CN103173550A - PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) assay primer and assay method for transgenic rapeseed RT73 strain - Google Patents
PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) assay primer and assay method for transgenic rapeseed RT73 strain Download PDFInfo
- Publication number
- CN103173550A CN103173550A CN2013100793850A CN201310079385A CN103173550A CN 103173550 A CN103173550 A CN 103173550A CN 2013100793850 A CN2013100793850 A CN 2013100793850A CN 201310079385 A CN201310079385 A CN 201310079385A CN 103173550 A CN103173550 A CN 103173550A
- Authority
- CN
- China
- Prior art keywords
- strain
- dhplc
- pcr
- primer
- transgenic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention discloses a PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) assay primer and assay method of transgenic rapeseed RT73 strain. The primer is strong in specificity, and can be used in PCR and used for specifically amplifying a DNA (deoxyribonucleic acid) fragment of the transgenic rapeseed RT73 strain, and the amplified product can be applied to subsequent DHPLC analysis. The assay method provides an assay method for the transgenic rapeseed RF2 strain, which is convenient to operate, good in extension performance and strong in specificity. The PCR amplified product is analyzed by utilizing the DHPLC, the resolution of the fragment of the PCR amplified can be a plurality of basic groups, and the resolution rate is high. The primer and assay method provided by the invention provide a simple, convenient, effective and reliable assay method to assay of the transgenic rapeseed RT73 strain, and are particularly applicable to port inspection and quarantine and other departments.
Description
Technical field
The application relates to the detection of transgenic product, and the PCR-DHPLC that particularly relates to a kind of transgene rape RT73 strain detects primer and detection method.
Background technology
At present the detection method of transgene rape mainly adopted conventional PCR, the detection methods such as real-time fluorescence PCR, PCR-gene chip.Traditional conventional PCR detection method has certain limitation aspect platform extension, along with the increase of target to be checked, need to re-start optimization to consumption and the ratio of the every cover primer in system, and takes into account the factors such as amplification efficiency, and workload is larger; On the other hand, the method for the gel electrophoresis analysis amplified production that usually adopts is distinguished efficient not high, and detected result is undesirable.More multiple conventional PCR detection method has superiority although real-time fluorescence PCR is at aspects such as detection sensitivities, but the restriction due to instrument self and fluorescence dye development at present, non-interfering 4 fluorescence channels only can be provided simultaneously, also limited this technology and detected the flux expansion, and testing cost is high.Conventional many cover PCR-gene chip detection methods need many cover primers to increase, complex operation step, and be not suitable for large-scale high throughput testing.Sex change high-efficient liquid phase chromatogram technology (Denaturing High-performance Liquid Chromatography, DHPLC) is a kind of method for nucleic acid analysis of simple, quick, non-gel, has the advantages such as good resolution, extendability is strong, sensitivity is high.The method is at 50 ℃ of condition analysis samples, and the wash-out at sample peak only determines by the quantity of base pair, and the base pair different amts elution order of sample is also different, thereby produces different sample peaks.Concrete, the acetonitrile concentration that has served as post improves, and nucleic acid fragment can be according to molecular weight order from small to large by wash-out out.Relatively determine molecular size range by elution peak and the DNA marker that obtains, thereby judge in sample whether contain the target detect gene.PCR-DHPLC is the technology that PCR is combined with DHPLC, namely first adopts pcr amplification to go out target sequence, and then amplified production is carried out DHPLC analyze, thereby improves sensitivity and the specificity that detects.At present, the detection method that still there is no the PCR-DHPLC of transgene rape RT73 strain.
Summary of the invention
The application's purpose is to provide the primer that a kind of new PCR-DHPLC that is used for transgene rape RT73 strain detects, based on the PCR-DHPLC detection method of the transgene rape RT73 strain of this primer.
For achieving the above object, the application has adopted following technical scheme:
The application discloses the primer that a kind of PCR-DHPLC for transgene rape RT73 strain detects, and the upstream primer of this primer contains sequence shown in Seq ID No.1, and downstream primer contains sequence shown in Seq ID No.2;
Seq?ID?No.1：5’-TCATTTTATAATAACGCTGCGGA-3’
Seq?ID?No.2：5’-TTCAGCAAGATTCTCTGTCAACAAT-3’。
Need to prove, the application's primer is the Auele Specific Primer that designs for transgene rape RT73 strain, can carry out specific amplification to transgene rape RT73 strain, therefore, be appreciated that this primer except the PCR-DHPLC that is used for the application detects, be equally applicable to conventional PCR and detect, and the detection of other PCR-based amplification, as real-time fluorescent PCR, gene chip etc.
