CN103308690A - Biosensor construction and detection method based on molecular motor, magnetic enrichment and double-probe hybridization - Google Patents
Biosensor construction and detection method based on molecular motor, magnetic enrichment and double-probe hybridization Download PDFInfo
- Publication number
- CN103308690A CN103308690A CN2013101862896A CN201310186289A CN103308690A CN 103308690 A CN103308690 A CN 103308690A CN 2013101862896 A CN2013101862896 A CN 2013101862896A CN 201310186289 A CN201310186289 A CN 201310186289A CN 103308690 A CN103308690 A CN 103308690A
- Authority
- CN
- China
- Prior art keywords
- probe
- magnetic bead
- atp
- capture probe
- biotin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention relates to a detection method of biomacromolecule, and in particular relates to a method for detecting the biomacromolecule by utilizing the signal amplification characteristic of the ATP molecular motor in terms of time and space and high temperature resistance thereof, high specificity of double-antibody hybridization and double-probe hybridization, high flexibility and fastness of magnetic enrichment and magnetic separation, and the high flexibility of the chemiluminiscence detection technology, and reduction of the non-specific hybridization by the single-stranded nuclease degradation and mismatched double-strand. A novel biosensor construction and detection method is capable of separating the signal molecule from the reaction system, storing the signal molecule to measure for multiple times and facilitating the comparison of the samples in different batches, and according to the method, the super-flexibility, fastness, high specificity and avoidance of amplification can be realized.
Description
Technical field
The present invention relates to the detection method of a kind of biomacromolecule.Relate in particular to and utilize ATP molecular motor, two Probe Hybridization, magnetic enrichment and separate and the macromolecular method of chemiluminescence detection technology high sensitivity ground detection of biological.
Background technology
Biology sensor is to utilize biological key element and physical chemistry to detect the device that factor combination detects analyte together.Double antibody sandwich method is a kind of of the large molecular detecting method of traditional biological, and its ultimate principle is to utilize a pair of specific probe (antibody or nucleic acid) that can identify with the different epi-positions of a part, detects by different signal output systems.For the large Molecular Detection of protide, method commonly used is the enzyme-linked immunosorbent assay based on the antigen-antibody combination, for the large molecule of nucleic acid (comprising DNA, RNA, microRNA etc.), and northern blot commonly used, southern blot, the technology such as PCR.Signal output system commonly used comprises the state of aggregation of fluorescence, chemiluminescence, isotope and molecule etc.Some new detection methods are also arranged, and as relying on quantum dot, nanogold particle detects as detection signal.But these signal output systems are momentary signal output, signaling molecule can't separate with reaction system, and detection signal must detect after reaction immediately, can't to code book carry out repeated detection, therefore its detection sensitivity is restricted, and is unfavorable for the comparison between the different time sample.
Summary of the invention
For the sensitivity that improves the biomacromolecule detections such as protein, nucleic acid, specificity and shortening detection time, avoid nucleic acid amplification, the reduce false positive rate, reduce testing cost, the realization high flux detects, and the invention provides a kind of biomacromolecule detection method that can spatially go up the amplification detection signal with the time.The method combines molecular motor with magnetic separation technique and two Probe Hybridization technology, detect in liquid phase environment, not only can fast detecting go out micro-target biological molecules, can also distinguish the nucleic acid molecules of target molecule and foreign protein or simple point mutation.And can carry out quantitative test to molecules of interest within the specific limits, and improved the sensitivity that detects, specificity, and be convenient to carry out the high flux detection.
The present invention has designed two specific probes for target molecule.For antigen, probe is the specific antibody for the different epi-positions of same antigen; For dna molecular, probe is and 5 ' end of positive-sense strand sequence and a pair of nucleic acid probe of 3 ' end difference complementation; For the RNA sequence, probe is to hold complementary respectively a pair of nucleic acid probe with RNA sequence 5 ' end and 3 '.One of them probe is connected on the magnetic bead as capture probe, another probe is connected on the ATP molecular motor as detector probe, hybridize by the hybridization conditions of optimizing, separate with unconjugated free molecule motor by magnetic separation technique in connection with the magnetic bead that molecular motor is arranged, through at high temperature carrying out the ATP synthetic reaction, separation separates with reaction system through magnetic with synthetic ATP, the ATP of this moment is can packing frozen in-80 ℃ of preservations as signaling molecule, select the suitable time to measure, also can directly reflect the existence of target molecule by the concentration of the detection ATP of luciferin/luciferase system.If there is target molecule, then have the active existence of molecular motor, amplify through the signal magnetic enrichment on the space and temporal synthetic ATP signal, can detect the target molecule of low concentration.For nucleic acid, false positive and the operating process of complexity and the instrument and equipment of costliness of having avoided amplification to bring.ATP molecule and reaction system separable and can preserving can be detected at different time the detection signal of same sample, and the pattern detection signal of different batches can be measured the comparison that is beneficial between sample simultaneously.The present invention will be connected with the magnetic microsphere of capture probe and be connected with the ATP molecular motor of detector probe as responsive biological elements acquisition target molecule, ATP molecular motor and luciferin/luciferase system are as transducing head, convert the concentration of target molecules signal to ATP molecular conecentration signal and chemiluminescence signal, react concentration of target molecules by the chemiluminescence light intensity as detection signal at last.The present invention is spatially by on the basis of secondary transducing (concentration of target molecules-ATP concentration-chemiluminescence intensity) amplification detection signal, increased accumulated time enlarge-effect (the ATP synthetic reaction that the same concentrations target molecule produces, prolonging in time synthetic ATP concentration increases), and the high specific by two probes has reduced the interference of non-specific molecule.Realized signaling molecule is separated with reaction system by magnetic separation technique, the signal of same sample has been measured and the signal of different samples is measured simultaneously and compared in the different time gradation.
