CN103308690B - Biosensor construction and detection method based on molecular motor, magnetic enrichment and double-probe hybridization - Google Patents
Biosensor construction and detection method based on molecular motor, magnetic enrichment and double-probe hybridization Download PDFInfo
- Publication number
- CN103308690B CN103308690B CN201310186289.6A CN201310186289A CN103308690B CN 103308690 B CN103308690 B CN 103308690B CN 201310186289 A CN201310186289 A CN 201310186289A CN 103308690 B CN103308690 B CN 103308690B
- Authority
- CN
- China
- Prior art keywords
- probe
- magnetic bead
- atp
- capture probe
- biomacromolecule
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Abstract
The invention relates to a detection method of biomacromolecule, and in particular relates to a method for detecting the biomacromolecule by utilizing the signal amplification characteristic of the ATP molecular motor in terms of time and space and high temperature resistance thereof, high specificity of double-antibody hybridization and double-probe hybridization, high flexibility and fastness of magnetic enrichment and magnetic separation, and the high flexibility of the chemiluminiscence detection technology, and reduction of the non-specific hybridization by the single-stranded nuclease degradation and mismatched double-strand. A novel biosensor construction and detection method is capable of separating the signal molecule from the reaction system, storing the signal molecule to measure for multiple times and facilitating the comparison of the samples in different batches, and according to the method, the super-flexibility, fastness, high specificity and avoidance of amplification can be realized.
Description
Technical field
The present invention relates to the detection method of a kind of biomacromolecule.Particularly relate to utilize ATP molecular motor, two Probe Hybridization, magnetic enrichment and be separated and chemiluminescence detection technology high sensitivity detect the method for biomacromolecule.
Background technology
Biology sensor utilizes biological key element and physical chemistry to detect together with factor combination the device that analyte detects.Double antibody sandwich method is the one of the large molecular detecting method of traditional biological, and its ultimate principle utilizes the specific probe (antibody or nucleic acid) that can identify the different epi-position of same a part for a pair, detected by different signal output systems.For the large Molecular Detection of protide, conventional method is the enzyme-linked immunosorbent assay combined based on antigen-antibody, (comprises DNA for the large molecule of nucleic acid, RNA, microRNA etc.), conventional northern blot, southern blot, the technology such as PCR.Conventional signal output system comprises the state of aggregation etc. of fluorescence, chemiluminescence, isotope and molecule.Also have some new detection methods, as relied on quantum dot, nanogold particle detects as detection signal.But these signal output systems are momentary signal and export, signaling molecule cannot be separated with reaction system, and detection signal must detect after reacting immediately, cannot to code book carry out repeated detection, therefore its detection sensitivity is restricted, and is unfavorable for the comparison between different time sample.
Summary of the invention
In order to improve the sensitivity of the biomacromolecule detection such as protein, nucleic acid, specificity and shortening detection time, avoid nucleic acid amplification, reduce false positive rate, reduce testing cost, realize high flux to detect, the invention provides a kind of can the spatially biomacromolecule detection method of upper amplification detection signal with the time.Molecular motor combines with magnetic separation technique and two Probe Hybridization technology by the method, detects, not only can detect the target biological molecules of trace fast, can also distinguish the nucleic acid molecules of target molecule and foreign protein or simple point mutation in liquid phase environment.And quantitative test can be carried out to molecules of interest within the specific limits, improve the sensitivity of detection, specificity, and be convenient to carry out high flux detection.
The present invention devises two specific probes for target molecule.For antigen, probe is the specific antibody for the different epi-position of same antigen; For DNA molecular, probe is hold with 5 ' of sense strand sequence and 3 ' a pair nucleic acid probe holding difference complementary; For RNA sequence, probe is hold with RNA sequence 5 ' and 3 ' a pair nucleic acid probe holding difference complementary.One of them probe is connected on magnetic bead as capture probe, another probe is connected on ATP molecular motor as detector probe, hybridized by the hybridization conditions optimized, the magnetic bead being combined with molecular motor is separated with unconjugated free molecule motor by magnetic separation technique, through at high temperature carrying out ATP synthetic reaction, the ATP of synthesis is separated with reaction system through Magneto separate, ATP now as signaling molecule can packing frozen in-80 DEG C of preservations, the suitable time is selected to measure, also the existence of target molecule directly can be reflected by the concentration of luciferin/luciferase systems axiol-ogy ATP.If there is target molecule, then have molecular motor activity and exist, amplify through signal magnetic enrichment spatially and temporal synthesis ATP signal, the target molecule of low concentration can be detected.For nucleic acid, avoid the operating process of false positive and the complexity increasing and bring and expensive instrument and equipment.ATP molecule and reaction system separable and can preserving, makes the detection signal of same sample can detect at different time, and the sample detection signal of different batches can be carried out measure the comparison be beneficial between sample simultaneously.The present invention will be connected with the magnetic microsphere of capture probe and be connected with the ATP molecular motor of detector probe as sensitive biological element acquisition target molecule, ATP molecular motor and luciferin/luciferase system are as transducing head, convert concentration of target molecules signal to ATP molecular conecentration signal and chemiluminescence signal, react concentration of target molecules finally by chemiluminescence light intensity as detection signal.The present invention is spatially by the basis of secondary transducing (concentration of target molecules-ATP concentration-chemiluminescence intensity) amplification detection signal, add accumulated time enlarge-effect (the ATP synthetic reaction that same concentrations target molecule produces, extend synthesis ATP concentration in time to increase), and by the high specific of two probe, reduce the interference of non-specific molecule.Achieved by magnetic separation technique and signaling molecule is separated with reaction system, the signal Simultaneously test of the signal of same sample at different time gradation mensuration and different sample is compared.
