CN103409497B - Sequencing method for part of DNA (deoxyribonucleic acid) of mitochondrial ND4 genes of Brachionus rotifer and identification method of Brachionus rotifer - Google Patents
Sequencing method for part of DNA (deoxyribonucleic acid) of mitochondrial ND4 genes of Brachionus rotifer and identification method of Brachionus rotifer Download PDFInfo
- Publication number
- CN103409497B CN103409497B CN201210563401.9A CN201210563401A CN103409497B CN 103409497 B CN103409497 B CN 103409497B CN 201210563401 A CN201210563401 A CN 201210563401A CN 103409497 B CN103409497 B CN 103409497B
- Authority
- CN
- China
- Prior art keywords
- brachionus
- rotifer
- dna
- wheel animalcule
- mitochondrial
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
- 241000700106 Brachionus Species 0.000 title claims abstract description 50
- 238000000034 method Methods 0.000 title claims abstract description 19
- 238000012163 sequencing technique Methods 0.000 title claims abstract description 9
- 108020004414 DNA Proteins 0.000 title abstract description 16
- 230000002438 mitochondrial effect Effects 0.000 title abstract description 5
- 102000053602 DNA Human genes 0.000 title abstract 8
- 230000003321 amplification Effects 0.000 claims abstract description 4
- 238000003199 nucleic acid amplification method Methods 0.000 claims abstract description 4
- 230000004087 circulation Effects 0.000 claims description 9
- 101150100316 ND4 gene Proteins 0.000 claims description 8
- 238000000137 annealing Methods 0.000 claims description 6
- 238000004925 denaturation Methods 0.000 claims description 6
- 230000036425 denaturation Effects 0.000 claims description 6
- 238000001712 DNA sequencing Methods 0.000 claims description 5
- 108091028043 Nucleic acid sequence Proteins 0.000 claims description 5
- 238000007400 DNA extraction Methods 0.000 claims description 3
- 238000004321 preservation Methods 0.000 claims description 3
- 238000005259 measurement Methods 0.000 claims 2
- 241000700141 Rotifera Species 0.000 abstract description 36
- 241000862786 Brachionus rubens Species 0.000 abstract description 9
- 238000013081 phylogenetic analysis Methods 0.000 abstract description 3
- 238000003752 polymerase chain reaction Methods 0.000 abstract 3
- 230000034994 death Effects 0.000 abstract 1
- 231100000517 death Toxicity 0.000 abstract 1
- 230000000877 morphologic effect Effects 0.000 description 11
- 238000012797 qualification Methods 0.000 description 8
- 241000894007 species Species 0.000 description 8
- 238000011160 research Methods 0.000 description 5
- 241001236591 Brachionus caudatus Species 0.000 description 4
- 241000700104 Brachionus plicatilis Species 0.000 description 4
- 238000006243 chemical reaction Methods 0.000 description 3
- 239000000203 mixture Substances 0.000 description 3
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 3
- 241000619650 Brachionus manjavacas Species 0.000 description 2
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 2
- 241001196932 Keratella cochlearis Species 0.000 description 2
- 238000012408 PCR amplification Methods 0.000 description 2
- 241000270708 Testudinidae Species 0.000 description 2
- 238000007621 cluster analysis Methods 0.000 description 2
- 238000012258 culturing Methods 0.000 description 2
- 238000005516 engineering process Methods 0.000 description 2
- 239000007788 liquid Substances 0.000 description 2
- 230000003562 morphometric effect Effects 0.000 description 2
- 238000013425 morphometry Methods 0.000 description 2
- 239000002773 nucleotide Substances 0.000 description 2
- 125000003729 nucleotide group Chemical group 0.000 description 2
- 235000015097 nutrients Nutrition 0.000 description 2
- 239000006228 supernatant Substances 0.000 description 2
- 241000700606 Acanthocephala Species 0.000 description 1
- 241001196934 Brachionus urceolaris Species 0.000 description 1
- 101150087323 COI gene Proteins 0.000 description 1
- 244000241257 Cucumis melo Species 0.000 description 1
- 241000196324 Embryophyta Species 0.000 description 1
- 102000004190 Enzymes Human genes 0.000 description 1
- 108090000790 Enzymes Proteins 0.000 description 1
- 229920002527 Glycogen Polymers 0.000 description 1
- 241001196935 Keratella Species 0.000 description 1
- 241001196722 Keratella hiemalis Species 0.000 description 1
- 241001465754 Metazoa Species 0.000 description 1
- 241000601230 Notholca Species 0.000 description 1
- 244000249201 Scenedesmus obliquus Species 0.000 description 1
- 235000007122 Scenedesmus obliquus Nutrition 0.000 description 1
- 241000982080 Trophis Species 0.000 description 1
- 238000010521 absorption reaction Methods 0.000 description 1
- 238000000246 agarose gel electrophoresis Methods 0.000 description 1
- 125000003275 alpha amino acid group Chemical group 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 239000012620 biological material Substances 0.000 description 1
- 230000001186 cumulative effect Effects 0.000 description 1
- 230000009089 cytolysis Effects 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 230000007812 deficiency Effects 0.000 description 1
- 230000008021 deposition Effects 0.000 description 1
- 238000013461 design Methods 0.000 description 1