The application's another side also discloses a kind of PCR-DHPLC detection method of transgene rape RT73 strain, this detection method comprises the primer that adopts the application's design, carry out pcr amplification take the DNA of detected sample as template, the product of pcr amplification is carried out dhplc analysis.
Need to prove, the primer of the application's design is the Auele Specific Primer for transgene rape RT73 strain, therefore, be appreciated that, if contain the transgene rape RT73 product set member of capacity in detected sample, can amplify corresponding target fragment, and produce corresponding elution peak when DHPLC analyzes.
Further, the application's detection method also comprises carries out dhplc analysis take DNA marker as reference standard, the dhplc analysis result of pcr amplification product and the dhplc analysis result of DNA marker are compared.
Preferred the application's detection method comprises the steps:
(A) adopt the application's primer, take the DNA of detected sample as template, carry out pcr amplification;
(B) analyze as sample carries out DHPLC take the pcr amplification product of step (A), carry out DHPLC simultaneously take DNAmarker as reference standard and analyze;
(C) the DHPLC analytical results of pcr amplification product in step (B) and the DHPLC analytical results of DNA marker are compared, determine the molecular size range of pcr amplification product, thereby judge whether to contain the target sequence of detection.
Need to prove, in theory, the application's primer is according to the Auele Specific Primer of transgene rape RT73 strain design, can amplify the approximately fragment of 215bp to the transgene rape RT73 product set member in detected sample, therefore, can analyze by DHPLC the elution peak of 215bp; And other composition is not had amplification, namely do not have other elution peak and occur.In the application, judge whether to contain transgene rape RT73 strain target sequence foundation namely, whether the elution peak of 215bp is arranged.
Owing to adopting above technical scheme, the application's beneficial effect is:
The application's transgene rape RT73 strain detects primer and has stronger specificity, can be used in follow-up multiplex PCR amplification and DHPLC and analyzes.The application combines PCR for traditional undesirable problem of electrophoretic analysis pcr amplification result with DHPLC, a kind of easy and simple to handle, scalability good, resolving power is high transgene rape RT73 strain detection method is provided.Utilize DHPLC that pcr amplification product is analyzed, can reach several bases to different big or small PCR product fragment differentiation rates, even can distinguish the fragment of 1 base difference in size.The application's primer and detection method are particularly suitable for department's uses such as Check and Examination of Port quarantine for the detection of transgene rape RT73 strain provides a kind of simple, convenient, effective, reliable detection method.
Description of drawings
Fig. 1: the partial results figure that is the DHPLC analysis of pcr amplification product in the embodiment of the present application;
Fig. 2: the partial results figure that is the DHPLC analysis of pcr amplification product in the embodiment of the present application;
Fig. 3: the partial results figure that is the DHPLC analysis of pcr amplification product in the embodiment of the present application;
in Fig. 1, top-down curve represents that respectively M is DNA marker, W is that water is blank, a1 is transgene rape strain MS1, b1 is transgene rape strain RF1, c1 is transgene rape strain RF2, d1 is transgene rape strain RF3, e1 is transgene rape strain RT73, f1 is transgene rape strain MS8, g1 is transgene rape strain T45, h1 is transgene rape strain Topas19/2, i1 is the non-transgenic rape, j1 is transgenic corns strain 3272, k1 is transgenic corns strain 59122, and in Fig. 2, top-down curve represents that respectively a2 is transgenic corns strain Bt11, b2 is transgenic corns strain Bt176, c2 is transgenic corns strain GA21, d2 is transgenic corns strain MIR604, e2 is transgenic corns strain MON810, f2 is transgenic corns strain MON863, g2 is transgenic corns strain MON88017, h2 is transgenic corns strain MON89034, i2 is transgenic corns strain NK603, j2 is transgenic corns strain TC1507, k2 is transgenic corns strain T25, L2 is the non-transgenic corn, m2 is the non-transgenic corn, n2 is genetically engineered soybean strain A2704-12, and in Fig. 3, top-down curve represents that respectively a3 is genetically engineered soybean strain A5547-127, b3 is genetically engineered soybean strain GTS 40-3-2-3-2, c3 is genetically engineered soybean strain MON89788, d3 is the non-transgenic soybean, e3 is the blind sample of soybean, f3 is transgene cotton strain GHB614, g3 is transgene cotton strain LLCotton25, h3 is the non-transgenic cotton, i3 is transgenic paddy rice strain LL Rice62, j3 is the non-transgenic paddy rice, k3 is transgenic Rhizoma Solani tuber osi strain EH92-527-1, L3 is pawpaw.Each peak value of marker is followed successively by 80bp, 102bp, 174bp, 257bp, 267bp, 296bp, 434bp, 458bp, 587bp from left to right.
