-3’。
2. the PCR-DHPLC detection method of a transgenic paddy rice CRY1C strain, it is characterized in that: described detection method comprises the described primer of employing claim 1, DNA with detected sample is that template is carried out pcr amplification, and the product of pcr amplification is carried out dhplc analysis.
3. detection method according to claim 2, it is characterized in that: it is that reference standard is carried out dhplc analysis that described detection method also comprises with DNA marker, and the dhplc analysis result of pcr amplification product and the dhplc analysis result of DNA marker are compared.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2013102228501A CN103343163A (en) | 2013-06-06 | 2013-06-06 | PCR-DHPLC detection primer and detection method for transgenic rice line CRY1C |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2013102228501A CN103343163A (en) | 2013-06-06 | 2013-06-06 | PCR-DHPLC detection primer and detection method for transgenic rice line CRY1C |
Publications (1)
Publication Number | Publication Date |
---|---|
CN103343163A true CN103343163A (en) | 2013-10-09 |
Family
ID=49277988
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN2013102228501A Pending CN103343163A (en) | 2013-06-06 | 2013-06-06 | PCR-DHPLC detection primer and detection method for transgenic rice line CRY1C |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103343163A (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN109971881A (en) * | 2019-04-11 | 2019-07-05 | 武汉大学 | A kind of primer pair and method for identifying multivalence transgenic pest-resistant rice genotype |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101974618A (en) * | 2010-07-26 | 2011-02-16 | 中国农业科学院植物保护研究所 | Transformant specific polymerase chain reaction (PCR) detection method for transgenic rice strain T1c-19 with cry1C gene |
CN102094038A (en) * | 2010-12-08 | 2011-06-15 | 上海市农业科学院 | Prokaryotic expression and purification method of transgenic rice Bt protein crylc |
CN102952856A (en) * | 2011-08-26 | 2013-03-06 | 深圳出入境检验检疫局动植物检验检疫技术中心 | PCR-DHPLC detection primers for transgenic rice line Kefeng 6 and detection method |
-
2013
- 2013-06-06 CN CN2013102228501A patent/CN103343163A/en active Pending
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101974618A (en) * | 2010-07-26 | 2011-02-16 | 中国农业科学院植物保护研究所 | Transformant specific polymerase chain reaction (PCR) detection method for transgenic rice strain T1c-19 with cry1C gene |
CN102094038A (en) * | 2010-12-08 | 2011-06-15 | 上海市农业科学院 | Prokaryotic expression and purification method of transgenic rice Bt protein crylc |
CN102952856A (en) * | 2011-08-26 | 2013-03-06 | 深圳出入境检验检疫局动植物检验检疫技术中心 | PCR-DHPLC detection primers for transgenic rice line Kefeng 6 and detection method |
Non-Patent Citations (1)
Title |
---|
白月等: "应用多重PCR-DHPLC方法快速检测转基因马铃薯及EH92-527-1品系鉴定", 《中国马铃薯》 * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN109971881A (en) * | 2019-04-11 | 2019-07-05 | 武汉大学 | A kind of primer pair and method for identifying multivalence transgenic pest-resistant rice genotype |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN101240278B (en) | Side sequence of exogenous insert of transgene paddy strain Kemingdao 1 | |
WO2020206828A1 (en) | Alternariol aptamer affinity column and preparation method and application therefor | |
CN104017859A (en) | Method for identifying sugarcane germplasm resources based on SSR (Simple Sequence Repeats) and CE (capillary electrophoresis) technique | |
CN103290099A (en) | Quick molecular detection kit for colletotrichum kahawae and application thereof | |
CN102154266A (en) | Chicken heat resistance-associated molecular marker and identification method and use thereof | |
CN103468790B (en) | Primers used for detecting polymorphism of saccharum arundinaceum, and detection method and applications | |
CN103173548A (en) | PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) assay primer and assay method for transgenic rapeseed RF2 strain | |
CN102952856B (en) | PCR-DHPLC detection primers for transgenic rice line Kefeng 6 and detection method | |
CN103343163A (en) | PCR-DHPLC detection primer and detection method for transgenic rice line CRY1C | |
CN103333957A (en) | Assay primer and assay method of PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) of transgenic rice KF8 strain | |
CN103333956A (en) | Assay primer and assay method of PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) of rice endogenous gene gos9 | |
CN103695533B (en) | One grows cotton main pathogen fungi ITS-RFLP rapid identification method | |
CN102952858B (en) | PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) detection primer and detection method for genetically modified rice strain KMD | |
CN103173550A (en) | PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) assay primer and assay method for transgenic rapeseed RT73 strain | |
CN104946638B (en) | The multiple DPO PCR detection kits of a kind of Controlling White Blister Disease bacterium and black stem bacterium and its application | |
CN101974618B (en) | Transformant specific polymerase chain reaction (PCR) detection method for transgenic rice strain T1c-19 with cry1C gene | |
CN103343162A (en) | PCR-DHPLC detection primers and detection method for maize ubiquitin protein promoter gene | |
CN103173551A (en) | PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) assay primer and assay method for transgenic rapeseed MS1 strain | |
CN102952861B (en) | Multiplex PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) detection primer and detection method for genetically modified maize | |
CN101792814A (en) | PCR method for detecting specificity of transformant of transgenic pest-resistant cotton GK12 | |
Kamangu | Comparison of the quality of the DNA extracted from different media at the laboratory of molecular biology of the faculty of medicine of UNIKIN | |
CN103173549A (en) | PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) assay primer and assay method for transgenic rapeseed RF1 strain | |
CN102952863B (en) | Multiplex PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) detection primer and detection method for genetically modified cotton | |
CN102952859A (en) | PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) detection primer and detection method for genetically modified maize strain CBH351 | |
CN102952862B (en) | PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) detection primer and detection method for genetically modified maize strain MON89034 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C12 | Rejection of a patent application after its publication | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20131009 |