- 239000012153 distilled water Substances 0.000 description 1
- 239000012154 double-distilled water Substances 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 235000013305 food Nutrition 0.000 description 1
- 230000002068 genetic effect Effects 0.000 description 1
- 230000006698 induction Effects 0.000 description 1
- 239000011159 matrix material Substances 0.000 description 1
- 230000029052 metamorphosis Effects 0.000 description 1
- 230000006920 protein precipitation Effects 0.000 description 1
- 235000018102 proteins Nutrition 0.000 description 1
- 108090000623 proteins and genes Proteins 0.000 description 1
- 102000004169 proteins and genes Human genes 0.000 description 1
- 238000000746 purification Methods 0.000 description 1
- 239000012264 purified product Substances 0.000 description 1
- 238000003375 selectivity assay Methods 0.000 description 1
- 210000002784 stomach Anatomy 0.000 description 1
- 230000009897 systematic effect Effects 0.000 description 1
- 229910021642 ultra pure water Inorganic materials 0.000 description 1
- 239000012498 ultrapure water Substances 0.000 description 1
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a sequencing method for a part of DNA (deoxyribonucleic acid) of mitochondrial ND4 genes of Brachionus rotifer and an identification method of the Brachionus rotifer. The sequencing method comprises the following steps of: extracting total DNA (deoxyribonucleic acid) of the Brachionus rotifer, performing PCR (polymerase chain reaction) primer amplification, determining a sequence and performing phylogenetic analysis; and according to the identification method, mitochondrial ND4 DNA of the Brachionus rotifer is used for identification. A designed PCR primer in the sequencing method can be used for amplifying the mitochondrial ND4 DNA of Brachionus rubens and the like, a sequencing result can be used for precisely identifying the Brachionus rubens and the like, the difficulty in identification by utilizing morphology and an ultra-micro structure can be solved, and then the possibility of drop in production and even mass deaths of the rotifers caused by population competition in mixed populations during the large-scale culture of the rotifers can be further reduced.
Description
Technical field
The invention belongs to biological technical field, be specifically related to the part DNA sequencing of the plastosome ND4 gene of a kind of Brachionus wheel animalcule and the method for qualification Brachionus wheel animalcule.
Background technology
Early stage wheel animalcule taxonomy and Phylogenetic Studies are mainly according to morphological data.As Wallace(1989) cluster analysis research finds wheel animalcule door (Rotifera), true wheel animalcule superclass (Eutatoria) and single nest guiding principle (Monogonota) are monosystem to utilize eight kinds of morphological features to carry out, utilize nine kinds of morphological features to carry out cluster analysis research and find that impeller genus (Notholca) is divided into six branches.Melone(1998) by carrying out matrix analysis to 60 morphological specificitys of a kind of acanthocephalan, 6 kinds of wheel animalcules and 2 outer groups (turbellarian worm and jaw stomach animal), obtain a brief clustering tree, the two nest guiding principle (Digononta) of discovery is and is monoid, but can not determine the monosystem of wheel animalcule door.This genealogical tree is different from the genealogical tree produced according to molecular level data or evolutionary taxonomy principle.The wheel animalcule systematics existing defects studied with morphological data, because the form of wheel animalcule is by the impact of the h and E factor two aspect, although inherited genetic factors is occupied an leading position.Along with going deep into of wheel animalcule research, existing investigator finds that morphological data can not meet wheel animalcule Partial Species and differentiate and phyletic evolution research (Guiset, 1977; Koste, 1978; Shiel, 1993; Fontaneto, 2007).Sergi (2005) etc. have studied the Morphometric difference between two kind B. plicatilis sensu stricto and B. manjavacas of brachionus plicatilis (B. plicatilis) L-type, find that B. plicatilis s.s. on average grows 6% than B. manjavacas, larger Morphometric crossover is shown between the individuality of two kinds, morphological classification can not be used for differentiating this two kinds, and their classification can only according to molecular indexes at present.2003, in order to understand morphological plasticity and the effect of genovariation in the metamorphosis of wheel animalcule, Derry etc. have studied tortoise plastron wheel animalcule (Keratella) the mitochondrial COⅠ gene sequence of different shape, find that there is quil and Keratella cochlearis (Keratella cochlearis) heritable variation without quil is larger, the difference of nucleotide sequence reaches 4.4%, implies that they are different kinds.And the difference of bent leg tortoise plastron wheel animalcule (K. hiemalis) nucleotide sequence of single quil and two quil is 0.21%, and aminoacid sequence does not make a variation, and their induction of morphologic variation owing to environment is described.
