CN103305609A - Detection method and application of single nucleotide polymorphism of yellow cattle NRIP1 (Nuclear Receptor Interacting Protein 1) gene - Google Patents

Abstract

The invention discloses a detection method and application of single nucleotide polymorphism of a yellow cattle NRIP1 (Nuclear Receptor Interacting Protein 1) gene. The detection method comprises the steps of: with a cattle whole genome DNA (Deoxyribonucleic Acid) to be detected containing the NRIP1 gene as a template and a primer pair P605 which is artificially designed as a primer, carrying out PCR (Polymerase Chain Reaction) amplification on the cattle NRIP1 gene, digesting a PCR amplification product by virtue of restriction endonuclease AluI, and carrying out agarose gel electrophoresis on an amplification fragment after enzyme digestion; and identifying the single nucleotide polymorphism of a 605th site of the yellow cattle NRIP1 gene according to an agarose gel electrophoresis result. According to the detection method disclosed by the invention, as the NRIP1 gene relates to the growth traits of body weight, daily gain and the like, a foundation of establishing a relationship between the SNP (Single Nucleotide Polymorphism) of the NRIP1 gene and the growth traits is laid so as to be used for marker-assisted selection (MAS) breeding of the growth traits of a Chinese yellow cattle and be beneficial to rapidly establishing a yellow cattle population with excellent genetic resources.

Description

A kind of detection method and application of ox NRIP1 gene mononucleotide polymorphism

Technical field

The invention belongs to the Animal molecular breeding field, relate to gene mononucleotide polymorphism, be specifically related to a kind of detection method and application of ox NRIP1 gene mononucleotide polymorphism.

Background technology

Single nucleotide polymorphism (SNP) just refers in the genomic dna sequence polymorphism that the replacement owing to single core thuja acid (A/T/C/G) causes.

Ox is one of human important domestic animal species resource, and it is playing the part of important role in various countries social economy and people's life.Along with the raising of China's expanding economy and people's living standard, society constantly strengthens the demand of dairy products, and expectation ox breeding expert cultivates the improved seeds that obtain more early, better, quickly dairy products as early as possible.On high yield, high-quality and efficient ox breeding objective, ox breeding expert pays close attention to Growth Traits always, but present problem is to only depend on the traditional breeding method means constantly to improve and improve these proterties, obviously be not all right, also need the intervention of the modern molecular breeding technology of marker assisted selection (MAS) mediation.

In numerous methods of seeking molecular genetic marker, PCR-RFLP is the effective technology of a kind of SNP of detection wherein, uses restriction enzyme to cut after finding the SNP site, then carries out the agarose gel electrophoresis analysis, just can accurately differentiate the SNP site.The PCR-RFLP method not only has the accuracy of dna sequencing method, has overcome again somewhat expensive, troublesome operation, false-positive shortcoming, and the sequence site of detecting is without the singularity requirement.

NRIP1 albumen is a kind of auxiliary inhibition transcription factor of transcribing, and it can carry out negative regulation to the genetic expression of the multiple metabolizing tissues such as fat, muscle and liver by combining with the AF2 of multiple nuclear receptor.After the reticent NRIP1 gene, glycolysis-, glucose uptake, triglyceride level are synthetic, tricarboxylic acid cycle, plastosome biosynthesizing, Fatty Acid Oxidation, oxidative phosphorylation homenergic metabolic process strengthen, and the relational approach Metabolic Gene Expression raises.In the past function and the polymorphism research for the NRIP1 gene mainly concentrates on people and the mouse, the research of ox NRIP1 gene reported seldom, and be to have great importance to the research of ox NRIP1 gene therefore.Have no the Research on Genetic Variation about ox NRIP1 gene both at home and abroad, the functional study of this gene locus and heritable variation thereof and economic characters (such as body weight etc.) association study is still blank.

Summary of the invention

The problem that the present invention solves is to provide a kind of detection method and application of ox NRIP1 gene mononucleotide polymorphism, detect ox NRIP1 gene polynorphisms, and itself and growth traits carried out association analysis, verify whether it can be used as the molecule marker of assisted Selection in the ox molecular breeding, thereby accelerate the speed of fine-variety breeding, for the improvement of Chinese Cattle kind provides certain directive function.