Embodiment
The application provides the primer of the PCR-DHPLC detection that is used for transgene rape RT73 strain, and this primer designs for the distinguished sequence of transgene rape RT73 strain, and the specific amplification that can be used in transgene rape RT73 strain detects.The application also provides the PCR-DHPLC detection method based on the transgene rape RT73 strain of the application's primer on this basis.
Need to prove, the application's primer is to detect and design for the PCR-DHPLC of transgene rape RT73 strain, but, be appreciated that, itself also uses this primer as pcr amplification, the pcr amplification that therefore, can increase, be combined with gene chip for pcr amplification, the real-time fluorescence PCR of routine equally etc.
Also by reference to the accompanying drawings the application is described in further detail below by concrete experimental example.Following experimental example only is further detailed the application, should not be construed as the restriction to the application.
Embodiment 1DNA extracts
(1) DNA extraction: the method that provides with reference to plant genome DNA extraction test kit (QIAGEN, Cat.No.69104) slightly makes improvements extraction DNA, and concrete operation step is as follows:
1. the AP1 solution of 65 ℃ of preheatings and Buffer AE;
2. the liquid nitrogen grinding sample is after Powdered, gets in the centrifuge tube that appropriate sample enters 1.5mL;
3. add the AP1 solution of 400 μ L preheatings and the RNA enzyme of 4 μ L100mg/mL in centrifuge tube, fully after mixing, 65 ℃ of water-bath 10min-15min, during vibration mixing 2-3 time;
4. after water-bath is completed, directly add 130 μ L AP2 solution, ice bath 5min after the mixing that fully vibrates can not shake during ice bath, the centrifugal 5min of 14000r/min;
5. draw supernatant and join in QIA shredder Mini spin column pillar, be i.e. purple pillar in test kit, the centrifugal 2min of 14000rpm/min, the volume number of the supernatant liquor that record is drawn;
6. abandon top pillar, add the Buffer AP3/E solution of 1.5 times of volumes in the solution after filter, with liquid-transfering gun mixing gently;
7. get the solution of 650 μ L steps mixing 6. at every turn and transfer in DNeasy Mini spin column pillar, namely in test kit white pillar, the centrifugal 1min of 14000rpm/min abandons filtrate, until the solution of step mixing has 6. filtered fully; Need to prove, the volume that when filtering, DNeasy Mini spin column post can hold is about 650 μ L, and therefore step solution 6. is generally all greater than 650 μ L,, 650 μ L solution can only be got at every turn, remaining solution could be added again after filtering, abandon filtrate;
8. abandon following collection tube, spin column post is put into a new 2mL collection tube, add 500 μ L Buffer AW solution, the centrifugal 1min wash-out of 14000rpm/min impurity, repeat the operation of wash-out impurity once, abandon filtrate, the centrifugal 1min of 12000rpm/min blank pipe;
9. abandon following collection tube, change a new 1.5mL centrifuge tube, add the Buffer AE dissolving DNA after 100 μ L preheatings, the standing 5min precipitation of room temperature DNA, the centrifugal 1min of 12000rpm/min, the solution of collection is DNA solution; Need to prove that the Buffer AE after 100 μ L preheatings can add at twice or repeatedly;
10. abandon top pillar, preserve DNA solution for-20 ℃.