More specifically, the invention provides the following:
1. detect a method for biomacromolecule, said method comprising the steps of:
A. capture probe is connected with magnetic bead;
B. detector probe is connected with ATP molecular motor;
C. by the magnetic bead being connected with capture probe obtained by step a and the ATP molecular motor being connected with detector probe obtained by step b and biological sample bulk crossing to be measured;
D. after step c, Magneto separate is carried out to magnetic bead, the magnetic bead of separation is joined in the reaction mixture containing ADP and carry out ATP synthetic reaction; And
E., after ATP synthetic reaction terminates, get and on Chemiluminescence Apparatus, do not carry out reading containing the reaction supernatant of magnetic bead;
Wherein said capture probe and described detector probe respectively with the different parts specific binding of detected biomacromolecule.
2. the method according to the 1st, wherein said biomacromolecule is protein, and described capture probe and described detector probe are the specific antibody of two different epi-positions for described protein respectively.
3. the method according to the 2nd, wherein said protein is c reactive protein (CRP), and described capture probe and described detector probe are monoclonal antibody M86842M and the M86284M of CRP respectively.
4. the method according to the 1st, wherein said biomacromolecule is DNA, and described capture probe and described detector probe are hold with 5 ' of described DNA sense strand sequence and 3 ' a pair nucleic acid molecules holding difference complementary respectively.
5. the method according to the 1st, wherein said biomacromolecule is RNA, and described capture probe and described detector probe are hold with 5 ' of described RNA sequence and 3 ' a pair nucleic acid molecules holding difference complementary respectively.
6. the method according to any one of 1-5 item, wherein in described step a, described capture probe is marked with biotin, and described magnetic bead is coated with streptavidin, and described capture probe and described magnetic bead are linked together by the interaction of biotin and streptavidin.
7. the method according to any one of 1-5 item, wherein in described step b, described detector probe is marked with biotin, described ATP molecular motor is marked with NeutrAvidin-PE-cap-biotin, and described detector probe and described ATP molecular motor are linked together by biotin-NeutrAvidin-biotin system.
8. the method according to any one of 1-5 item, wherein in described steps d, described ATP synthetic reaction is carried out at 42 DEG C.
9. the method according to any one of the 2nd or the 3rd, wherein in described step c, before carrying out bulk crossing, carries out Seal treatment to the described magnetic bead being connected with capture probe obtained by step a.
10. the method according to any one of the 2nd or the 3rd, wherein in described step c, described hybridization is carried out at 37 DEG C.
11. methods according to any one of the 4th or the 5th, wherein in described step c, described hybridization is carried out at 25-45 DEG C.
12. 1 kinds for detecting the kit of biomacromolecule, described kit comprises:
Capture probe;
Magnetic bead;
Detector probe;
ATP molecular motor; With
Reaction mixture containing ADP;
Wherein said capture probe and described detector probe respectively with the different parts specific binding of detected biomacromolecule.
Below in conjunction with specific embodiment, the invention will be further described.
Accompanying drawing explanation
Fig. 1. based on the schematic diagram of the biomacromolecule detection method of molecular motor, Magneto separate and two Probe Hybridization technology, wherein mark magnetic bead with capture probe, with detector probe labeled molecule motor, different according to the type detecting target molecule, antigen is detected, probe can be the antagonist for the different epi-position of same antigen, and for detection of nucleic acids, probe can be a pair oligonucleotide probe for same sequence diverse location.
Fig. 2. carry out antigen detection for c reactive protein (CRP): in 33fg/ml to 3.3ug/ml scope, concentration and the fluorescent value of the CRP of sample have linear relationship.
Fig. 3. the magnetic bead that variable concentrations CRP mediates assembles electron microscopic observation.
Fig. 4. the detection of tiny RNA is carried out for miR141, with synthesis microRNA141 sequence (miR141) be standard sequence, be diluted to variable concentrations, be respectively 0,1nM, 5nM, 10nM, 20nM, 40nM, according to nucleic acid detection method of the present invention, it is detected, the nucleic acid concentration of result show sample and fluorescent value good in 1-40nM scope internal linear relation.
Fig. 5. compare the specific detection of miR141 and its Point mutont.
Embodiment
Term " ATP molecular motor " when for refer to time herein derive from Thermophilic Bacteria containing the chromatophore of atp synthase.Atp synthase (ATP synthase) is distributed widely on the plasma membrane of mitochondrial inner membrane, chloroplast thylakoids, heterotroph and photosynthetic bacteria, participates in oxidative phosphorylation and photophosphorylation, under the promotion of cross-film PMF, synthesizes ATP.Molecular structure is made up of the F1 hydrophilic head protruded from outside film and the Fo hydrophobic tail embedded in film.The photosynthesis of photosynthetic bacteria carries out at the intercellular membrane containing photosynthetic pigments.This inner membrance is little blister or sachet shape, is distributed in cell peripheral, is called chromatophore.
The micron of the derivant bag quilt that the magnetic bead that the present invention uses is through Streptavidin (streptavidin) or has equivalent action is connected to the tri-iron tetroxide paramagnetic beads of nanoscale with biotinylated probe, but be not limited only to this standard, the method by intermolecular interaction or chemical coupling mode probe being connected to magnetic bead surfaces is all suitable for the present invention.Magnetic bead surfaces electric charge can have an impact to the detection of different molecular, and bead diameter size can affect magnetic bead surfaces and amass, thus affects the binding ability of unit mass magnetic bead.