The present invention is achieved through the following technical solutions:

A kind of detection method of ox NRIP1 gene mononucleotide polymorphism, take the cow genome group DNA to be measured that comprises the NRIP1 gene as template, take primer pair P605 as primer, pcr amplification ox NRIP1 gene, after restriction enzyme A luI digestion pcr amplification product, the amplified fragments after again enzyme being cut carries out agarose gel electrophoresis; Identify the single nucleotide polymorphism of the 605th of ox NRIP1 gene according to the agarose gel electrophoresis result;

Described primer pair P605 is:

Upstream primer F1:CCTAAAGGCAAACAGGACAGCA;

Downstream primer R1:GGTTTTCGTGACATCAGGGAAG.

Described pcr amplification reaction program is:

95 ℃ of denaturation 5min; 94 ℃ of sex change 30s of 36 circulations, 56 ℃ of annealing 30s, 72 ℃ are extended 50s; 72 ℃ are extended 10min.

The mass concentration of described sepharose was 3.0%, with 110V electrophoresis 1.5 hours.

Described the 605th single nucleotide polymorphism is: the AA genotype shows as the band of 205bp, and the GG genotype shows as the band of 183bp and 22bp, and the AG genotype shows as the band of 205bp, 183bp and 22bp.

The application of the single nucleotide polymorphism that ox NRIP1 gene is the 605th in the different ox of evaluation colony polymorphism.

The single nucleotide polymorphism that ox NRIP1 gene is the 605th is as the application of molecule marker in the assistant breeding of ox growth traits.

The application of described molecule marker in screening raising Weight of Yellow Cattle and day weight gain.

Described when assistant breeding, with genotype be the individuality of AA type reserve seed for planting expand numerous.

Described when assistant breeding, be that AA type and GG type form two underlying groups with genotype, then hybridize, obtaining genotype is the population of AG type.

Compared with prior art, the present invention has following useful technique effect:

The present invention adopts DNA pond sequencing technologies according to the primers of NRIP1 gene, and take primer pair P1, P2, P3, P4, P5 as primer, pcr amplification ox NRIP1 gene product is found the 605th of this gene through order-checking.For above-mentioned SNP polymorphism, the invention also discloses its examination and detection method, by designing the amplification of specific primer PCR, specific digestion with restriction enzyme identifies, can be simply, quick, cost is low, detect accurately the polymorphism of its mononucleotide.

The present invention has carried out detection and gene frequency analysis to the SNP genotype of 5 cattle breeds, above-mentioned SNP site and Nanyang cattle some growth proterties (such as body weight etc.) are carried out association analysis, and the result shows that this site can be as the molecule marker that improves Weight of Yellow Cattle and day weight gain proterties.

Because the NRIP1 gene function relates to the growth traitss such as body weight, detection method provided by the invention is that the SNP of NRIP1 gene and the foundation of Chinese Cattle growth traits relation are laid a good foundation, for use in the marker assisted selection of Chinese Cattle growth traits, the ox population that the Rapid Establishment genetic resources is good.

Description of drawings

Fig. 1 is ox NRIP1 gene SNP polymorphism sequencer map, and wherein bimodal is the 605th SNP site of ox NRIP1 gene.

Fig. 2 be ox NRIP1 gene c.605A G site Forced PCR-RFLP somatotype.DNA EB after 3% sepharose detects electrophoresis is coloured to picture and detects.Swimming lane 14 is Marker I; Swimming lane 1,2,4,9 is the AG genotype; Swimming lane 3,5,6,7,8,10,11 is the GG genotype; Swimming lane 13 is the AA genotype.

Specific embodiments

The present invention utilizes the PCR-RFLP method that the single nucleotide polymorphism of the 605th of ox NRIP1 gene is detected, and the present invention is described in further detail below in conjunction with the drawings and specific embodiments, what the explanation of the invention is not limited.