(2) DNA purifying: when the amount that contains the impurity such as protein in DNA was higher, its purity can not satisfy requirement of experiment, need to carry out purifying to it, and concrete purification step is as follows:
1. after the DNA solution that extracts being diluted to 500 μ L-700 μ L, add isopyknic phenol and chloroform, fully mixing;
2. the centrifugal 10min of 14000rpm/min, get supernatant liquor;
3. add the Virahol of 0.6 times of volume in supernatant liquor, more than-20 ℃ of standing 30min;
4. the centrifugal 10min of 14000rpm/min under 4 ℃ of conditions, abandon supernatant;
5. abandon 70% the ethanol that adds 1mL4 ℃ of precooling in the precipitation of supernatant liquor in 4. to step, the centrifugal 10min of 14000rpm/min abandons supernatant, and repetitive operation once;
6. will be air-dry through being deposited under aseptic condition of step washing with alcohol 5., add appropriate AE Buffer dissolving DNA, namely obtain the higher DNA solution of purity.Need to prove, the add-on of AE Buffer is decided according to concrete requirement of experiment, if wish that the concentration of acquisition DNA solution is higher, the AE Buffer that can add small amount, as 10 μ L-50 μ L, also can directly add again 100 μ L Buffer AE, before DNA concentration and purifying quite, perhaps add the Buffer AE of volume more to obtain the DNA solution of low concentration.
Embodiment 2DNA concentration determination
The sample DNA that extracts is carried out concentration and purity testing; Adopt ultraviolet spectrophotometer to measure 260nm and 280nm place absorption value, calculate respectively purity and the concentration of nucleic acid, calculation formula is as follows:
DNA purity=OD260/OD280
DNA concentration=50 * OD260mg/mL
The purity ratio of DNA is between 1.7～1.9, and concentration is greater than 10ng/ μ L.
Embodiment 3PCR amplification
according to the DNA sequence dna design primer (table 1) of transgene rape RT73 strain, and the DNA of the following sample of extraction carries out specific detection: transgene rape strain MS1, transgene rape strain RF1, transgene rape strain RF2, transgene rape strain RF3, transgene rape strain RT73, transgene rape strain MS8, transgene rape strain T45, transgene rape strain Topas19/2, the non-transgenic rape, transgenic corns strain 3272, transgenic corns strain 59122, transgenic corns strain Bt11, transgenic corns strain Bt176, transgenic corns strain GA21, transgenic corns strain MIR604, transgenic corns strain MON810, transgenic corns strain MON863, transgenic corns strain MON88017, transgenic corns strain MON89034, transgenic corns strain NK603, transgenic corns strain TC1507, transgenic corns strain T25, the non-transgenic corn, the non-transgenic corn, genetically engineered soybean strain A2704-12, genetically engineered soybean strain A5547-127, genetically engineered soybean strain GTS 40-3-2-3-2, genetically engineered soybean strain MON89788, the non-transgenic soybean, the blind sample of soybean, transgene cotton strain GHB614, transgene cotton strain LLCotton25, the non-transgenic cotton, transgenic paddy rice strain LL Rice62, the non-transgenic paddy rice, transgenic Rhizoma Solani tuber osi strain EH92-527-1, pawpaw.
The detection primer of table 1 transgene rape RT73 strain
| Title | Sequence 5 '-3 ' | Seq?ID?No. |
| RT73-F | TCATTTTATAATAACGCTGCGGA | 1 |
| RT73-R | TTCAGCAAGATTCTCTGTCAACAAT | 2 |
PCR reaction system cumulative volume is 50 μ L, each composition is respectively: PCR reaction solution 10 * Buffer5 μ L, 2.5mmol/L dNTP5 μ L, each 1 μ L of the upstream primer of 10 μ mol/L and downstream primer, 5U/ μ L Taqpolymerase0.3 μ L, DNA solution 1 μ L, then supplying with the sterilization distilled water is 50 μ L.
PCR reaction conditions: 94 ℃ of sex change 1min; Then enter 35 circulations: 94 ℃ of 30s, 58 ℃ of 90s, 72 ℃ of 90s; After loop ends, 72 ℃ are extended 10min.
Embodiment 4DHPLC detects
The PCR product is placed on the automatic sampling platform of DHPLC; Open DHPLC and control software Navigator, select Multiplex in detection method, i.e. multi-disc piecewise analysis, setting simultaneously upper limit of detection is 600bp, under be limited to 70bp; Move two blank, i.e. empty needle, balance chromatographic column; Move a marker, be used for reference to contrast, the nucleic acid fragment of test sample size; Successively sample to be tested is analyzed, partial results is seen Fig. 1-Fig. 3.The DNA marker that the application adopts is SSR (pUC18/MspI) DNA Marker, can obtain by commercially available purchase.