The conventional method of embodiment 1, detection biomacromolecule
Prepared by 1.ATP molecular motor:
Thermophilic Bacteria Thermomicrobium roseum bacterial classification (ATCC27502 is purchased from U.S.'s ATCC species storehouse) is inoculated in fluid nutrient medium (see table 1) in proportion at 1: 100,60 DEG C, 150rpm cultivates 24h.Then 4000rpm, 30min, 4 DEG C of collected by centrifugation thalline.With Extraction buffer (20mM Tris-ClpH8.0,100mM NaCl, 2mM MgCl
2, 1mM DTT) and resuspended thalline, centrifugally removes supernatant (6000rpm, 10min, 4 DEG C).Add the resuspended thalline of Extraction buffer (about 1g thalline adds 10ml damping fluid), then add the PMSF that final concentration is 1mM, on ice ultrasonication 30min (ultrasonic 5s, stops 8s, power 300W).By centrifugal for broken thalline (25,000g, 30min, 4 DEG C), precipitation is gone to get supernatant.By supernatant ultracentrifugation (145,000g, 1h, 4 DEG C), get precipitation be chromatophore (Chromatophore) (its be bacterium Plasmalemma invagination formed the vesica that turns up, containing atp synthase on chromatophore film, be the important tool of research Proton Transport character and ATP synthesis and hydrolysis).Finally obtain chromatophore solution by the resuspended precipitation of Extraction buffer, if do not used immediately, add glycerine-80 DEG C preservation of final concentration 50%.
Table 1.Thermobacterium nutrient culture media
| Yeast extract | 1g |
| Tryptone | 1g |
| (NH4) 2SO 4 | 1.3g |
| MgSO 4·7H 2O | 0.247g |
| KH 2PO 4 | 0.28g |
| CaCl 2·2H 2O | 0.074g |
| FeCl 3·6H 2O | 0.019g |
| Salt solusion * | 1ml |
| Agar | 20g (adding when preparing solid medium) |
| Distilled water | 1L |
Note: nutrient culture media prepares rear NaOH and regulates pH=8.5,120 DEG C of sterilizing 20min
*: the compound method of salt solusion: add 1.8g MnCl in 1L distilled water
24H
2o, 4.4gNa
2b
4o
710H
2o, 0.22g ZnSO
47H
2o, 0.05g CuCl
2h
2o, 0.03g Na
2moO
42H
2o, 0.03g VOSO
42H
2o, uses H afterwards
2sO
4regulate pH=2.0.
Carry out sucrose density gradient centrifugation: sucrose (20-60%) aqueous solution of preparation variable concentrations, 60% sucrose 1ml, 50% sucrose 2ml, 40% sucrose 2ml, 30% sucrose 2ml and 20% sucrose 2ml is added from bottom to top respectively in density gradient centrifugation pipe, notice that often adding one deck all should try one's best carefully, does not allow it miscible in order to avoid affect separating effect.Again by prepared not glycerinated 2ml chromatophore solution gently join on saccharose gradient along tube wall, collect the chromatophore of the second layer after the centrifugal 1.5h of 38000rpm, carry out ATP hydrolysing activity mensuration with enzyme coupling method, detect grain size with dynamic light scattering.Collect rear 4 DEG C of centrifugal 90min of 40000rpm, it is for subsequent use with being put in-70 DEG C of refrigerators after resuspended containing the PBS of 30% glycerine to get precipitation.
Measure chromatophorous ATP hydrolysing activity: ATP enzyme hydrolysing activity assay method utilizes spectrophotometric method, the reaction of coupling pyruvate kinase and lactic dehydrogenase, measure NADH in the minimizing of 340nm place optical density, obtain the amount of hydrolysis of ATP.First in cuvette, add lysis buffer (50mM Tris-Cl pH8.0,10mM KCl, the 2mM MgCl of 400ul
2) and return to zero, then add 1ul NADH (100mM) and make OD340nm=0.8-1.Add 4ul PEP (50mM) more respectively, 4ul ATP (200mM), 2ul PK (1U/ul), 2ul LDH (1U/ul), after OD340nm absorption value is stable, the chromatophore adding 5ul carries out determination of activity at 37 DEG C, until OD340nm absorption value is constant.The change of record absorption value and enzyme reaction Time Calculation enzyme are lived.1U ATP enzyme hydrolysing activity is defined as the enzyme amount at 37 DEG C of hydrolysising ATPs per minute.
2. pair probe design and preparation:
2.1 when target molecule is protein, and detection of the present invention needs design for the monoclonal antibody of same antigen (protein molecular) different epi-position as capture probe and detector probe.Antibody can buy a commercial antagonist for the different epi-position of same antigen.It is as follows that process is changed in capture antibody and detection antibody biotin (biotin): by 2 μ l (+)-Biotin N-hydroxysuccinimide ester (10mM) (sigma, article No. H1759) be added to 500 μ l capture antibodies (20 μMs) respectively and detect in antibody (20 μMs), incubated at room 4h, (+)-Biotin N-hydroxysuccinimide ester dissociated is by PBS dialysis removing, change three dislysates (PBS), each dialysis 8 hours.Collect the biotinylated antibody of having dialysed add 50% glycerine be placed in-20 DEG C frozen for subsequent use.
2.2 when target molecule is nucleic acid, and detection of the present invention needs design for two nucleic acid probes of same nucleotide sequence diverse location as the capture probe of nucleic acid and detector probe.The synthesis of nucleic acid probe and biotin (biotin) are modified and are undertaken by biotech firm.