One, the clone of ox NRIP1 gene C DS district dna sequence dna and the detection of polymorphism thereof

1, bovine blood sample collecting

The present invention specifically amounts to 1467 ox individualities as detected object take 5 Chinese Cattle kinds, and concrete collecting sample sees Table 1:

Table 1 sample collection information table

Kind	Sample number	Sample source	Sample mode
				Nanyang cattle	225	Nanyang City, Henan Province ox seed stock breeding station (national ox conservation field)	The jugular vein blood sampling
Qinchuan Cattle	510	Qinchuan Cattle stock breeding center, Shaanxi Province	The jugular vein blood sampling
				Growth traits in Jiaxian red cattle	410	The Pingdingshan City, Henan Province growth traits in Jiaxian red cattle is bred center and each villages and small towns	The jugular vein blood sampling
The western Shandong ox	183	Western Shandong ox seed farm	The jugular vein blood sampling
				Red Steppe	139	Environment in Tongyu County of Jilin Province three home Red Steppe conservation fields	The jugular vein blood sampling

2, the extraction of blood sample genomic dna and purifying

(1), after freezing blood sample at room temperature thaws, transferase 45 00 μ L to 1.5mL Eppendorf centrifuge tube adds equal-volume PBS solution, abundant mixing, 12000r/min, 4 ℃, centrifugal 10min, supernatant discarded, the repetition above-mentioned steps is transparent to supernatant liquor, precipitation is faint yellow;

(2), in centrifuge tube, add DNA extraction buffer 500 μ L, shake mixing, make the hemocyte precipitation break away from the centrifuge tube tube wall, at 37 ℃ of water-bath 1h;

Add 3 μ L(20mg/mL) the Proteinase K mixing, 55 ℃ are spent the night to clarification, and defecator not yet continues digestion to clarification after adding 1 μ L Proteinase K mixing;

(4), reaction solution is cooled to room temperature, add the saturated phenol 500 μ L of Tris-, shake gently centrifuge tube 20min, fully mixing; 4 ℃, the centrifugal 10min of 12000r/min changes supernatant liquor in another 1.5mL centrifuge tube over to, repeats once;

(5), add 500 μ L chloroforms, abundant mixing, 4 ℃, the centrifugal 10min of 12000r/min changes supernatant in another 1.5mL centrifuge tube over to;

(6), add 500 μ L chloroforms and primary isoamyl alcohol mixed solution (24:1), abundant mixing, 4 ℃, the centrifugal 10min of 12000r/min changes supernatant in another 1.5mL centrifuge tube over to;

(7), add NaAc damping fluid and 2 times of dehydrated alcohols that volume is ice-cold of 0.1 times of volume, mix and rotate centrifuge tube, until the flocks of white is separated out, preserve 30～60min for-20 ℃;

(8), 4 ℃, the centrifugal 10min of 12000r/min, supernatant discarded, 70% ice-cold ethanol rinsing DNA precipitation 2 times;

(9), 4 ℃, the centrifugal 10min of 12000r/min makes ethanol volatilization clean under the supernatant discarded, room temperature;

(10), dried DNA is dissolved in the TE solution of 80～100 μ L, preserve until DNA dissolves fully for 4 ℃, the agarose gel electrophoresis with 0.8% detects its quality ,-80 ℃ of preservations;

(11), adding 10%SDS in the dna solution of 500 μ L, to make its ultimate density be 0.1%, add Proteinase K to final concentration and reach 50 μ g/mL, about 5 ℃ of insulation 10h;

(12), with isopyknic phenol, chloroform, primary isoamyl alcohol (25:24:1) and the extracting of chloroform difference once;

(13), 4 ℃, the centrifugal 5min phase-splitting of 12000r/min is drawn the upper strata water to another centrifuge tube;

(14), 3mol/L sodium-acetate and the 2 times of ice-cold dehydrated alcohol precipitation of volume DNA of adding 1/10 volume;

(15), gently outwell liquid, with drying after 70% washing with alcohol, add the dissolving of 60 μ L sterilization ultrapure water, detect rear 4 ℃ of storages.