The morphological features such as formalness and internal structure such as traditional wheel animalcule classification Main Basis pileum, quil, foot and mouthpart.But because wheel animalcule huge number, build are small and phenotypical plasticity, some species of wheel animalcule formalness are closely similar, and same species are seasonable cyclomorphosis also, and numerous species lacks morphological classification feature effectively, carry out identifying and classifying to there is certain difficulty by means of only traditional method, as Branchionus urceus and Brachionus rubens are Brachionus frequent species, because they have similar form, these two kinds of wheel animalcules were once classified as one by early stage research, be called Brachionus urceus, be also translated into Branchionus urceus (Zhang Jiaji); Koste, Zhang Zong related to He Huangxiang and to fly etc., according to the both sides of polypide front end quil shape that is whether symmetrical and eyespot, B.urceus is divided into B.urceolaris and B.rubens two kinds afterwards, still there is smudgy part in the defining standard of therefore planting, therefore conventional identification method can not meet qualification requirement, and the ultrastructure of inner trophi needs the auxiliary of electron microscope, qualification difficulty.
Summary of the invention
For the deficiencies in the prior art, the invention provides the part DNA sequencing of the plastosome ND4 gene of a kind of Brachionus wheel animalcule and the method for qualification Brachionus wheel animalcule, this authentication method uses ND4 DNA sequence dna on the primer amplification wheel animalcule plastosome designed by experiment, and purifying, connection, clone, conversion, order-checking are carried out to PCR primer, sequence is compared and differentiates the kind of wheel animalcule.Molecular biological Identification of Species is carried out to wheel animalcule, solve the qualification difficulty utilizing morphology and ultrastructure to exist, make in the process of large scale culturing wheel animalcule, reduce population and mix the Species Competition that brings and cause the wheel animalcule the underproduction even possibility of mortality.
For solving the problems of the technologies described above, technical scheme of the present invention is:
A part DNA sequencing method for the plastosome ND4 gene of Brachionus wheel animalcule, comprises the following steps:
A, Brachionus wheel animalcule total DNA extraction;
The amplification of B, PCR primer and sequencing;
C, Phylogenetic analysis.
In described step B, PCR primer is: ND4W1:5 '-CCTA (TAG) GGCTCATGTTGAGGC-3 ' and ND5W2:5 '-ACAAGGGT (AG) GAAGAATGAAC-3 ';
Amplified reaction program is: 95 DEG C of denaturation 5min; 95 DEG C of sex change 30s, 48 DEG C of annealing 50s, 68 DEG C extend 3min, totally 15 circulations; 95 DEG C of denaturation 5min; 95 DEG C of sex change 30s, 48 DEG C of annealing 50s, 68 DEG C extend 3min, and the extension time, each circulation added 5s, totally 15 circulations; Last 72 DEG C extend 10min, 4 DEG C of preservations.
Identify a method for Brachionus wheel animalcule, use the partial dna sequence of the plastosome ND4 gene of Brachionus wheel animalcule to identify.
Based on chondriogen ND4 DNA partial sequence qualification Brachionus wheel animalcule, result accurately and reliably, PCR primer designed in present method can amplify Brachionus rubens, to cultrate Brachionus, square Brachionus, cleft foot Brachionus, Brachionus forcatus, ten refer to Brachionus, Brachionus caudatus, the plastosome ND4 DNA of rectangle Brachionus, utilize and (A is comprised to ND4 DNA comparison result, C, G, the content of T base, variant sites, brief informative site etc.) analyze the classification position of disputable kind further and molecular biological explanation is made to the phyletic evolution of the sibship between wheel animalcule population and wheel animalcule, can to Brachionus rubens, to cultrate Brachionus, square Brachionus, cleft foot Brachionus, Brachionus forcatus, ten refer to Brachionus, Brachionus caudatus, rectangle Brachionus carries out accurate identification.Solve the qualification difficulty utilizing morphology and ultrastructure to exist, make in the process of large scale culturing wheel animalcule, reduce population and mix the Species Competition that brings and cause the wheel animalcule the underproduction even possibility of mortality.
Embodiment
This identifies that the method for Brachionus wheel animalcule biomaterial used is Brachionus rubens, to cultrate Brachionus, square Brachionus, cleft foot Brachionus, Brachionus forcatus, ten refer to Brachionus, Brachionus caudatus, rectangle Brachionus, picking often plants the single individuality of wheel animalcule, Colony Culture, wherein Brachionus rubens, square Brachionus adopts Gilbert(1963) formula, nutrient solution is made after all the other several employing original place sides water samples filter, temperature is consistent substantially with envrionment temperature when gathering, food used is cultivate with HB-4 nutrient solution, be in the scenedesmus obliquus of exponential phase of growth, when single clone wheel animalcule individual amount reaches certain many amounts time, wheel animalcule is leached with 25 μm of aperture filter screens, and rinse with sterile distilled water, Eppendof pipe is collected, be placed in-20 DEG C of Refrigerator stores.