3. the mark of probe
Biotinylated capture probe is connected to the magnetic bead surfaces that streptavidin (streptavidin) wraps quilt.For detector probe, first by PE-cap-biotin (purchased from avanti company, 870277P) mark is to chromatophore surface, then wrap by NeutrAvidin (purchased from Thermo fisher company, article No. 31050), then use biotin (biotin) to mark detector probe, finally biotinylated detector probe is connected to chromatophore surface by biotin-NeutrAvidin-biotin system.Concrete preparation process is as follows:
3.1 capture probe mark magnetic bead:
If 3.1.1 labeling nucleic acid probe, get 100ul10mg/ml diameter be the streptavidin bag of 1um by magnetic bead (purchased from life technology company, article No. 650.02, diameter 1um, 10mg/ml)), with elution buffer (5mM Tris-HCL, 1M NaCl, 0.5mM EDTA) wash three times, the composition of conserving liquid is removed by Magneto separate.Resuspended with 200ul binding buffer liquid (10mM Tris-HCL, 2M NaCl, 1mM EDTA).The biotinylated nucleic acid probe (capture probe) of applicable concentration is added the above-mentioned magnetic bead handled well, room temperature reaction 15 minutes, period rocks and ensures that magnetic bead does not precipitate, by Magneto separate, free probe is removed, with 100ul hybridization buffer, ((20X SSC dilutes four times and obtains 5X SSC 5X SSC, 20X SSC fills a prescription as follows: 0.3mol/L sodium citrate, 3.0mol/L sodium chloride), (50X denhardts liquid is 5X denhardts liquid: 1% (m/V) glycan body 400 (Ficoll400), 1% (m/V) polyvinylpyrrolidone (PVP), 1% (m/V) bovine serum albumin(BSA) (component V), diluted 10 times and obtained 5X denhardts liquid)) resuspended stand-by.
If 3.1.2 labelled antibody, get 100ul10mg/ml diameter be 2.8um streptavidin bag by magnetic bead (purchased from life technology company, article No. 112.06D, diameter 2.8um, 10mg/ml), wash three times with PBS, removed the composition of conserving liquid by Magneto separate.Resuspended with 200ul PBS.200ul is applicable to the biotinylated antibody probe (capture probe) (optimizing concentration according to concrete probe needs) of concentration, add the above-mentioned magnetic bead handled well, room temperature reaction 15 minutes, period rocks and ensures that magnetic bead does not precipitate, by Magneto separate, free probe is removed, wash three times with PBS.Resuspended stand-by with 100ul PBS.
3.2 detector probe-chromatophore preparation:
3.2.1NeutrAvidin-PE-cap-biotin-chromatophore preparation: in the chromatophore obtained after the PE-cap-biotin (methyl alcohol dissolving) of 1ul5mg/ml is added 1ml sucrose gradient centrifugation, add 9ml PBS damping fluid (pH7.4), 4 DEG C mark 30 minutes, and slowly shake makes reaction even simultaneously.Reaction terminate after be dispensed in 10 EP pipes, often pipe 1ml, under 40000 rotating speeds 4 DEG C centrifugal 20 minutes, remove supernatant, in triplicate, remove free PE-cap-biotin, the resuspended precipitation of every effective 1ml PBS, add 50ul10mg/ml NeutrAvidin (purchased from Thermo fisher company, article No. 31050) respectively, room temperature reaction 15 minutes, then under rotating speed 40000rpm, 4 DEG C centrifugal 10 minutes, removes supernatant, wash away free NeutrAvidin in triplicate.Every effective 200ul is resuspended containing the PBS of 30% glycerine, bag be stored in-20 DEG C for subsequent use.
3.2.2 get the NeutrAvidin-PE-cap-biotin-chromatophore prepared by 50ul, add 1mlPBS, 40000rpm, 4 DEG C, within centrifugal 10 minutes, remove glycerine, resuspended with 1ml PBS.
3.2.3 the biotin labeled detector probe (according to different probe needs Optimal reaction conditions) of applicable concentration is added, room temperature reaction 15 minutes, reaction terminate after under 40000rpm centrifugal force 4 DEG C centrifugal 10 minutes, remove unconjugated probe, in triplicate.Finally with 100ul PBS resuspended detection antibody-chromatophore or for subsequent use with 100ul hybridization buffer resuspended detection of nucleic acids probe-chromatophore.
4. target hybridization method:
4.1 detection system when biomolecule to be measured is protein
First the magnetic bead being marked with capture probe is closed: with containing 2% gelatin, the confining liquid of 0.01%Tween20 is closed, room temperature one hour, washs magnetic bead once afterwards with magnetism separate method PBST (PBS solution containing 0.01%Tween20).Antigen (albumen) sample PBST is diluted to suitable concn, carries out protein hybridization according to following system:
Antigen-antibody, 37 degree of association reactions 1 hour, washs three times with PBST afterwards, then washs three times with PBS.
4.2 detection system when biomolecule to be measured is nucleic acid
Nucleic acid hybridization is carried out according to following system:
Hybridization temperature is 25-45 degree Celsius, according to different target molecule optimal conditions.Hybridization time is 10 minutes.Hybridization terminates to be put on ice rapidly afterwards, and unconjugated free molecule and chromatophore is removed by magnetism separate method, washs three times afterwards, then wash three times with PBS with PBST.
5.ATP synthetic reaction
By the magnetic bead that above-mentioned hybridization terminates, be separated magnetic bead with magnet, remove supernatant, add 50ul and start damping fluid (50mM Tricine-NaOH, 5mM MgCl
2, 5mM NaH
2pO
4, 10% glycerine, 0.3uMADP), carry out ATP synthetic reaction at 42 degree, the reaction time is 30 minutes.