More specifically, the invention provides the following:
1. macromolecular method of detection of biological said method comprising the steps of:
A. capture probe is connected with magnetic bead;
B. detector probe is connected with the ATP molecular motor;
The magnetic bead that is connected with capture probe that c. will obtain by step a and the ATP molecular motor that is connected with detector probe and the biological sample bulk crossing to be measured that obtains by step b;
D. behind step c, magnetic bead is carried out magnetic and separate, the magnetic bead that separates is joined carry out the ATP synthetic reaction in the reaction mixture that contains ADP; And
E. after the ATP synthetic reaction finishes, get the reaction supernatant that does not contain magnetic bead and carry out reading at Chemiluminescence Apparatus;
Wherein said capture probe and described detector probe respectively with the different parts specific binding of the biomacromolecule that detects.
2. according to the 1st described method, wherein said biomacromolecule is protein, and described capture probe and described detector probe are respectively the specific antibodies for two different epi-positions of described protein.
3. according to the 2nd described method, wherein said protein is c reactive protein (CRP), and described capture probe and described detector probe are respectively monoclonal antibody M86842M and the M86284M of CRP.
4. according to the 1st described method, wherein said biomacromolecule is DNA, and described capture probe and described detector probe are respectively and 5 ' end of described DNA positive-sense strand sequence and 3 ' the end a pair of nucleic acid molecules of complementation respectively.
5. according to the 1st described method, wherein said biomacromolecule is RNA, and described capture probe and described detector probe are respectively and 5 ' end of described RNA sequence and 3 ' the end a pair of nucleic acid molecules of complementation respectively.
6. according to each described method in the 1-5 item, wherein in described step a, described capture probe is marked with biotin, and described magnetic bead is coated with streptavidin, and described capture probe and described magnetic bead link together by the interaction of biotin and streptavidin.
7. according to each described method in the 1-5 item, wherein in described step b, described detector probe is marked with biotin, described ATP molecular motor is marked with NeutrAvidin-PE-cap-biotin, and described detector probe and described ATP molecular motor link together by biotin-NeutrAvidin-biotin system.
8. according to each described method in the 1-5 item, wherein in described steps d, described ATP synthetic reaction is carried out at 42 ℃.
9. according to each described method in the 2nd or the 3rd, wherein in described step c, before carrying out bulk crossing, the described magnetic bead that is connected with capture probe that obtains by step a is sealed processing.
10. according to each described method in the 2nd or the 3rd, wherein in described step c, described hybridization is carried out at 37 ℃.
11. according to each described method in the 4th or the 5th, wherein in described step c, described hybridization is carried out at 25-45 ℃.
12. the kit for detection of biomacromolecule, described kit comprises:
Capture probe;
Magnetic bead;
Detector probe;
The ATP molecular motor; With
The reaction mixture that contains ADP;
Wherein said capture probe and described detector probe respectively with the different parts specific binding of the biomacromolecule that detects.
The invention will be further described below in conjunction with specific embodiment.
Description of drawings
Fig. 1. separate and the schematic diagram of the biomacromolecule detection method of two Probe Hybridization technology based on molecular motor, magnetic, wherein use capture probe mark magnetic bead, with detector probe labeled molecule motor, different according to the type that detects target molecule, detect for antigen, probe can be the antagonist for the different epi-positions of same antigen, and for detection of nucleic acids, probe can be a pair of oligonucleotide probe for same sequence diverse location.
Fig. 2. carry out antigen as an example of c reactive protein (CRP) example and detect: in the 3.3ug/ml scope, concentration and the fluorescent value of the CRP of sample have linear relationship at 33fg/ml.
Fig. 3. the magnetic bead of variable concentrations CRP mediation is assembled electron microscopic observation.
Fig. 4. carry out the detection of little RNA as an example of miR141 example, be standard sequence with synthetic microRNA141 sequence (miR141), it is diluted to variable concentrations, be respectively 0,1nM, 5nM, 10nM, 20nM, 40nM, according to nucleic acid detection method of the present invention it is detected, the nucleic acid concentration of show sample and fluorescent value are good in 1-40nM scope internal linear relation as a result.
Fig. 5. compare the specific detection of miR141 and its Point mutont.
Embodiment
Term " ATP molecular motor " refers to the chromatophore that contains atp synthase that derives from Thermophilic Bacteria when being used for herein.Atp synthase (ATP synthase) is distributed widely on the plasma membrane of mitochondrial inner membrane, chloroplast thylakoids, heterotroph and photosynthetic bacteria, participates in oxidative phosphorylation and photophosphorylation, synthetic ATP under the promotion of cross-film PMF.Molecular structure is comprised of the Fo hydrophobic tail that protrudes from the outer F1 hydrophilic head of film and embed in the film.The photosynthesis of photosynthetic bacteria is to carry out at the cell inner membrance that contains photosynthetic pigments.This inner membrance is little blister or flat cryptomere, is distributed in cell peripheral, is called chromatophore.
The magnetic bead that the present invention uses is through Streptavidin (streptavidin) or has the coated micron of the derivant of equivalent action and be connected with biotinylated probe to the tri-iron tetroxide paramagnetic beads of nanoscale, but be not limited only to this standard, by intermolecular interaction or chemical coupling mode the method that probe is connected to magnetic bead surfaces all be suitable for the present invention.The magnetic bead surfaces electric charge can exert an influence to the detection of different molecular, and it is long-pending that the magnetic bead diameter can affect magnetic bead surfaces, thereby affects the binding ability of unit mass magnetic bead.