Total DNA extraction: utilize the method for the big grade (2002) of Dong Yun to extract wheel animalcule DNA.WizardTM genomic DNA purification kit (pormega, USA) is adopted to extract wheel animalcule DNA.Frozen wheel animalcule is taken out from-20 DEG C of refrigerators, the centrifugal several seconds, sucks excessive moisture.Add 60 μ l karyorhexis liquid (nuclear lysis solution), flick centrifuge tube and suspend evenly to make wheel animalcule, place 10min at 4 DEG C, take out.65 DEG C of water-bath 40min.Taking-up is cooled to room temperature, adds 20 μ l protein deposition liquid (protein precipitation solution), concuss 10s, the centrifugal 4min of ice bath 5min, 13000g.Careful absorption supernatant, adds 60 μ l Virahols, and 2.5 μ l glycogens (20mg/ml, Sigma, USA), carefully mix.Place 30min, 13000g centrifugal 20min, then supernatant discarded for-70 DEG C, with 70% ethanol wash twice.Dried up at sterilisable chamber, then add 50 μ l aseptic double-distilled waters, 4 DEG C of placements are spent the night with dissolving DNA.
Pcr amplification and sequencing: amplified reaction carries out in PCR amplification instrument.PCR primer design is as follows: ND4W1:5 '-CCTA (TAG) GGCTCATGTTGAGGC-3 ' and ND5W2:5 '-ACAAGGGT (AG) GAAGAATGAAC-
3 ', primer synthesizes in Shanghai Invitrogen company; The cumulative volume of PCR reaction system is 25 μ l, comprises 1 × LA PCR Buffer II (Mg
2+plus), 0.4 mmol/L dNTP, 1.5 μm of ol/L primers, the TaKaRa La Taq enzyme of DNA profiling 2 μ l, 1U, ultrapure water is mended to 25 μ l; Amplified reaction program is as follows: 95 DEG C of denaturation 5min; 95 DEG C of sex change 30s, 48 DEG C of annealing 50s, 68 DEG C extend 3min, totally 15 circulations; 95 DEG C of denaturation 5min; 95 DEG C of sex change 30s, 48 DEG C of annealing 50s, 68 DEG C extend 3min, and the extension time, each circulation added 5s, totally 15 circulations; Last 72 DEG C extend 10min, 4 DEG C of preservations; After having increased, by BBI kits PCR primer, get 2 μ l and check on the agarose gel electrophoresis of 1%, all the other-20 DEG C save backup; Purified product TaKaRa Pmd 18-T Vector is cloned; Finally serve Hai Shenggong order-checking.
Phylogenetic analysis: process sequencing result and analyze, sequence editor uses CLUSTAL X(1.81) software (Thompson, 1999) carries out DNA sequence dna comparison.
Wheel animalcule ND4 sequence is recorded as follows by primer:
Brachionus rubens:
cctaaggctcatgttgaggctcctacttttggttctatgattttagcgggtattttacttaaattaggtggtgttggtttattgcgttgttcgaagtttatagatataggtatgctaggtgctattttcatagcttattttacagtgtttatattatatgttactgttgtttgtttgtttcaatctgattttaaacgtttagtagcttactcttcagtttctcatatgatggctattccaattttattgttagttaacaatttgatgtcaactaagagattagtgatgcttatgctttttcatggtcttagttctcctttattattcatgctagttggtattgtttattctatgttttctaggcgtcagttaatcatgattcgtggtcttcttttatcatcccccttaattagatttgttatagttttagcctttttctttacattatctgctcctcctttcccttcttttgtttcagaggtttattttttagtttcttctctttgttattcatcttattttatttatgtgttttgtgtttttacatttttatcattgctatataatttaaattgattgagtgctatagtgttttctagggctactccctctaatatgagaacaagccttagttatataagatttatacctttatttatgtcaatccttttatgtgtgcctatgtctcttttaatatttttattgtagtgttgtttattagattttagttctaatagtgaatttattacagcattaatgacttccttatatcatcatttattgtgatttactttttaatttataacttttattgtttcttttttaatggctatttatgttagttatttaaacgaaagtttttatgtggcttttaatttattttctttctgaaataatgacatgatcgtctctttttatcttgattatatgtcaatgtgatttagtactgttattttgttaattagttctgtaattatagtttactcttacttttatatggctccatatagaaagacagtttactttttatgaattactaacttatttattctttctatgcttttagtggttaatttatcaaatttattctttcttatattaggttgggatggtttaggtttagtttcttttttcttaattgtttattatcaaaatcaaaggtctattacttctggtgttttcaccttgttaataaatcgattaggtgatagttttttcttagttactattatgttattcttttattatcattctgatttaactaggtttaggtctaatattccatctcttttagttttaacttttcttatgcttacttttatgactaaaagagctctttatcctttttcaccttgacttcctttagctatagcggcacccaccccaatttctgctttggttcattcttccacccttgt
To cultrate Brachionus:
CCTAAGGCTCATGTTGAGGCTCCTACTTTTGGTTCTATAATTCTTGCTGGTGTTCTTTTAAAGTTAGGAGGTGTTGGACTAATTCGTTGTGTTGGTCTAATGTCTGTTGATTTCTTATATTCAGTTTTTTTAAGATATTTTATGATTTTTATAATTTATGTTACTATTGTTTGTGTATTTCAGTCTGACTTAAAGCGTTTAGTTGCTTATTCTTCTGTGTCTCATATGATAGCTATTCCTCTTTTAGTTTTAAGCAACAATTTGCTGTCTATTAAGACTATTGTATTGCTAATACTATTTCATGGTCTTAGGTCTCCTATACTTTTCATGTTAGTTGGTGTTCTATACTCATTTTATTCTAGGCGACAGTTAATTGTTATTCGCGGTTTAATATTAGTATCGCCTCTTTTGTCCTTTATAATAGTCTTAGCTTTCTTCTTTACATTATCGGCTCCTCCCTTTCCATCTTTTATTTCTGAAGTTTATTTCTTTATTTCTTCTTTTGCATTATCTGATTATTTGGTATACGTTTTTATTGTCTTTTCTTTTTTATCATTGGTTTATAATTTAAATTGACTTAGTGCTATAGTGTTTTCAAGTTCTTCGCCTTCCAATATGAGAGTTACTTTGACTTATATGAGGTTTATGCCTCTTATTGTAAGTGTTTTAATTTGTATTCCTTTTATATCGCTCGTTTATTTGCTGTAAGATGACAATTTACTTAGTATTCTAAGGTGCCTTTGTAGGGTGTTGTTTATGACTTCTTTGTATTATCATGTGTCCTGATTTGTTACTCTTTT TTCTTTTTTTCTTTTATTTTTATTTTTTGCTATCTACATTAGATATATAGACCAATCTGTTTACATTTCTTTCCCTTTATTTTCTCTATGAAACAGTGACATAAGGGTTTCTTTTTTTTTTGATTACATATCTGTCTGGTTTAGTACTATTATCCTTATGATTAGGTCGGTTATTATAATTTATGCTTACTTTTATATAGCTCCCTATAGAAAATCTGTATACTTTTTGTCGCTCACCAATATATTTATTCTATCTATACTAATTGTAGTAAACATGAGTAATTTGTTTTACTTAATACTTGGTTGGGATGGTTTAGGGCTTGTTTCTTTCTTCTTAATTGTTTATTATCAAAATCAATCTTCAATTACGTCTGGAATGTTTACATTGCTTATAAATCGTTTAGGCGATAGATTCTTCTTAGTGACCATTATAATGACTTTTTACATATATTCAGATCTAACTATGTTTACCTCTTCTCTGGCTAGCTTGTTCTATGTTGTGTTTATAGTTCTTACTTTTATGACTAAGAGTGCTATCTATCCTTTTTCTCCTTGGCTTCCTTTAGCTATGGCTGCTCCCACTCCAATTTCCGCTCTTGTTCATTCTTCCACCCTTGT
Square Brachionus:
TTGGGTATATTCTAGCGGGTATTCTTCTAAAATTAGGTGGAGTTGGTCTGATTCGTTGTTTAAGCCTATTAGACTTAAATTATCTCTATTATGTATCTTTATCATACTTTATAATTTTTTTATGTTATGTAACTTTTGTTTGTTTGTTTCAGTCTGATTTTAAACGCTTAGTTGCTTACTCTTCTGTTTCTCATATAATAGCATTACCAATTCTTCTGATCTCCAATAATTTAATAGCCGTTAAAACAATAGTTATGTTAATATTATTTCATGGGTTAAGGTCTCCTATTTTATTTATGCTAGTAGGTGTAGTTTATTCAATGTTTTCGAGACGTCAGTTAATTATGATTCGTGGATTACTTTTAACATCCCCCCTCTTAAGATTTATTTTAATTCTAACATTTTTCTTTACTCTGTCTGCCCCCCCATTCCCATCATTTGTGTCTGAAGTGTATTTTTTAGTCTCTTCATTATTACTTTCTAAGTATTTTATTTATTGTTTTTGTGTTTTTACCTTCTTTTCTCTCCTGTATAATTTAAATTGACTAAGCGCTATGGTTTTTTCTAGAGCAACAACATCAAATATAATAAGATCATTAACTTACTTATCTTTTATGCCTTTATTTACTTCTTTACTGCTTTGTGTACCAATCTCTTTATTAATTTATTTATTTTAGCAATTAAGATATGTATTTATTTACAAAGTTTTATTTATAAGAATTGCTTATGACTTCATTATACCATCATTTATTATGATTTGTTATTTTATTTACTGTTTTTATTACAAGCTTGTTAATAGCAATCTATATTAGGTTTATAAACCAAGTTTTTTATGTGTCTTTTAGTTTATTTTCTATTTGAAATAACGATATAAATGTCTCCTTCTTTTTTGATTATATGTCTATTTGATTTACTACTATTATTTTGCTAATTAGGTCTGTAATTATAATTTACTCTTATTTTTATATAGCTCCATATAGAAAATCTGTGTATTTTTTATGATTAACAAATCTATTCATTATGTCTATGTTAATAGTAGTTAATATAAGTAATTTATTTTTTTTAATGCTAGGTTGAGATGGTCTTGGTTTAGTGTCCTTTTTTTTAATTGTTTACTACCAAAACCAAAGATCAATCACTTCGGGTATTTTCACTCTTCTGATAAATCGATTAGGGGATAGATTTTTTTTAGTTACTATTATGCTATTTTTTTACTACCACTCTGATTTAACAATATTTACATCAAATCTTCCTAGGTTTGTGGTTTTACTTTTTCTAATATTTACTTTTATAACAAAAAGGGCTATTTATCCATTTTCTCCTTGGCTTCCTTTAGCTATAGCTGCTCCGACTCCCCTTTGGCC
Cleft foot Brachionus:
AATTGATCTTATCTTGCTGGAGTTCTTTTAAACTAGGTGGTGTTGGTCTTCTTCGTTGTTTACCACTATTAGATATCGAT TTTTTATTTACTTACTTGTTTGCTTACTTCATGGTTTTCATGCTTTATGTTACTATTGTTTGTTTGTTTCAATCTGATTTAAAGCGACTTGTTGCGTACTCTTCAGTTTCTCATATGATAGCTCTGCCTATTCTTTTATTAGGGAATAATATTCTTTCCTTTAAAAGTTTCGTTATAATTATACTTTTTCATGGTATCAGTTCTCCCATTTTATTTATGTTAGTTGGTGTTCTCTACTCTTATTTTTCAAGCCGACAGCTCATTGCAGTTCGAGGTGTCTTGTTGATTTCTCCTCTTCTTGCCTTTTTGATAGTGCTCGCTTTCTTTTTTACCTTGTCAGCCCCTCCGTTTCCCTCGTTTATTGCAGAAGTCTTGTTTTTTGTGTCCTCTTACTATATAAGATCTTACATTTTATATGTTTTTATTATTTTTGCCTTTTTCTCTTTAGTTTATAATCTTAATTGGCTTAGTTCTATGGTCTTTTCCGCCCCTTCTCTTACTAATAATTCGTTCTTTATTACTTACATATCTTTTATGCCTATTATAGTATCATTTTTGATGGTTTTTCCTTTTATGTCTTTAGTTTATCTTATTTAGCATTGAGTTTGATTGTTTAAATCTTTTCTTATTTATTATAGGCAATGCTTCATGACATCTTTTTATCTCCATTTCGGTTGATTTGTTACTTTGATATGCGGCTTTATATTTTTTTTACTGTTATCTTTATACGTTAGATACATAGGTCAATCTTTTTATTTATCTATTAGGTTGTTTTCTTTGTGGAACAATGATATAGAGTTGTCCTTTGTTTTTGATTATATGTCTGTTTGGTTTAGGACCTTGATTTTGCTGATTAGCTCTGTTATTATGCTATACTCTTATAATTACATGGCTCCTTATAGTAAGTCTATTTATTTTCTTCCTCTTACTATCGCTTTTATCGCCTCTATGCTTATAGTTGTTAACATGAGCAATTTATTTTTTCTTATGTTAGGATGAGATGGTTTAGGTTTAGTTTCTTTTTTTTTTATTGTTTATTATCAAAAACATTCCTCTATTACTTCAGGTCTTTTTACAGTTATAATAAACCGTCTTGGTGATAGGTTTTTTTTAGCTTCCATTGTGCTCGTTTTTTACAGTTCTTGTGATCTTACTATGTTTAGATCTAACATTCCCTCTTATTTATTAGGGTTTATAATGACTTTAACTTTTATAACTAAAAGGGCTATTTTTCCTTTTCTCCATGGTTGCCTATGGCTATGGCCGCTCTACTGCACCGCCAA