6.ATP chemiluminescence detection:
Be placed on ice by each reaction tube after ATP synthetic reaction terminates, with magnetism separate method, magnetic bead be adsorbed onto tube wall, get supernatant 20ul and join in 96 blank plates, two multiple holes are done in every hole, then add ATP detection kit (
aTP Assay System, article No.: FF2021, Promega) working fluid 40ul, carries out reading after mixing immediately on Chemiluminescence Apparatus.
7. interpretation of result
Detection arranges blank (only have magnetic bead, do not have chromatophore), negative control (water is as negative control), positive control (positive criteria sample, it contains the molecules detected of variable concentrations) and testing sample.If sample containing target molecule, then can show higher chemiluminescence readings, if not containing target molecule, then chemiluminescence reading and negative control are without significant difference.
Embodiment 2, carry out protein molecular detection for c reactive protein (CRP)
1. prepare chromatophore according to the method described in embodiment 1.
2. the preparation of capture antibody and detection antibody: c reactive protein used (CRP) is bought from meridianlifescience (A97201H).Capture antibody used is CRP monoclonal antibody M86842M (meridianlifescience), and detection antibody used is CRP monoclonal antibody M86284M (meridianlifescience).Its biotinylation proce is: by 2 μ l (+)-BiotinN-hydroxysuccinimide ester (10mM) (sigma, article No. H1759) be added in 200 μ lCRP capture antibodies M86842M (5mg/ml) and CRP detection antibody M86284M (7.5mg/ml) respectively, incubated at room 4h, (+)-Biotin N-hydroxysuccinimide ester dissociated is by PBS dialysis removing, change three dislysates (PBS), each dialysis 8 hours.Collect the biotinylated antibody of having dialysed add 50% glycerine be placed in-20 DEG C frozen for subsequent use.
3. prepare NeutrAvidin-PE-cap-biotin-chromatophore according to the method described in embodiment 1.
4.CRP detects antibody M86284M and marks NeutrAvidin-PE-cap-biotin-chromatophore: in the NeutrAvidin-PE-cap-biotin-chromatophore prepared by 50ul, add the biotinylated CRP of 30ul detect antibody M86284M, 200ul is diluted to PBS, room temperature reaction 15 minutes, reaction terminate after under 40000rpm centrifugal force 4 DEG C centrifugal 10 minutes, remove free detection antibody, in triplicate.Finally use 100ulPBS resuspended for subsequent use.
5.CRP capture antibody M86842M marks the magnetic bead of streptavidin bag quilt: get 100ul10mg/ml diameter be the streptavidin bag of 2.8um by magnetic bead (purchased from life technology company, article No. 112.06D, diameter 2.8um, 10mg/ml), with elution buffer (5mM Tris-HCL, 1MNaCl, 0.5mM EDTA) wash three times, the composition of conserving liquid is removed by Magneto separate.Resuspended with 200ul PBS.Get 10ug biotinylated CRP capture antibody M86842M to mix with the magnetic bead after process, 200ul is diluted to PBS, react 15 minutes, wash three times by Magneto separate and remove free capture antibody, obtain the magnetic bead of CRP capture antibody M86842M mark by the resuspended precipitation of 100ulPBS.
6. closing the magnetic bead being marked with capture probe: with containing 2% gelatin, the confining liquid of 0.01%Tween20 is closed, room temperature one hour, washing magnetic bead once with magnetism separate method PBST afterwards.
7. antigen detects: CRP sample PBST (containing 0.01%Tween20PBS) is diluted to suitable concn, is respectively 33fg/ml, 3.3pg/ml, 330pg/ml, 33ng/ml, carry out protein hybridization according to following system:
By the CPR sample of variable concentrations and the magnetic bead being marked with capture probe and the chromatophore that is marked with detector probe 37 degree of association reactions 1 hour, use PBST (containing 0.02%Tween20PBS) to wash three times afterwards, then wash three times with PBS.
8.ATP synthetic reaction
By the magnetic bead that above-mentioned hybridization terminates, be separated magnetic bead with magnet, remove supernatant, add 50ul and start damping fluid (50mM Tricine-NaOH, 5mM MgCl
2, 5mM NaH
2pO
4, 10% glycerine, 0.3uMADP), carry out ATP synthetic reaction at 42 degree, the reaction time is 30 minutes.
9.ATP chemiluminescence detection
Be placed on ice by each pipe after ATP synthetic reaction terminates, with magnetism separate method, magnetic bead be adsorbed onto tube wall, get supernatant 20ul and join in 96 hole blanks, two multiple holes are done in each hole, then add luciferin/luciferase working fluid (ATP detection kit (
aTP Assay System, article No.: FF2021, Promega) 40ul, carries out reading after mixing immediately on Chemiluminescence Apparatus.
10. interpretation of result
Detection arranges blank (only have magnetic bead, do not have chromatophore), negative control (water is as negative control), positive control (positive criteria sample) and testing sample.If sample containing target molecule, then can show higher chemiluminescence readings, if not containing target molecule, then chemiluminescence readings and negative control are without significant difference.Result as shown in Figure 2, raise with CRP concentration, ATP synthesizing activity reduces, in order to study its mechanism, we have carried out electron microscopic observation to the magnetic bead form being combined with variable concentrations CRP, result as shown in Figure 3, when there is no CRP (contrast), do not have molecular motor to be attached on magnetic bead, magnetic bead is comparatively disperse state distribution, when there being the CRP of 0.0003pg/L to exist, magnetic bead is little aggregates state, and when CRP exists with higher concentration (30ng/L) CRP, the aggregation extent of magnetic bead is maximum, hinder the activity of molecular motor on the contrary.The method presents reverse sensitivity characteristic, namely concentration of target molecules is lower, detection signal is higher, and traditional detection method, detection signal increases with concentration of target molecules and increases, and when concentration of target molecules is to a certain extent low, is subject to the impact of detect and track, detection sensitivity can not improve further, and the present invention is directed to the sensitivity that the oppositely sensitive characteristic presented when CRP detects can improve detection greatly.