3, the structure in DNA pond

With the OD value of UV-light photometric determination DNA sample at 260nm, 280nm place.Calculate dna content and OD ₂₆₀/ OD ₂₈₀Ratio, DNA concentration (ng/ μ L)=50 * OD ₂₆₀Value * extension rate.If OD ₂₆₀/ OD ₂₈₀Ratio contains more protein or phenol less than 1.6 in the interpret sample, then should carry out purifying; If ratio greater than 1.8, then should consider to remove the RNA purifying.After DNA detection is complete, takes out certain amount and be diluted to 50ng/ μ L, then 100 concentration of random selection are to get 10 μ L mixing constructed dna ponds in the 50ng/ μ LDNA sample from 9 cows bodies.

4, amplimer design

The PCR primer of design ox NRIP1 gene

The ox NRIP1 gene order that provides in the database (GenBank accession number XM_603300.3) is provided, utilize Primer5.0 software design primer, by 5 couples of primer P1～P5 in CDS district of the synthetic ox NRIP1 gene of Nanjing Jin Sirui company, as follows:

Described primer pair P1 is:

Upstream primer: 5'-AAGCCCTCGTGAACACTTCTATTG-3'

Downstream primer: 5'-TGCTGTAAATGGGCTTCACT-3 '

Described primer pair P2 is:

Upstream primer: 5'-CCAAACCCAGTGTTGCCTGTAGC-3'

Downstream primer: 5'-CCAAGCAGCAACTGAAGAAG-3 '

Described primer pair P3 is:

Upstream primer: 5'-ATTCGCACCAGAAAGTAACCCT-3'

Downstream primer: 5'-CTATCTGTATGTTCCTGAGTGC-3 '

Described primer pair P4 is:

Upstream primer: 5'-GGGAAGACTGAAAAGAAAGAGAAG-3'

Downstream primer: 5'-ACTCAAGATCACTTCTGCTAAG-3 '

Described primer pair P5 is:

Upstream primer: 5'-GCTGAAACTTAGCAGAAGTGATCTT-3'

Downstream primer: 5'-GGCAGGTCCATTTTATTCTGATTC-3 '

5, pcr amplification

The PCR reaction system adopts mixes the application of sample method, namely according to the number of the required PCR reaction of the quantity of the needed various components of each reaction system and 1 reflection, calculate the total amount of various reactive components, join in 1 1.5mL centrifuge tube, fully instantaneous centrifugal behind the mixing, then divide to install in the 0.2mL Eppendorf PCR pipe, then add template DNA, blow and beat gently the laggard performing PCR amplification of mixing;

Respectively take the DNA pond of 4 cattle breeds as template, carry out pcr amplification with the primer pair of above-mentioned design, PCR total reaction system is 25 μ L.

The PCR reaction system sees Table 2:

Table 2PCR reaction system

The system composition	Volume (μ L)
		2×Mix	12.5
Upstream primer (10pmol/L)	1.0
		Downstream primer (10pmol/L)	1.0
Taq archaeal dna polymerase (2.5U/ μ L)	0.2
		Dna profiling (100ng/ μ L)	0.5
Sterilization ultrapure water (H 2O）	9.8
		Cumulative volume	25.0

PCR response procedures: 95 ℃ of denaturation 5min; 94 ℃ of sex change 30s of 36 circulations, 56 ℃ of annealing 30s, 72 ℃ are extended 50s; 72 ℃ are extended 10min.

6, PCR product purification and order-checking pcr amplification carry out agarose gel electrophoresis after finishing, then the glue of cutting that carries out the PCR product reclaims and purifying: downcut the gel that contains the purpose fragment from sepharose under ultraviolet lamp, put into the 1.5mL centrifuge tube, then reclaim purification kit (Nanjing Jin Sirui biotech firm) purified pcr product with the PCR product, operate according to the test kit specification sheets.

The PCR product that will be with the DNA pond of above mixing template send Nanjing Jin Sirui company limited to carry out two-way order-checking.The order-checking peak figure of ox NRIP1 gene purpose fragment 258bp and the order-checking peak figure of purpose fragment 154bp are analyzed, wherein in same site two different peaks being arranged is that single nucleotide mutation has occured, 605 positions (c.605A〉G) (see figure 1) and 1301 positions (c.1301T〉C) find that peak figure is bimodal uniformly, through sequential analysis, be judged to be single nucleotide mutation.Be 2 SNP polymorphisms that ox NRIP1 gene has been arrived in examination of the present invention, be respectively: the 605th nucleotide polymorphisms and the 1301st nucleotide polymorphisms for T or C (because the 1301st polymorphism is significantly not related with growth traits, the below no longer narrates) for A or G of ox NRIP1 gene.