Need to prove that Fig. 1-Fig. 3 is the result of one-time detection, can not at the peak of a complete all samples of screen display figure, therefore be divided into three figure and show during due to DHPLC analyser Output rusults.from top to bottom curve in Fig. 1, article one, curve is that DNA marker carries out the curve that DHPLC analyzes, the second curve is for adopting water to carry out as blank the curve that DHPLC analyzes, down be respectively thus transgene rape strain MS1, transgene rape strain RF1, transgene rape strain RF2, transgene rape strain RF3, transgene rape strain RT73, transgene rape strain MS8, transgene rape strain T45, transgene rape strain Topas19/2, the non-transgenic rape, the DNA of transgenic corns strain 3272 and transgenic corns strain 59122 is the DHPLC analytic curve through carrying out after pcr amplification respectively.in Fig. 2, from top to bottom curve is respectively transgenic corns strain Bt11, transgenic corns strain Bt176, transgenic corns strain GA21, transgenic corns strain MIR604, transgenic corns strain MON810, transgenic corns strain MON863, transgenic corns strain MON88017, transgenic corns strain MON89034, transgenic corns strain NK603, transgenic corns strain TC1507, transgenic corns strain T25, first part of non-transgenic corn, the DNA of second part of non-transgenic corn and genetically engineered soybean strain A2704-12 is the DHPLC analytic curve through carrying out after pcr amplification respectively.The DNA that in Fig. 3, from top to bottom curve is respectively genetically engineered soybean strain A5547-127, genetically engineered soybean strain GTS 40-3-2-3-2, genetically engineered soybean strain MON89788, non-transgenic soybean, the blind sample of soybean, transgene cotton strain GHB614, transgene cotton strain LLCotton25, non-transgenic cotton, transgenic paddy rice strain LL Rice62, non-transgenic paddy rice, transgenic Rhizoma Solani tuber osi strain EH92-527-1 and pawpaw is the DHPLC analytic curve through carrying out after pcr amplification respectively.Wherein the blind sample of soybean is the sample of arbitrarily inspecting by random samples from non-transgenic soybean and genetically engineered soybean.
Result judgement: observe the elution peak that DHPLC obtains, by comparing with marker and the WAVE4500 automatic analysis is determined to judge the DNA fragmentation size of elution peak position accordingly.
DHPLC as sample analyzes to the pcr amplification product take the DNA of transgene rape strain RT73 as template, and its analytical results shows, this sample contains the elution peak of 215bp; Pcr amplification product take the DNA of other sample as template does not all have elution peak as the DHPLC of sample analyzes.As seen, the primer that this example provides has good specificity, can be from plurality of samples the specific transgene rape RT73 strain that detects.
Above content is the further description of the application being done in conjunction with concrete embodiment, can not assert that the application's concrete enforcement is confined to these explanations.For the application person of an ordinary skill in the technical field, under the prerequisite that does not break away from the application's design, can also make some simple deduction or replace, all should be considered as belonging to the application's protection domain.
Claims (3)
1. primer that the PCR-DHPLC that is used for transgene rape RT73 strain detects, it is characterized in that: described primer comprises upstream primer and downstream primer, described upstream primer contains sequence shown in Seq ID No.1, and described downstream primer contains sequence shown in Seq ID No.2;
Seq?ID?No.1：5’-TCATTTTATAATAACGCTGCGGA-3’
Seq?ID?No.2：5’-TTCAGCAAGATTCTCTGTCAACAAT-3’。
2. the PCR-DHPLC detection method of a transgene rape RT73 strain, it is characterized in that: described detection method comprises the primer that adopts in claim 1, carry out pcr amplification take the DNA of detected sample as template, the product of pcr amplification is carried out dhplc analysis.