Embodiment 3, carry out variable concentrations detection of nucleic acids for miR141
Detect using a kind of microRNA (miR141) as target nucleic acid molecule.
1. prepare chromatophore according to the method described in embodiment 1.
2.miR141 the preparation of capture probe and detector probe:
(sequence of miR141 is miR141: UAACACUGUCUGGUAAAGAUGG) in Shanghai, the biological company limited of lucky agate synthesizes standard sequence, be diluted to 20uM as storage liquid with pyrocarbonic acid diethyl ester (DEPC water 0.1%), before experiment storage liquid DEPC water be diluted to variable concentrations (be respectively 0,1nM, 5nM, 10nM, 20nM, 40nM).
The capture probe of synthesizing biotinylated and detector probe (the Shanghai biological company limited of lucky agate):
Capture probe miRNA141-1:biotin-AAAAAAAAAA
cCATCTTTACC
Detector probe miRNA141-2:
aGACAGTGTTAaAAAAAAAAA-biotin
In order to reduce space steric effect, devising polyadenylic acid at the 5 ' end of capture probe miRNA141-1 and the 3 ' end of detector probe miRNA141-2 and extending probe length, increasing hybridization probability.
3. prepare the preparation of NeutrAvidin-PE-cap-biotin-chromatophore according to the method described in embodiment 1.
4. detector probe miRNA141-2 marks NeutrAvidin-PE-cap-biotin-chromatophore: in 50ul NeutrAvidin-PE-cap-biotin-chromatophore, add the biotinylated detector probe miRNA141-1 of 30ul, 200ul is diluted to PBS, room temperature reaction 15 minutes, reaction terminate after under 40000rpm centrifugal force 4 DEG C centrifugal 10 minutes, remove free detection antibody, in triplicate.((20XSSC dilutes four times and obtains 5XSSC 5X SSC finally to use 100ul hybridization buffer, 20XSSC formula is as follows: 0.3mol/L sodium citrate, 3.0mol/L sodium chloride), (50Xdenhardts liquid is 5X denhardts liquid: 1% (m/V) glycan body 400 (Ficoll400), 1% (m/V) polyvinylpyrrolidone (PVP), 1% (m/V) bovine serum albumin(BSA) (component V), dilutes 10 times and obtains 5X denhardts liquid)) resuspended for subsequent use.
5. capture probe miRNA141-1 marks the magnetic bead of streptavidin bag quilt: get 100ul10mg/ml diameter be the streptavidin bag of 1um by magnetic bead (purchased from life technology company, article No. 650.02, diameter 1um, 10mg/ml), with elution buffer (5mM Tris-HCL, 1MNaCl, 0.5mM EDTA) wash three times, the composition of conserving liquid is removed by Magneto separate.Resuspended with 200ul binding buffer liquid (10mM Tris-HCL, 2M NaCl, 1mM EDTA).The capture probe miRNA141-1 of applicable concentration is added the above-mentioned magnetic bead handled well, room temperature reaction 15 minutes, period rocks and ensures that magnetic bead does not precipitate, by Magneto separate, free probe is removed, with hybridization buffer 5X SSC, (20XSSC dilutes four times and obtains 5XSSC, 20XSSC formula is as follows: 0.3mol/L sodium citrate, 3.0mol/L sodium chloride), (50X denhardts liquid is 5X denhardts liquid: 1% (m/V) glycan body 400 (Ficoll400), 1% (m/V) polyvinylpyrrolidone (PVP), 1% (m/V) bovine serum albumin(BSA) (component V), diluting 10 times and obtain 5X denhardts liquid) 100ul is resuspended stand-by.
6. carry out nucleic acid hybridization according to following system
Hybridization temperature is 25-45 degree, and hybridization time is 10 minutes.Hybridization terminates to be put on ice rapidly afterwards, and unconjugated free molecule and chromatophore is removed by magnetism separate method, uses PBST (PBS containing 0.02%Tween20) to wash three times afterwards, then washs three times with PBS.
7.ATP synthetic reaction: the magnetic bead above-mentioned hybridization terminated, is separated magnetic bead with magnet, removes supernatant, adds 50ul and starts damping fluid (50mM Tricine-NaOH, 5mM MgCl
2, 5mMNaH
2pO
4, 10% glycerine, 0.3uM ADP), carry out ATP synthetic reaction at 42 degree, the reaction time is 30 minutes.
8.ATP chemiluminescence detection: after ATP synthetic reaction terminates, each pipe is placed on ice, with magnetism separate method, magnetic bead is adsorbed onto tube wall, gets supernatant 20ul and join in 96 blank plates, each sky does two multiple holes, then add 40ul luciferin/luciferase working fluid (ATP detection kit:
aTP Assay System, article No.: FF2021, Promega), after mixing, on Chemiluminescence Apparatus, carry out reading immediately.