Brachionus forcatus:
TTTGTTATATTTTAGCTGGTGTCCTGTTGAGTTAGGTGGAGTGGGGCTTTTACGTTGTTCATATTTTTTGTGTTTAGATTCTATTACTAGTGTAAGACTTGCTTATTTTATGATTTTTTTGCTATACGTGACAGTTGTTTGCTTGTTTCAATCGGACTTTAAACGTTTGGTTGCTTACTCGTCTGTTTCCCATATGATGGCTATTCCTATTCTTCTTTTGTCTGATAATCTTCTATCTTATAAGGCTTTGTTAATAGTTATGTTTTTCCATGGATTGAGTTCTCCTATTCTTTTTATGTTGGTAGGGGTTATCTACTCAATGTTTTCAAGACGTCAGTTACTTGTGGTTCGTGGGGTGATTTTGGTTTCTCCATTATTAAGTTTACTTATAATTCTCGCTTTTTTCTTTACTCTTTCTGCTCCTCCTTTTCCATCTTTTGTGTCAGAAGTTTATTTTTTAATGTCTTCTTACGTTTTGTCGTCTTCTCTTCTGTTTGTGTTCATCATTTTTACTTTCTTATCTTTGGTTTATAATCTTAATTGGTTAAGATCGATTTTGTTTTCTCGTTTTACTACTTCAAATATAGAATACACTTTTAGGTATTTGTATTTTATACCATTATTAGTTTCTTTTCTGTTTTGTATTCCAATCATTTTTCTTTTTCATATTTTTTTGCAGCAATTAATTTTAAATTAGGTTTTACTAAAAAGTAGAAATATGTTGTATTTGACATCTATATATGTTCATTTCTTTTGGTTTACCATTTTTTTAGTCTTATTTCTTTTAGTTTTTCTTTGGGCTCTTACTCTTAGCTATCTTGGTCAATGTTTTTATTTATCTTTTAATATGTTTTCTTTATGAAATTTGGATATAACGGTTTCCTTTTACGTTGATTTTATAGCAGTGTGGTTTAGCACTATTATCTTGCTAATTAGGAGGGTCATCATAGTTTATTCTTA TTTTTATATAGCGCCATATTCTAAAACTGTCTACTTTCTTTGGCTAACGAATTTATTCATTTTATCTATACTTTTAGTAGTTAATATGTCTAATTTGTTCTTTTTAATGTTGGGGTGAGATGGGTTAGGTCTAGTTTCTTTTTTCTTGATTGTTTACTATCAAAATCAGACTTCTATCACTTCTGGTGTGTTCACTCTCTTAATAAATCGTATCGGTGATAGGTTTTTTTTGGTTACTATTATGGTGGTCTTTTACTACCAACCCGACTTCGTTATTTTTGGGGTGTCTATCCCTAGTAAGCTAGTTTCACTATTAATACTATTTACGTTTATAACTAAAAGAGCTATTTACCCATTTTCACCTTGATTGCCCTTAGCTATAGCAGCTCTACTCCTTTTCCTCA
Ten refer to Brachionus:
CCTATGGCTCATGTTGAGGCACCTACTTTTGGTTCTATAATTCTTGCAGGGGTTCTTCTTAAGCTAGGTGGGTTAGGTCTTTTACGTTGTTCTTCTCTTATAAATCTTTTCTATTTAAAAAGTTTTATGATATCTTATCTTATACTATTTTTACTTGTTGTAACTATTGTTTGTCTTTTTCAGTCAGATTTCAAACGTTTAGTAGCTTACTCTTCTGTAGTTCATATAATAGCAGTCCCTATTCTTTTACTTTCTAATACTCTTTTATCCTTCAGAGCAATCATTCTTTTAATACTTTTACATGGTTTAAGATCTCCTATTATATTTATGTTAGTGGGTGTTCTTTATTCTCTATTTGGAACTCGTCAATTAATTATAATTCGTGGTGTCATACTCCTTTCCCCTCTTTTAAGATTTATTATAATTTTAGCTTTCTTTTTTACTTTAAGAGCTCCTCCTTTCCCCTCTTTTATTGCTGAGGTTTACTTTTTAGTTTCTTCTTTTTACTTATCCTCTTTCTTTATACCAGTTTTTTTAATCTTCATTTTTATATCTTTAGTTTATAATTTAAATTGGCTTGTTTCTATAGTTTTTTCAAGTTCTACTTATGTAAACATGTCTATAAGTTTAAGCTATATAGCTTTTCTTCCTTTGTTTACCTCTTTCTTCCTTTGTTTACCTCTTTCTTCCTTTGTTTACCTCTTTTAATGATATTTTTTTTAAAAAACCTAAGTTCTCTTAGTTATCTATATAGTATCATTTATGACTTCTTTATACCAGCATTTGTTGTGATTTTTAGTTTTATCTATTGTCTTTATCAGTTCTTTGATTCTATCAATTTATATTCTTTACACAAATCAAGCATTTTATTTATCTTTTAGCTTGTTTTCTTTTTGAAACAACGATATTTATGTCTCTTTTTATTTAGATTACATATCATCTTGTTTTAGCACAGTTATTCTATTGATTAGTTCTGTCATTATAGTTTATTCTGTTAACTATATATCCCCTTACAGAAAATCTACATATTTTTTATGGCTACCAATCTTTTTATCCTTTCTATGCTTATTGTTGTAAACATATCCAACTTGTTTTTTTTAATATTAGGTTGAGATGGTTTAGGATTAGTCTCATTTTTTTTAATTGTTTACTGCCAAAATCAAAATTCTATTACTTCAGGAGTTTTTACTTTACTAATGAATCGTATTGGGGATAGTTTCTTTTTAATTACATTAATTTTATTATTCTACACTTATCCTTCTCTTTTCAGGTTTTCTTCTAGTTATTCTTCAACTTTTTTAGTTTTATTCCTTACTCTTACTTTTATAACAAAAAGAGCTATCTATCCTTTTTCTCCTTGGTTACCTTTGGCAATAGCAGCACCAACTCCTATTTCAGCTTTAGTTCATTCTTCCACCCTT