3. detection method according to claim 2, it is characterized in that: described detection method also comprises carries out dhplc analysis take DNA marker as reference standard, the dhplc analysis result of pcr amplification product and the dhplc analysis result of DNA marker are compared.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2013100793850A CN103173550A (en) | 2013-03-13 | 2013-03-13 | PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) assay primer and assay method for transgenic rapeseed RT73 strain |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2013100793850A CN103173550A (en) | 2013-03-13 | 2013-03-13 | PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) assay primer and assay method for transgenic rapeseed RT73 strain |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103173550A true CN103173550A (en) | 2013-06-26 |
Family
ID=48633737
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2013100793850A Pending CN103173550A (en) | 2013-03-13 | 2013-03-13 | PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) assay primer and assay method for transgenic rapeseed RT73 strain |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103173550A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105586418A (en) * | 2016-01-29 | 2016-05-18 | 江汉大学 | Detection method of transgenic components in rapeseed oil |
| CN105624298A (en) * | 2016-01-29 | 2016-06-01 | 江汉大学 | Method for detecting genetically modified components of rape |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102212540A (en) * | 2011-03-31 | 2011-10-12 | 中华人民共和国上海出入境检验检疫局 | Standard molecule simultaneously suitable for specificity detection on seven transgene rape strains |
-
2013
- 2013-03-13 CN CN2013100793850A patent/CN103173550A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102212540A (en) * | 2011-03-31 | 2011-10-12 | 中华人民共和国上海出入境检验检疫局 | Standard molecule simultaneously suitable for specificity detection on seven transgene rape strains |
Non-Patent Citations (2)
| Title |
|---|
| 张舒亚等: "进境谷物中转基因油菜籽 RT73 的定性定量检测", 《检验检疫科学》, vol. 16, no. 1, 31 December 2006 (2006-12-31), pages 51 - 54 * |
| 白月等: "应用多重PCR-DHPLC方法快速检测转基因马铃薯及EH92-527-1品系鉴定", 《中国马铃薯》, vol. 25, no. 3, 25 June 2011 (2011-06-25), pages 129 - 134 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105586418A (en) * | 2016-01-29 | 2016-05-18 | 江汉大学 | Detection method of transgenic components in rapeseed oil |
| CN105624298A (en) * | 2016-01-29 | 2016-06-01 | 江汉大学 | Method for detecting genetically modified components of rape |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Onishi et al. | Development of a multiplex polymerase chain reaction method for simultaneous detection of eight events of genetically modified maize | |
| CN103173548A (en) | PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) assay primer and assay method for transgenic rapeseed RF2 strain | |
| CN103173550A (en) | PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) assay primer and assay method for transgenic rapeseed RT73 strain | |
| CN102952856B (en) | PCR-DHPLC detection primers for transgenic rice line Kefeng 6 and detection method | |
| CN103173551A (en) | PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) assay primer and assay method for transgenic rapeseed MS1 strain | |
| CN103966208A (en) | Transgenic rice PA110-15 foreign insert flanking sequence and application | |
| CN105177172A (en) | Transgenic maize T4-1-1 strain specific detection method and reagent kit | |
| CN102888398A (en) | Flanking sequence of exogenous insertion fragment of transgenic rice variety Bar68-1 and application thereof | |
| CN102952858B (en) | PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) detection primer and detection method for genetically modified rice strain KMD | |
| CN103173549A (en) | PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) assay primer and assay method for transgenic rapeseed RF1 strain | |
| CN102660777A (en) | Method for constructing suppression subtractive hybridization (SSH) library of oryza rufipogon threatened by bacterial blight germs | |
| CN102952861B (en) | Multiplex PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) detection primer and detection method for genetically modified maize | |
| CN105087550A (en) | Method for rapid and high-flux extraction of plant genome DNA and application of plant genome DNA | |
| CN102952862B (en) | PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) detection primer and detection method for genetically modified maize strain MON89034 | |
| CN103343163A (en) | PCR-DHPLC detection primer and detection method for transgenic rice line CRY1C | |
| CN103333957A (en) | Assay primer and assay method of PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) of transgenic rice KF8 strain | |
| CN102952860B (en) | PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) detection primer and detection method for genetically modified maize strain BT11 | |
| CN102952864B (en) | PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) detection primer and detection method for genetically modified maize strain BT176 | |
| CN102952859A (en) | PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) detection primer and detection method for genetically modified maize strain CBH351 | |
| CN102952863B (en) | Multiplex PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) detection primer and detection method for genetically modified cotton | |
| CN103333956A (en) | Assay primer and assay method of PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) of rice endogenous gene gos9 | |
| CN101792814B (en) | PCR method for detecting specificity of transformant of transgenic pest-resistant cotton GK12 | |
| CN104404161A (en) | Transgenic maize multiple PCR screening detection primer and detection method | |
| CN103834646A (en) | PCR (Polymerase Chain Reaction) detection primer and qualitative detection method and kit for specificity of transgenic rice PA110-15 strain | |
| CN103343162A (en) | PCR-DHPLC detection primers and detection method for maize ubiquitin protein promoter gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20130626 |