7, genotyping design of primers and pcr amplification

Carry out the NRIP1 gene fragment of pcr amplification ox to be measured with primer pair P605.

Described primer pair P605 is:

Upstream primer F1:5'-CCTAAAGGCAAACAGGACAGCA-3'

Downstream primer R1-AluI:5'-GGTTTTCGTGACATCAGGGA

G-3 '

Hold the 2nd to introduce base mismatch at P605 downstream primer 3 ', thereby artificially made up the restriction enzyme site of an AluI; Can use Forced PCR-RFLP method to carry out genotypic judgement, PCR product amplification system and reaction conditions are as previously described.

8, cut the NRIP1 gene fragment of digestion pcr amplification with restriction enzyme A luI enzyme

The enzyme of establishing according to table 3 system of cutting is carried out enzyme to the Forced PCR product of corresponding SNP and is cut.37 ℃ of lower enzymes are cut 5～8h, should not surpass 10h.Sepharose in 3.0% detects and somatotype different genotype, and method is loading 10 μ L, runs behind the 1h30min EB about 10min that dyes with 110V, judges the gene classification according to banding pattern.

Table 3AluI endonuclease reaction system

The system composition	Volume (μ L)
		10×L	1.0
The PCR product	7.0
		AluI	0.2
Sterilization ultrapure water (H 2O）	1.8
		Cumulative volume	10

9, according to agarose gel electrophoresis interpretation of result SNP polymorphism

The single nucleotide polymorphism that ox NRIP1 gene is the 605th is: the AA genotype shows as the band of 205bp, the GG genotype shows as two bands of 183bp and 22bp, the AG genotype shows as 205 and 3 bands of 183bp and 22bp, because that band is the band of 22bp is too little, can not see in gel.See Fig. 2.

Two, the frequency statistics analysis of ox NRIP1 gene SNP site

1, gene and genotype frequency

Genotype frequency refers to that certain genotype number of individuals of a certain proterties in the colony accounts for the ratio of total individual number.P _AA=N _AA/ N, wherein P _AARepresent the AA genotype frequency in a certain site; N _AAHas the genotypic number of individuals of AA in the expression colony; N is for detecting the total quantity of colony.

Gene frequency refers to that a certain gene number is to the relative ratios of its allelotrope sum in the colony.The formula that calculates can be write as: P _A=(2N _AA+ N _Aa1+ N _Aa2+ ... + N _Aan)/2N.In the formula, P _AExpression allelotrope A frequency, N _AAHas the genotypic individual amount of AA, N in the expression colony _AaiHave Aai genotype individual amount in the expression colony, a1-an is n the different multiple allelomorphos of allelotrope A.

At different cattle breeds NRIP1 genes c.605A〉in the G polymorphic site, gene frequency changes as shown in table 4:

Table 4 ox NRIP1 Gene A luI position population genetic distributes

Kind (Breeds)	AA	AG	GG	A	G	He	Ne	PIC
									Qinchuan Cattle (QC)	0.1133	0.2867	0.6000	0.2567	0.7433	0.3816	1.6170	0.3088
Nanyang cattle (NY)	0.0667	0.1000	0.8333	0.1167	0.8833	0.2061	1.2596	0.1849
									Western Shandong ox (LX)	0.3000	0.4000	0.3000	0.5000	0.5000	0.5000	2.0000	0.3750
Red Steppe (CY)	0.0500	0.1500	0.8000	0.1250	0.8750	0.2188	1.2800	0.1948
									Jiaxian County ox (JX)	0.0345	0.1034	0.8621	0.0862	0.9138	0.1576	1.1870	0.1451

2, the association analysis of ox NRIP1 gene SNP site genetic effect

The genotype (AA, GG and AG) of (1) genotype data: AluI identification.