9. interpretation of result: detect and blank (only have magnetic bead, do not have chromatophore) is set, negative control (water is as negative control), positive control (synthesis miR141 standard model) and testing sample.If containing miR141 in sample, then can show higher chemiluminescence readings, if not containing target molecule, then chemiluminescence readings and negative control are without significant difference.As shown in Figure 4, miR141 is linearly relevant to chemiluminescence intensity within the scope of 1-40nM, can quantitatively detect for result.Whole testing process is no more than 2 hours, and traditional micro RNA detection method needs to carry out reverse transcription, real time PCR carries out quantitative test, length consuming time, required reagent facility is expensive, operation requirements is strict, and reagent instrument required for the present invention is common, only needs to use traditional Chemiluminescence Apparatus and detect, low price, simple to operate, detection time is short, and 96 orifice plates can carry out high flux detection, also can carry out quantitative test, can further improve detection sensitivity through optimization, be conducive to promoting the use of on a large scale.
Embodiment 4, carry out two Probe Hybridization specific detection for miR141
Take miR141 as positive criteria, with two point mutation miR141m-1 and miR141m-2 for simple point mutation sequence carries out specific detection.Mutant nucleotide sequence is respectively:
miR141m-1：UAAC
UCUGUCUGGUAAAGAUGG；
miR141m-2：UAACACUGUCUGGUAAA
CAUGG。
Concrete detection method is with embodiment 3, probe used is with embodiment 3, sample comprises negative control, 10nM positive criteria miR141, 10nM miR141m-1, miR141m-2, result as shown in Figure 5, higher chemiluminescence signal can be produced with the miR141 of probe complete complementary, and the chemiluminescence signal produced containing the sequence miR141m-1 of point mutation and miR141m-2 and negative control no significant difference, this illustrates that the method for the invention can well distinguish simple point mutation micro RNA sequence, the method required time is less than 2 hours, simple to operate, required reagent and instrument not expensive, and traditional reverse transcription PCR and real time PCR method length consuming time, required reagent facility is expensive, operation requirements is strict, be unfavorable for carrying out in a large number.
Claims (12)
1. detect a method for biomacromolecule, said method comprising the steps of:
A. capture probe is connected with magnetic bead;
B. detector probe is connected with ATP molecular motor;
C. by the magnetic bead being connected with capture probe obtained by step a and the ATP molecular motor being connected with detector probe obtained by step b and biological sample bulk crossing to be measured;
D. after step c, Magneto separate is carried out to magnetic bead, the magnetic bead of separation is joined in the reaction mixture containing ADP and carry out ATP synthetic reaction; And
E., after ATP synthetic reaction terminates, get and on Chemiluminescence Apparatus, do not carry out reading containing the reaction supernatant of magnetic bead;
Wherein said capture probe and described detector probe respectively with the different parts specific binding of detected biomacromolecule.
2. method according to claim 1, wherein said biomacromolecule is protein, and described capture probe and described detector probe are the specific antibody of two different epi-positions for described protein respectively.
3. method according to claim 2, wherein said protein is c reactive protein (CRP), and described capture probe and described detector probe are monoclonal antibody M86842M and the M86284M of CRP respectively.
4. method according to claim 1, wherein said biomacromolecule is DNA, and described capture probe and described detector probe are hold with 5 ' of described DNA sense strand sequence and 3 ' a pair nucleic acid molecules holding difference complementary respectively.
5. method according to claim 1, wherein said biomacromolecule is RNA, and described capture probe and described detector probe are hold with 5 ' of described RNA sequence and 3 ' a pair nucleic acid molecules holding difference complementary respectively.
6. the method according to any one of claim 1-5, wherein in described step a, described capture probe is marked with biotin, and described magnetic bead is coated with streptavidin, and described capture probe and described magnetic bead are linked together by the interaction of biotin and streptavidin.
7. the method according to any one of claim 1-5, wherein in described step b, described detector probe is marked with biotin, described ATP molecular motor is marked with PE-cap-biotin-NeutraAvidin, and described detector probe and described ATP molecular motor are linked together by biotin-NeutrAvidin-biotin system.
8. the method according to any one of claim 1-5, wherein in described steps d, described ATP synthetic reaction is carried out at 42 DEG C.
9. the method according to any one of Claims 2 or 3, wherein in described step c, before carrying out bulk crossing, carries out Seal treatment to the described magnetic bead being connected with capture probe obtained by step a.
10. the method according to any one of Claims 2 or 3, wherein in described step c, described hybridization is carried out at 37 DEG C.
11. methods according to any one of claim 4 or 5, wherein in described step c, described hybridization is carried out at 25-45 DEG C.