1.ATP molecular motor preparation:
Thermophilic Bacteria Thermomicrobium roseum bacterial classification (ATCC27502 is purchased from U.S. ATCC species storehouse) is inoculated in the fluid nutrient medium (seeing Table 1) in proportion at 1: 100, and 60 ℃, 150rpm are cultivated 24h.Then 4000rpm, 30min, 4 ℃ of centrifugal collection thalline.With Extraction buffer (20mM Tris-ClpH8.0,100mM NaCl, 2mM MgCl
2, 1mM DTT) and resuspended thalline, the centrifugal supernatant (6000rpm, 10min, 4 ℃) that goes.Add the resuspended thalline of Extraction buffer (approximately the 1g thalline adds the 10ml damping fluid), add again the PMSF that final concentration is 1mM, on ice ultrasonication 30min (ultrasonic 5s stops 8s, power 300W).With broken thalline centrifugal (25,000g, 30min, 4 ℃), go precipitation to get supernatant.With supernatant ultracentrifugation (145,000g, 1h, 4 ℃), get to precipitate and be chromatophore (Chromatophore) (it is the vesica that turns up that the bacterium Plasmalemma invagination forms, and contains atp synthase on the chromatophore film, is the synthetic important tool with being hydrolyzed of research Proton Transport character and ATP).Obtain chromatophore solution with the resuspended precipitation of Extraction buffer at last, if do not use immediately then add the glycerine-80 ℃ preservation of final concentration 50%.
Table 1.Thermobacterium nutrient culture media
| Yeast extract | 1g |
[0043]?
| Tryptone | 1g |
| (NH4) 2SO 4 | 1.3g |
| MgSO 4·7H 2O | 0.247g |
| KH 2PO 4 | 0.28g |
| CaCl 2·2H 2O | 0.074g |
| FeCl 3·6H 2O | 0.019g |
| Salt solusion * | 1ml |
| Agar | 20g (when the preparation solid medium, adding) |
| Distilled water | 1L |
Annotate: nutrient culture media prepares regulates pH=8.5 with NaOH, 120 ℃ of sterilization 20min afterwards
*: the compound method of salt solusion: in 1L distilled water, add 1.8g MnCl
24H
2O, 4.4gNa
2B
4O
710H
2O, 0.22g ZnSO
47H
2O, 0.05g CuCl
2H
2O, 0.03g Na
2MoO
42H
2O, 0.03g VOSO
42H
2O uses H afterwards
2SO
4Regulate pH=2.0.
Carry out sucrose density gradient centrifugation: sucrose (20-60%) aqueous solution of preparation variable concentrations, in the density gradient centrifugation pipe, add respectively from bottom to top 60% sucrose 1ml, 50% sucrose 2ml, 40% sucrose 2ml, 30% sucrose 2ml and 20% sucrose 2ml, notice that whenever adding one deck all should try one's best carefully, does not allow it miscible in order to avoid affect separating effect.With prepared not glycerinated 2ml chromatophore solution joining on the saccharose gradient along tube wall gently, collect the chromatophore of the second layer behind the centrifugal 1.5h of 38000rpm again, carry out the ATP hydrolysing activity with enzyme coupling method and measure, detect grain size with dynamic light scattering.Collect rear 4 ℃ of centrifugal 90min of 40000rpm, to be put in-70 ℃ of refrigerators after resuspended for subsequent use with containing the PBS of 30% glycerine to get precipitation.
Measure chromatophorous ATP hydrolysing activity: ATP enzyme hydrolysis activity determination method is to utilize spectrophotometric method, and the reaction of coupling pyruvate kinase and lactic dehydrogenase is measured NADH in the minimizing of 340nm place optical density, obtains the amount of hydrolysis of ATP.The hydrolysis damping fluid (50mM Tris-Cl pH8.0,10mM KCl, the 2mM MgCl that at first in cuvette, add 400ul
2) and zeroing, then add 1ul NADH (100mM) and make OD340nm=0.8-1.Add respectively again 4ul PEP (50mM), 4ul ATP (200mM), 2ul PK (1U/ul), 2ul LDH (1U/ul), after the OD340nm absorption value was stable, the chromatophore that adds 5ul carried out determination of activity at 37 ℃, until the OD340nm absorption value is constant.The record absorption value changes and enzyme reaction Time Calculation enzyme is lived.1U ATP enzyme hydrolysis activity is defined as the enzyme per minute in the amount of 37 ℃ of hydrolysising ATPs.
2. two probe design and preparation:
2.1 when target molecule was protein, detection of the present invention need to design monoclonal antibody for the different epi-positions of same antigen (protein molecular) as capture probe and detector probe.Antibody can be bought a commercial antagonist for the different epi-positions of same antigen.Capture antibody and detection antibody biotin (biotin) change process are as follows: with 2 μ l (+)-Biotin N-hydroxysuccinimide ester (10mM) (sigma, article No. H1759) is added to respectively in 500 μ l capture antibodies (20 μ M) and the detection antibody (20 μ M), incubated at room 4h, (+) of dissociating-Biotin N-hydroxysuccinimide ester removes by the PBS dialysis, change three dislysates (PBS), dialysed 8 hours at every turn.The good biotinylated antibody of collecting dialysis add 50% glycerine place-20 ℃ frozen for subsequent use.
2.2 when target molecule was nucleic acid, detection of the present invention need to design for two nucleic acid probes of same nucleotide sequence diverse location capture probe and detector probe as nucleic acid.Synthetic and the biotin (biotin) of nucleic acid probe is modified and can be undertaken by biotech firm.