(2) production data: the various growth traitss at Nanyang cattle baby weight and 6 monthly ages, 12 monthly ages, 18 monthly ages, 24 monthly ages (comprise body weight, height, body plagioclase, chest measurement, the ischium hip is wide and each monthly age day weight gain).

(3) relation analysis model:

Utilize SPSS(16.0) dependency of growth traits corresponding to the range gene type of software analysis gene locus and various age.First data are described analysis, determine whether to exist outlier, the analysis of recycling least square is proofreaied and correct data; According to data characteristics, utilize multivariate linear model analyzing gene type effect.Model is as follows:

Y _ijk=μ+A _i+G _j+Xn+E _ijk

Wherein: Y _IjkBe individual phenotype record; μ is colony's average; A _iBe age effect; G _jGenotype effect for each site; Xn is age and the genotypic effect of doing mutually; E _IjkBe random error.

The result shows (seeing Table 5): the AG genotype is better than the AA genotype, and the AA genotype is better than the GG genotype.Because AG genotype individuality all is being higher than two homozygotes aspect 18 monthly age daily weights and the weightening finish, illustrate that we are in the molecular breeding of ox, can utilize the polymorphism mark in AluI site, select AA type and GG type to form two underlying groups, then hybridize, filial generation (genotype is the AG type) because growth is fast as commercial generation, to improve the meat production of ox.So the AluI site can be used as a molecular genetic marker that improves Niu Tichong and day weight gain.

Table 5 ox NRIP1 Gene A luI site different genotype and the association analysis of Nanyang cattle growth traits

Annotate: Mean ± SE: the standard error of mean value ± mean value; P＜0.05 represents significant difference; BW represents body weight; ADG represents day weight gain.Have same letter and represent difference not remarkable (P＞0.05), the different expression of letter significant differences (P＜0.05).

Claims (9)

1. the detection method of an ox NRIP1 gene mononucleotide polymorphism, it is characterized in that: take the cow genome group DNA to be measured that comprises the NRIP1 gene as template, take primer pair P605 as primer, pcr amplification ox NRIP1 gene, after restriction enzyme A luI digestion pcr amplification product, the amplified fragments after again enzyme being cut carries out agarose gel electrophoresis; Identify the single nucleotide polymorphism of the 605th of ox NRIP1 gene according to the agarose gel electrophoresis result;

Described primer pair P605 is:

Upstream primer F1:CCTAAAGGCAAACAGGACAGCA;

Downstream primer R1:GGTTTTCGTGACATCAGGGAAG.

2. the detection method of ox NRIP1 gene mononucleotide polymorphism according to claim 1 is characterized in that, described pcr amplification reaction program is:

95 ℃ of denaturation 5min; 94 ℃ of sex change 30s of 36 circulations, 56 ℃ of annealing 30s, 72 ℃ are extended 50s; 72 ℃ are extended 10min.

3. the detection method of ox NRIP1 gene mononucleotide polymorphism according to claim 1 is characterized in that, the mass concentration of described sepharose is 3.0%, with 110V electrophoresis 1.5 hours.

4. the detection method of ox NRIP1 gene mononucleotide polymorphism according to claim 1, it is characterized in that, the 605th single nucleotide polymorphism is: the AA genotype shows as the band of 205bp, the GG genotype shows as the band of 183bp and 22bp, and the AG genotype shows as the band of 205bp, 183bp and 22bp.

5. the application of the single nucleotide polymorphism of the 605th of ox NRIP1 gene in identifying different ox colony polymorphism.

6. the single nucleotide polymorphism of the 605th of ox NRIP1 gene is as the application of molecule marker in the assistant breeding of ox growth traits.

7. application as claimed in claim 6 is characterized in that, the application of described molecule marker in screening raising Weight of Yellow Cattle and day weight gain.

8. application as claimed in claim 6 is characterized in that, when assistant breeding, with genotype be the individuality of AA type reserve seed for planting expand numerous.

9. application as claimed in claim 6 is characterized in that, when assistant breeding, is that AA type and GG type form two underlying groups with genotype, then hybridizes, and obtaining genotype is the population of AG type.

Images