12. 1 kinds for detecting the kit of biomacromolecule, described kit comprises:
Capture probe;
Magnetic bead;
Detector probe;
ATP molecular motor; With
Reaction mixture containing ADP;
Wherein said capture probe and described detector probe respectively with the different parts specific binding of detected biomacromolecule.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310186289.6A CN103308690B (en) | 2013-05-20 | 2013-05-20 | Biosensor construction and detection method based on molecular motor, magnetic enrichment and double-probe hybridization |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310186289.6A CN103308690B (en) | 2013-05-20 | 2013-05-20 | Biosensor construction and detection method based on molecular motor, magnetic enrichment and double-probe hybridization |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103308690A CN103308690A (en) | 2013-09-18 |
| CN103308690B true CN103308690B (en) | 2015-03-18 |
Family
ID=49134135
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310186289.6A Expired - Fee Related CN103308690B (en) | 2013-05-20 | 2013-05-20 | Biosensor construction and detection method based on molecular motor, magnetic enrichment and double-probe hybridization |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103308690B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107632163A (en) * | 2017-10-16 | 2018-01-26 | 苏州长光华医生物医学工程有限公司 | A kind of detection method of hs-CRP |
| CN108195811A (en) * | 2018-01-12 | 2018-06-22 | 海南大学 | A kind of nano-sensor of molecular probe functionalization pyruvate kinase quickly detects microorganism |
| CN114149985A (en) * | 2021-12-06 | 2022-03-08 | 杭州优玛达生物科技有限公司 | Preparation method and application of molecular motor |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1513752A (en) * | 2002-12-31 | 2004-07-21 | 中国科学院生物物理研究所 | Biomolecule motor magnetic regulating and controlling device |
| CN101993820A (en) * | 2009-08-21 | 2011-03-30 | 殷勤伟 | Method for manufacturing rotary type sensor used for rapidly, sensitively and specifically detecting trace small RNAs |
| CN102183648A (en) * | 2011-01-26 | 2011-09-14 | 中国科学院上海微系统与信息技术研究所 | Detection method and detection kit for detecting special pathogenic bacteria by bioluminescence |
| CN102253193A (en) * | 2010-05-20 | 2011-11-23 | 上海医脉赛科技有限公司 | Magnetic fluorescent kit for rapidly detecting microbes as well as preparation method and use method thereof |
| CN102912021A (en) * | 2012-10-23 | 2013-02-06 | 北京出入境检验检疫局检验检疫技术中心 | Molecular motor biosensor kit for molecular subtyping of salmonella |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8076079B2 (en) * | 2003-12-17 | 2011-12-13 | Arizona Board of Regents, a body coporate acting for and on behalf of Arizona State University | Single molecule detection using molecular motors |
| GB0918016D0 (en) * | 2009-10-14 | 2009-12-02 | Univ Portsmouth | Biosensor |
-
2013
- 2013-05-20 CN CN201310186289.6A patent/CN103308690B/en not_active Expired - Fee Related
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1513752A (en) * | 2002-12-31 | 2004-07-21 | 中国科学院生物物理研究所 | Biomolecule motor magnetic regulating and controlling device |
| CN101993820A (en) * | 2009-08-21 | 2011-03-30 | 殷勤伟 | Method for manufacturing rotary type sensor used for rapidly, sensitively and specifically detecting trace small RNAs |
| CN102253193A (en) * | 2010-05-20 | 2011-11-23 | 上海医脉赛科技有限公司 | Magnetic fluorescent kit for rapidly detecting microbes as well as preparation method and use method thereof |
| CN102183648A (en) * | 2011-01-26 | 2011-09-14 | 中国科学院上海微系统与信息技术研究所 | Detection method and detection kit for detecting special pathogenic bacteria by bioluminescence |
| CN102912021A (en) * | 2012-10-23 | 2013-02-06 | 北京出入境检验检疫局检验检疫技术中心 | Molecular motor biosensor kit for molecular subtyping of salmonella |
Non-Patent Citations (1)
| Title |
|---|
| 分子马达传感器对沙门氏菌快速检测方法的初步研究;张捷等;《食品工业科技》;20121231;第33卷(第12期);摘要，第93-94页的材料与方法部分 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103308690A (en) | 2013-09-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wei et al. | An improved ultrasensitive enzyme-linked immunosorbent assay using hydrangea-like antibody–enzyme–inorganic three-in-one nanocomposites | |
| Yi et al. | The research of aptamer biosensor technologies for detection of microorganism | |
| Yi-Xian et al. | Application of aptamer based biosensors for detection of pathogenic microorganisms | |
| Bhardwaj et al. | Recent progress in nanomaterial-based sensing of airborne viral and bacterial pathogens | |
| Wu et al. | Bifunctional magnetic nanobeads for sensitive detection of avian influenza A (H7N9) virus based on immunomagnetic separation and enzyme-induced metallization | |
| US20040018495A1 (en) | Microparticle based signal amplification for the detection of analytes | |
| JP2014527183A (en) | Molecular diagnostic assay device and method of use | |
| JP2003185668A (en) | Taxonomic identification of pathogenic microbe and toxicity protein of pathogenic microbe | |
| US20200363406A1 (en) | Highly-specific assays | |
| Chen et al. | A novel chemiluminescence immunoassay of staphylococcal enterotoxin B using HRP-functionalised mesoporous silica nanoparticle as label | |
| CN103308690B (en) | Biosensor construction and detection method based on molecular motor, magnetic enrichment and double-probe hybridization | |
| ES2660295T3 (en) | Method of capturing bacteria on polylysine coated microspheres | |
| US20230021971A1 (en) | Biologic Machines for the Detection of Biomolecules | |
| CN102384974B (en) | Application of transition metal oxide | |
| CN112540095B (en) | Method for detecting food-borne pathogenic bacteria by enzymatic low-field nuclear magnetic resonance immunosensor | |
| Xia et al. | Biosensors based on sandwich assays | |
| CN114807397A (en) | Method for detecting salmonella and drug-resistant bacteria by non-amplification time-resolved fluorescence lateral chromatography detection | |
| US20160258938A1 (en) | Method of detecting an analyte in a sample | |
| Daramola et al. | Functionalized inorganic nanoparticles for the detection of food and waterborne bacterial pathogens | |
| Kim et al. | A rapid and sensitive immunoassay for detection of E. coli O157: H7 using multienzyme—Au nanoparticle complex | |
| Yu et al. | Immunological methods | |
| He et al. | DNA sensor by using electrochemiluminescence of acridinium ester initiated by tripropylamine | |
| RU2397243C1 (en) | Method of detecting pathogenic microorganisms | |
| Liu et al. | Highly sensitive detection of Hg2+ using molybdenum disulfide-DNA sensors | |
| US10752892B2 (en) | Multilayer complex, method for manufacturing said complex and use of said complex |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150318 |