3. the mark of probe
Biotinylated capture probe is connected to the coated magnetic bead surfaces of streptavidin (streptavidin).For detector probe, at first with PE-cap-biotin (available from avanti company, 870277P) mark is to the chromatophore surface, then coated NeutrAvidin is (available from Thermo fisher company, article No. 31050), then with biotin (biotin) mark detector probe, at last biotinylated detector probe is connected to the chromatophore surface by the biotin-NeutrAvidin-biotin system.Concrete preparation process is as follows:
3.1 capture probe mark magnetic bead:
If 3.1.1 labeling nucleic acid probe, get the 100ul10mg/ml diameter and be the coated magnetic bead of streptavidin of 1um (available from life technology company, article No. 650.02, diameter 1um, 10mg/ml)), with elution buffer (5mM Tris-HCL, 1M NaCl, 0.5mM EDTA) wash three times, separate by magnetic and remove the composition of preserving liquid.(10mM Tris-HCL, 2M NaCl, 1mM EDTA) is resuspended with 200ul binding buffer liquid.The biotinylated nucleic acid probe (capture probe) that is fit to concentration is added the above-mentioned magnetic bead of handling well, room temperature reaction 15 minutes, rock during this time and guarantee that magnetic bead does not precipitate, separating the probe that will dissociate by magnetic removes, ((20X SSC dilutes four times and obtains 5X SSC 5X SSC with the 100ul hybridization buffer, 20X SSC prescription is as follows: the 0.3mol/L sodium citrate, 3.0mol/L sodium chloride), (50X denhardts liquid is 5X denhardts liquid: 1% (m/V) glycan body, 400 (Ficoll400), 1% (m/V) polyvinylpyrrolidone (PVP), 1% (m/V) bovine serum albumin(BSA) (component V) obtains 5X denhardts liquid with 10 times of its dilutions)) resuspended stand-by.
3.1.2 if labelled antibody is got the 100ul10mg/ml diameter and is the coated magnetic bead of streptavidin of 2.8um (available from life technology company, article No. 112.06D, diameter 2.8um, 10mg/ml), wash three times with PBS, separate by magnetic and remove the composition of preserving liquid.Resuspended with 200ul PBS.The biotinylated antibody probe (capture probe) (optimizing concentration according to concrete probe needs) that 200ul is fit to concentration, add the above-mentioned magnetic bead of handling well, room temperature reaction 15 minutes, rock during this time and guarantee that magnetic bead does not precipitate, separate the probe that to dissociate by magnetic and remove, wash three times with PBS.Resuspended stand-by with 100ul PBS.
3.2 detector probe-chromatophore preparation:
3.2.1NeutrAvidin-PE-cap-biotin-chromatophore preparation: the PE-cap-biotin (methyl alcohol dissolving) of 1ul5mg/ml is added in the chromatophore that obtains after the 1ml sucrose gradient centrifugation, add 9ml PBS damping fluid (pH7.4), 4 ℃ of marks 30 minutes slowly shake make reaction evenly simultaneously.Minute install in 10 EP pipes after reaction finishes, every pipe 1ml, under 40000 rotating speeds 4 ℃ centrifugal 20 minutes, remove supernatant, triplicate removes free PE-cap-biotin, the resuspended precipitation of every effective 1ml PBS, add respectively 50ul10mg/ml NeutrAvidin (available from Thermo fisher company, article No. 31050), room temperature reaction 15 minutes, then under rotating speed 40000rpm, 4 ℃ centrifugal 10 minutes, remove supernatant, the NeutrAvidin that the triplicate flush away is free.The PBS that every effective 200ul contains 30% glycerine is resuspended, the bag be stored in-20 ℃ for subsequent use.
3.2.2 get the prepared NeutrAvidin-PE-cap-biotin-chromatophore of 50ul, add 1mlPBS, 40000rpm, 4 ℃, removed glycerine in centrifugal 10 minutes, resuspended with 1ml PBS.
3.2.3 add to be fit to the biotin labeled detector probe (optimizing reaction conditions according to the different probe needs) of concentration, room temperature reaction 15 minutes, after reaction finishes under 40000rpm centrifugal force 4 ℃ centrifugal 10 minutes, remove unconjugated probe, triplicate.At last with the resuspended detection antibody-chromatophore of 100ul PBS or for subsequent use with the resuspended detection of nucleic acids probe-chromatophore of 100ul hybridization buffer.
4. target molecule hybridizing method:
4.1 the detection system when biomolecule to be measured is protein
At first sealing is marked with the magnetic bead of capture probe: with containing 2% gelatin, the confining liquid of 0.01%Tween20 seals, room temperature one hour, afterwards with magnetism separate method with PBST (the PBS solution that contains 0.01%Tween20) washing magnetic bead once.Antigen (albumen) sample is diluted to suitable concn with PBST, carries out protein hybridization according to following system:
Antigen-antibody is spent association reactions 1 hour 37, afterwards with PBST washing three times, again with PBS washing three times.
4.2 the detection system when biomolecule to be measured is nucleic acid
Carry out nucleic acid hybridization according to following system:
Hybridization temperature is 25-45 degree centigrade, according to different target molecule optimal conditions.Hybridization time is 10 minutes.Hybridization is put on ice rapidly after finishing, and by magnetism separate method unconjugated free molecule and chromatophore is removed, afterwards with PBST washing three times, again with PBS washing three times.
5.ATP synthetic reaction
Magnetic bead with above-mentioned hybridization finishes separates magnetic bead with magnet, removes supernatant, adds 50ul and starts damping fluid (50mM Tricine-NaOH, 5mM MgCl
2, 5mM NaH
2PO
4, 10% glycerine 0.3uMADP), carries out the ATP synthetic reaction at 42 degree, and the reaction time is 30 minutes.
6.ATP chemiluminescence detection:
After the ATP synthetic reaction finishes each reaction tube is placed on ice, use magnetism separate method, magnetic bead is adsorbed onto tube wall, get supernatant 20ul and join in 96 blank plates, every hole is done two and is answered holes, add again the ATP detection kit (
ATP Assay System, article No.: FF2021, Promega) working fluid 40ul, carry out reading at Chemiluminescence Apparatus behind the mixing immediately.
7. interpretation of result
Detection arranges blank (magnetic bead is only arranged, do not have chromatophore), negative control (water is as negative control), positive control (positive criteria sample, it contains the molecules detected of variable concentrations) and testing sample.If sample contains target molecule, then can show higher chemiluminescence readings, if do not contain target molecule, then chemiluminescence reading and negative control are without significant difference.
1. prepare chromatophore according to the method described in the embodiment 1.
2. the preparation of capture antibody and detection antibody: used c reactive protein (CRP) is bought from meridianlifescience (A97201H).Used capture antibody is CRP monoclonal antibody M86842M (meridianlifescience), and used detection antibody is CRP monoclonal antibody M86284M (meridianlifescience).Its biotinylation process is: with 2 μ l (+)-BiotinN-hydroxysuccinimide ester (10mM) (sigma, article No. H1759) being added to respectively 200 μ lCRP capture antibody M86842M (5mg/ml) and CRP detects among the antibody M86284M (7.5mg/ml), incubated at room 4h, (+) of dissociating-Biotin N-hydroxysuccinimide ester removes by the PBS dialysis, change three dislysates (PBS), dialysed 8 hours at every turn.The good biotinylated antibody of collecting dialysis add 50% glycerine place-20 ℃ frozen for subsequent use.
3. prepare the NeutrAvidin-PE-cap-biotin-chromatophore according to the method described in the embodiment 1.
4.CRP detect antibody M86284M mark NeutrAvidin-PE-cap-biotin-chromatophore: add the biotinylated CRP of 30ul in the prepared NeutrAvidin-PE-cap-biotin-chromatophore of 50ul and detect antibody M86284M, be diluted to 200ul with PBS, room temperature reaction 15 minutes, after reaction finishes under 40000rpm centrifugal force 4 ℃ centrifugal 10 minutes, remove free detection antibody, triplicate.Use at last 100ulPBS resuspended for subsequent use.
5.CRP the magnetic bead that capture antibody M86842M mark streptavidin is coated: get the 100ul10mg/ml diameter and be the coated magnetic bead of streptavidin of 2.8um (available from life technology company, article No. 112.06D, diameter 2.8um, 10mg/ml), with elution buffer (5mM Tris-HCL, 1MNaCl, 0.5mM EDTA) wash three times, separate by magnetic and remove the composition of preserving liquid.Resuspended with 200ul PBS.Magnetic bead after getting the biotinylated CRP capture antibody of 10ug M86842M and processing mixes, be diluted to 200ul with PBS, reacted 15 minutes, and washed three times by the magnetic separation and remove free capture antibody, obtain the magnetic bead of CRP capture antibody M86842M mark with the resuspended precipitation of 100ulPBS.
6. sealing is marked with the magnetic bead of capture probe: with containing 2% gelatin, the confining liquid of 0.01%Tween20 seals, room temperature one hour, afterwards with magnetism separate method with PBST washing magnetic bead once.
7. antigen detects: the CRP sample is diluted to suitable concn with PBST (containing 0.01%Tween20PBS), is respectively 33fg/ml, and 3.3pg/ml, 330pg/ml, 33ng/ml, carry out protein hybridization according to following system:
The CPR sample of variable concentrations is spent association reactions 1 hour with the magnetic bead that is marked with capture probe and the chromatophore that is marked with detector probe 37, use afterwards PBST (containing 0.02%Tween20PBS) washing three times, again with PBS washing three times.
8.ATP synthetic reaction
Magnetic bead with above-mentioned hybridization finishes separates magnetic bead with magnet, removes supernatant, adds 50ul and starts damping fluid (50mM Tricine-NaOH, 5mM MgCl
2, 5mM NaH
2PO
4, 10% glycerine 0.3uMADP), carries out the ATP synthetic reaction at 42 degree, and the reaction time is 30 minutes.
9.ATP chemiluminescence detection
After the ATP synthetic reaction finishes each pipe is placed on ice, use magnetism separate method, magnetic bead is adsorbed onto tube wall, get supernatant 20ul and join in the 96 hole blanks, each hole is done two and is answered holes, add again the luciferin/luciferase working fluid (the ATP detection kit (
ATP Assay System, article No.: FF2021, Promega) 40ul, carry out reading at Chemiluminescence Apparatus behind the mixing immediately.
10. interpretation of result
Detection arranges blank (magnetic bead is only arranged, do not have chromatophore), negative control (water is as negative control), positive control (positive criteria sample) and testing sample.If sample contains target molecule, then can show higher chemiluminescence readings, if do not contain target molecule, then chemiluminescence readings and negative control are without significant difference.The result as shown in Figure 2, raise with CRP concentration, the ATP synthesizing activity reduces, in order to study its mechanism, we have carried out electron microscopic observation to the magnetic bead form that is combined with variable concentrations CRP, the result as shown in Figure 3, when not having CRP to exist (contrast), do not have molecular motor to be attached on the magnetic bead, magnetic bead is than the disperse state distribution, when the CRP that 0.0003pg/L is arranged exists, magnetic bead is slight state of aggregation, and when CRP with higher concentration (30ng/L) when CRP exists, the aggregation extent of magnetic bead is maximum, has hindered on the contrary the activity of molecular motor.The method presents reverse sensitivity characteristic, be that concentration of target molecules is lower, detection signal is higher, and traditional detection method, detection signal increases with concentration of target molecules and increases, and when concentration of target molecules is low to a certain extent, is subject to detecting the impact of lower bound, detection sensitivity can further not improve, and the characteristic that the present invention is directed to the reverse sensitivity that presents when CRP detects can improve the sensitivity of detection greatly.
Detect as target nucleic acid molecule with a kind of microRNA (miR141).
1. prepare chromatophore according to the method described in the embodiment 1.
2.miR141 the preparation of capture probe and detector probe:
(sequence of miR141 is: UAACACUGUCUGGUAAAGAUGG) the biological company limited of lucky agate synthesizes standard sequence to miR141 in Shanghai, with pyrocarbonic acid diethyl ester (DEPC water 0.1%) it is diluted to 20uM as storage liquid, before the experiment storage liquid is diluted to variable concentrations (be respectively 0,1nM, 5nM, 10nM, 20nM, 40nM) with DEPC water.
The capture probe of synthesizing biotinylated and detector probe (the biological company limited of the lucky agate in Shanghai):
Capture probe miRNA141-1:biotin-AAAAAAAAAA
CCATCTTTACC
Detector probe miRNA141-2:
AGACAGTGTTAAAAAAAAAAA-biotin
In order to reduce space steric effect, designed polyadenylic acid prolongation probe length at the 5 ' end of capture probe miRNA141-1 and the 3 ' end of detector probe miRNA141-2, increase the hybridization probability.
3. prepare the preparation of NeutrAvidin-PE-cap-biotin-chromatophore according to the method described in the embodiment 1.
4. detector probe miRNA141-2 mark NeutrAvidin-PE-cap-biotin-chromatophore: in 50ul NeutrAvidin-PE-cap-biotin-chromatophore, add the biotinylated detector probe miRNA141-1 of 30ul, be diluted to 200ul with PBS, room temperature reaction 15 minutes, after reaction finishes under 40000rpm centrifugal force 4 ℃ centrifugal 10 minutes, remove free detection antibody, triplicate.((20XSSC dilutes four times and obtains 5XSSC 5X SSC to use at last the 100ul hybridization buffer, the 20XSSC prescription is as follows: the 0.3mol/L sodium citrate, 3.0mol/L sodium chloride), (50Xdenhardts liquid is 5X denhardts liquid: 1% (m/V) glycan body, 400 (Ficoll400), 1% (m/V) polyvinylpyrrolidone (PVP), 1% (m/V) bovine serum albumin(BSA) (component V) dilutes 10 times and obtains 5X denhardts liquid)) resuspended for subsequent use.
5. the coated magnetic bead of capture probe miRNA141-1 mark streptavidin: get the 100ul10mg/ml diameter and be the coated magnetic bead of streptavidin of 1um (available from life technology company, article No. 650.02, diameter 1um, 10mg/ml), with elution buffer (5mM Tris-HCL, 1MNaCl, 0.5mM EDTA) wash three times, separate by magnetic and remove the composition of preserving liquid.(10mM Tris-HCL, 2M NaCl, 1mM EDTA) is resuspended with 200ul binding buffer liquid.The capture probe miRNA141-1 that is fit to concentration is added the above-mentioned magnetic bead of handling well, room temperature reaction 15 minutes, rock during this time and guarantee that magnetic bead does not precipitate, separating the probe that will dissociate by magnetic removes, (20XSSC dilutes four times and obtains 5XSSC with hybridization buffer 5X SSC, the 20XSSC prescription is as follows: the 0.3mol/L sodium citrate, 3.0mol/L sodium chloride), (50X denhardts liquid is 5X denhardts liquid: 1% (m/V) glycan body, 400 (Ficoll400), 1% (m/V) polyvinylpyrrolidone (PVP), 1% (m/V) bovine serum albumin(BSA) (component V) dilutes 10 times and obtains 5X denhardts liquid) 100ul is resuspended stand-by.
6. carry out nucleic acid hybridization according to following system
Hybridization temperature be the 25-45 degree all can, hybridization time is 10 minutes.Hybridization is put on ice rapidly after finishing, and by magnetism separate method unconjugated free molecule and chromatophore is removed, and uses afterwards PBST (PBS that contains 0.02%Tween20) washing three times, again with PBS washing three times.
7.ATP synthetic reaction: the magnetic bead with above-mentioned hybridization finishes, separate magnetic bead with magnet, remove supernatant, add 50ul and start damping fluid (50mM Tricine-NaOH, 5mM MgCl
2, 5mMNaH
2PO
4, 10% glycerine, 0.3uM ADP), carry out the ATP synthetic reaction at 42 degree, the reaction time is 30 minutes.
8.ATP chemiluminescence detection: the ATP synthetic reaction places each pipe on ice after finishing, use magnetism separate method, magnetic bead is adsorbed onto tube wall, get supernatant 20ul and join in 96 blank plates, each sky is done two multiple holes, add again 40ul luciferin/luciferase working fluid (the ATP detection kit:
ATP Assay System, article No.: FF2021, Promega), carry out reading at Chemiluminescence Apparatus immediately behind the mixing.
9. interpretation of result: detect blank (magnetic bead is only arranged, do not have chromatophore) is set, negative control (water is as negative control), positive control (synthetic miR141 standard model) and testing sample.If contain miR141 in the sample, then can show higher chemiluminescence readings, if do not contain target molecule, then chemiluminescence readings and negative control are without significant difference.The result as shown in Figure 4, miR141 is linear dependence with chemiluminescence intensity in the 1-40nM scope, can quantitatively detect.Whole testing process is no more than 2 hours, and traditional micro RNA detection method is to carry out reverse transcription, real time PCR carries out quantitative test, length consuming time, required reagent apparatus expensive, operation requirements is strict, and reagent instrument required for the present invention is common, and only need to use traditional Chemiluminescence Apparatus detects low price, simple to operate, detection time is short, and 96 orifice plates can carry out high flux and detect, and also can carry out quantitative test, can further improve detection sensitivity through optimizing, be conducive to promote the use of on a large scale.
With the positive standard of miR141, carry out specific detection take two point mutation miR141m-1 and miR141m-2 as the simple point mutation sequence.Mutant nucleotide sequence is respectively:
miR141m-1：UAAC
UCUGUCUGGUAAAGAUGG；
miR141m-2：UAACACUGUCUGGUAAA
CAUGG。
Concrete detection method is with embodiment 3, used probe is with embodiment 3, sample comprises negative control, 10nM positive criteria miR141,10nM miR141m-1, miR141m-2, the result as shown in Figure 5, can produce higher chemiluminescence signal with the miR141 of probe complete complementary, and contain the sequence miR141m-1 of point mutation and chemiluminescence signal and negative control no significant difference that miR141m-2 produces, and this explanation the method for the invention can well be distinguished simple point mutation micro RNA sequence, and the method required time is less than 2 hours, simple to operate, required reagent and instrument are not expensive, and traditional reverse transcription PCR and real time PCR method length consuming time, required reagent apparatus expensive, operation requirements is strict, is unfavorable for carrying out in a large number.
Claims (12)
1. macromolecular method of detection of biological said method comprising the steps of:
A. capture probe is connected with magnetic bead;
B. detector probe is connected with the ATP molecular motor;
The magnetic bead that is connected with capture probe that c. will obtain by step a and the ATP molecular motor that is connected with detector probe and the biological sample bulk crossing to be measured that obtains by step b;
D. behind step c, magnetic bead is carried out magnetic and separate, the magnetic bead that separates is joined carry out the ATP synthetic reaction in the reaction mixture that contains ADP; And
E. after the ATP synthetic reaction finishes, get the reaction supernatant that does not contain magnetic bead and carry out reading at Chemiluminescence Apparatus;
Wherein said capture probe and described detector probe respectively with the different parts specific binding of the biomacromolecule that detects.
2. method according to claim 1, wherein said biomacromolecule is protein, and described capture probe and described detector probe are respectively the specific antibodies for two different epi-positions of described protein.
3. method according to claim 2, wherein said protein is c reactive protein (CRP), described capture probe and described detector probe are respectively monoclonal antibody M86842M and the M86284M of CRP.
4. method according to claim 1, wherein said biomacromolecule is DNA, and described capture probe and described detector probe is respectively and 5 ' end of described DNA positive-sense strand sequence and 3 ' the end a pair of nucleic acid molecules of complementation respectively.
5. method according to claim 1, wherein said biomacromolecule is RNA, and described capture probe and described detector probe is respectively and 5 ' end of described RNA sequence and 3 ' the end a pair of nucleic acid molecules of complementation respectively.
6. each described method according to claim 1-5, wherein in described step a, described capture probe is marked with biotin, and described magnetic bead is coated with streptavidin, and described capture probe and described magnetic bead link together by the interaction of biotin and streptavidin.
7. each described method according to claim 1-5, wherein in described step b, described detector probe is marked with biotin, described ATP molecular motor is marked with NeutrAvidin-PE-cap-biotin, and described detector probe and described ATP molecular motor link together by biotin-NeutrAvidin-biotin system.
8. each described method according to claim 1-5, wherein in described steps d, described ATP synthetic reaction is carried out at 42 ℃.
9. each described method according to claim 2 or in 3 wherein in described step c, before carrying out bulk crossing, is sealed processing to the described magnetic bead that is connected with capture probe that obtains by step a.
10. each described method according to claim 2 or in 3, wherein in described step c, described hybridization is carried out at 37 ℃.
11. each described method according to claim 4 or in 5, wherein in described step c, described hybridization is carried out at 25-45 ℃.
12. the kit for detection of biomacromolecule, described kit comprises:
Capture probe;
Magnetic bead;
Detector probe;
The ATP molecular motor; With
The reaction mixture that contains ADP;
Wherein said capture probe and described detector probe respectively with the different parts specific binding of the biomacromolecule that detects.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310186289.6A CN103308690B (en) | 2013-05-20 | 2013-05-20 | Biosensor construction and detection method based on molecular motor, magnetic enrichment and double-probe hybridization |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310186289.6A CN103308690B (en) | 2013-05-20 | 2013-05-20 | Biosensor construction and detection method based on molecular motor, magnetic enrichment and double-probe hybridization |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103308690A true CN103308690A (en) | 2013-09-18 |
| CN103308690B CN103308690B (en) | 2015-03-18 |
Family
ID=49134135
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310186289.6A Expired - Fee Related CN103308690B (en) | 2013-05-20 | 2013-05-20 | Biosensor construction and detection method based on molecular motor, magnetic enrichment and double-probe hybridization |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103308690B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108195811A (en) * | 2018-01-12 | 2018-06-22 | 海南大学 | A kind of nano-sensor of molecular probe functionalization pyruvate kinase quickly detects microorganism |
| WO2019075769A1 (en) * | 2017-10-16 | 2019-04-25 | 苏州长光华医生物医学工程有限公司 | Method for detecting hypersensitive c-reactive protein |
| CN114149985A (en) * | 2021-12-06 | 2022-03-08 | 杭州优玛达生物科技有限公司 | Preparation method and application of molecular motor |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1513752A (en) * | 2002-12-31 | 2004-07-21 | 中国科学院生物物理研究所 | Biomolecule motor magnetic regulating and controlling device |
| WO2005080603A2 (en) * | 2003-12-17 | 2005-09-01 | Arizona Board Of Regents, A Body Corporate Acting On Behalf Of Arizona State University | Single molecule detection using molecular motors |
| CN101993820A (en) * | 2009-08-21 | 2011-03-30 | 殷勤伟 | Method for manufacturing rotary type sensor used for rapidly, sensitively and specifically detecting trace small RNAs |
| WO2011045570A2 (en) * | 2009-10-14 | 2011-04-21 | Le Centre National De La Recherche Scientifique | Biosensor |
| CN102183648A (en) * | 2011-01-26 | 2011-09-14 | 中国科学院上海微系统与信息技术研究所 | Detection method and detection kit for detecting special pathogenic bacteria by bioluminescence |
| CN102253193A (en) * | 2010-05-20 | 2011-11-23 | 上海医脉赛科技有限公司 | Magnetic fluorescent kit for rapidly detecting microbes as well as preparation method and use method thereof |
| CN102912021A (en) * | 2012-10-23 | 2013-02-06 | 北京出入境检验检疫局检验检疫技术中心 | Molecular motor biosensor kit for molecular subtyping of salmonella |
-
2013
- 2013-05-20 CN CN201310186289.6A patent/CN103308690B/en not_active Expired - Fee Related
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1513752A (en) * | 2002-12-31 | 2004-07-21 | 中国科学院生物物理研究所 | Biomolecule motor magnetic regulating and controlling device |
| WO2005080603A2 (en) * | 2003-12-17 | 2005-09-01 | Arizona Board Of Regents, A Body Corporate Acting On Behalf Of Arizona State University | Single molecule detection using molecular motors |
| CN101993820A (en) * | 2009-08-21 | 2011-03-30 | 殷勤伟 | Method for manufacturing rotary type sensor used for rapidly, sensitively and specifically detecting trace small RNAs |
| WO2011045570A2 (en) * | 2009-10-14 | 2011-04-21 | Le Centre National De La Recherche Scientifique | Biosensor |
| CN102253193A (en) * | 2010-05-20 | 2011-11-23 | 上海医脉赛科技有限公司 | Magnetic fluorescent kit for rapidly detecting microbes as well as preparation method and use method thereof |
| CN102183648A (en) * | 2011-01-26 | 2011-09-14 | 中国科学院上海微系统与信息技术研究所 | Detection method and detection kit for detecting special pathogenic bacteria by bioluminescence |
| CN102912021A (en) * | 2012-10-23 | 2013-02-06 | 北京出入境检验检疫局检验检疫技术中心 | Molecular motor biosensor kit for molecular subtyping of salmonella |
Non-Patent Citations (1)
| Title |
|---|
| 张捷等: "分子马达传感器对沙门氏菌快速检测方法的初步研究", 《食品工业科技》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019075769A1 (en) * | 2017-10-16 | 2019-04-25 | 苏州长光华医生物医学工程有限公司 | Method for detecting hypersensitive c-reactive protein |
| CN108195811A (en) * | 2018-01-12 | 2018-06-22 | 海南大学 | A kind of nano-sensor of molecular probe functionalization pyruvate kinase quickly detects microorganism |
| CN114149985A (en) * | 2021-12-06 | 2022-03-08 | 杭州优玛达生物科技有限公司 | Preparation method and application of molecular motor |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103308690B (en) | 2015-03-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7048564B2 (en) | Methods and systems for detecting microorganisms | |
| Yi et al. | The research of aptamer biosensor technologies for detection of microorganism | |
| Wu et al. | A sensitive aptasensor for the detection of Vibrio parahaemolyticus | |
| JP3706890B2 (en) | Method for detecting organisms in a sample | |
| US20040018495A1 (en) | Microparticle based signal amplification for the detection of analytes | |
| WO2017181339A1 (en) | Method and kit for simultaneous detection of protein ligand and gene | |
| JP2014527183A (en) | Molecular diagnostic assay device and method of use | |
| JP2004317520A (en) | Taxonomic identification of pathogenic microorganism and toxic protein of the pathogenic microorganism | |
| US20200363406A1 (en) | Highly-specific assays | |
| Vishwakarma et al. | Aptamer-based approaches for the detection of waterborne pathogens | |
| CN103308690B (en) | Biosensor construction and detection method based on molecular motor, magnetic enrichment and double-probe hybridization | |
| Daramola et al. | Functionalized inorganic nanoparticles for the detection of food and waterborne bacterial pathogens | |
| US20160258938A1 (en) | Method of detecting an analyte in a sample | |
| EP0441469A1 (en) | Immunospecific and bioluminescent assay of cellular ATP | |
| Yu et al. | Immunological methods | |
| Kim et al. | A rapid and sensitive immunoassay for detection of E. coli O157: H7 using multienzyme—Au nanoparticle complex | |
| Li et al. | Discovery and translation of functional nucleic acids for clinically diagnosing infectious diseases: Opportunities and challenges | |
| US20060257929A1 (en) | Method for the rapid taxonomic identification of pathogenic microorganisms and their toxic proteins | |
| CN116338171A (en) | Washing-free homogeneous detection method | |
| AU2021100496A4 (en) | A fast qualitative and quantitative kit for microorganisms and a fast qualitative and quantitative method | |
| CN112505117A (en) | Ferrocene nanoflower, electrochemical aptamer biosensor system and preparation method and application thereof | |
| CN113189193B (en) | Tunneling magnetic resistance biosensor and preparation method and application thereof | |
| Liu et al. | Detection of Escherichia coli using luminometer with pyruvate kinase | |
| Pięta et al. | Application of an aptamer and a reagent based on gold nanoparticles for detection of Escherichia coli | |
| KR20060094315A (en) | Device and method for detection of environmental pathogens |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150318 |