Brachionus caudatus:
TCTTACTTTAGCTGGTGTTTTATTAAAACTAGGTGGTGTTGGGTTGTTACGTTGTCTTGATTTAATTGATTTAAATTTTCTTTATAGTGTATTTATGTCTTACTTTATAGTCTCTATAATTTATGTTACTATTGTTTGTTTATTCCAATCAGATTTAAAACGTTTAGTAGCTTATTCGTCAGTCTCCCATATAATAGCAATCCCTGTTCTTCTTTTATCTAATAATTTACTTTCCGTTAA AAGTATTATTATGGTTATATTATTCCATGGTCTTAGATCTCCTATCTTATTTATATTAGTTGGTGTTTTATACTCTTTCTTTTCTAGACGTCAACTTATTGTTGTTCGAGGGGTTATACTTATCTCTCCTCTGTTATCTTTCATTCTTGTTTTAGCATTTTTTTTCACTCTATCTGCTCCTCCTTTCCCTTCTTTTATTTCTGAGGTTTATTTCTTTATCTCTTCTTACTGTTCTTCTTCTTATTTTTTATATGTATTTATTGTTTTTTCTTTTCTTTCTTTGGTTTATAATTTAAATTGGTTAAGAGCTATAGTTTTTTCGACTTCTTCACCTTCTAATATAAGTGTAACATTAAGTTATATAAGATTCTTGCCTATAATAAGATCATTTATAATATGTATTCCATTAATACTGTTAATTTATATATTTTAATAACAACCATTAGATTACATTCTAAACAATTATTTTATGTTATTTATGACTTCTTTATATTATCACATTGCATGATTTACACCCTTATTTTGTATATTTATTATTTCTTTTATTTTCTCTATTTATATTAGCTATTTAGACCAGTCAATCTACTTGTCTTGTAATTTATTTTCTTTATGAAATATGGATATTAGAGTTTCTTTTTTATTTGATTACATATCTTTATGATTTACTTGTATTATTTTATTAATTAGTTCTGTTATCATAATTTATGCTTATTTTTATATAGCTCCATACTCTAAATCAGTATACTTTCTTTTATTAACTAATTTATTTATTATATCTATGCTTATTGTTGTTAATATAACTAACCTATTTTTTTTAATGCTGGGTTGAGATGGTTTAGGTCTTGTATCTTTTTTTCTTATTGTTTACTACCAAAAACAATCTTCTATTACTTCTGGTATTTTTACAGTATTAATAAACCGTTTAGGGGATAGTTTCTTTTTAGTTACAATTATAATATCATTTTATTTTTATTCTGATTTAAATGCTTTTGGTTCAGATATACCTTCCGTATATTTTCTTTTATTTCTTAGGGTGGCGGAAAGAACCAAAAGAGCTATTTATCCTTTTCACCTTGATTACCTTGGCTACGGCGCTCCCACCGCCTTTTCCCC
Rectangle Brachionus:
CTTTGGCTCATGCTTTTGGCAGGAGTTCTTCTGAGTTAGGGGGGGTTGGTCTATTACGTTGCACTCCTTTAATAACTCTTAGTATTTTGTCTTATACTATTTTATCCTATCTGATGCTTTTTATGTTGTATGTTACAATTGTTTGTATGTTTCAGTCTGACTTTAAGCGTTTGGTAGCTTACTCCTCAGTATCTCATATGATGGCTATTCCTATTCTTTTGATCGCTGATAATCTTATGTCTACCAAGACTTTGGTTTTATTAATGTTTTTTCATGGTTTATCTTCCCCTATTCTTTTTATGTTAGTAGGAGTTATCTACTCTATGTTTTCTAGGCGCCAATTTATTGTTATTCGTGGGATTCTTGTTGTCTCCCCTCTAATTAGTTTCATGTTGATTCTAGCCTTCTTTTTTACTCTTTCGGCTCCTCCATTTCCTTCCTTTGTGTCAGAAGTCTACTTCCTAGTGTCTTCTCTGTCTTTATCTCCTTATTTTATTTATGTCTTTTGAGGGTTTACCTTCTTGTCTTTAATTTATAATTTAAATTGGTTATCAGCTATGGTCTTTTCGAGGGCAACTTTAACAAATATGTGTACTTCTCTTTCTTATTTATCATTTATGCCTTTAATAATTTCCTTTTTATTCTGCATTCCTGTTTCTATGCTCTTATATTTTTTATAAAGATAATTATATTTAAAATTAGACATGTGTCTAAAGAGTTTGTTATATCTTTAATGACTTCATTTTACAATCATTTACTATGATTCACCACTTTAGCAGTTACTTTTATTGTTTGTCTCTTGTTTGCTGTTTATACTTCTTACACAAATCAAGTAGTGTTTGTTTCCTTTGATTTATTTTCTCTTTGAAATAGGGATATACAAGTATCCTTCTTTTTTGATTATATGTCTTTGTGATTTAGAACTATTATTTTACTCATTAGAAGGGTTATTATGGTTTATTCTTACTTTTATATGTCTCCTTACAGAAAAGCTGTTTACTTCCTTTGATTAACTAATTTGTTTATTTTGTCTATGCTGCTTGTTGTCAATATATCTAATCTATTTTTTCTTATGTTGGGTTGGGATGGGTTAGGTCTTATTTCATTCTTTCTGATTGTTTATTACCAAAACCAAAGTTCTATTACTTCAGGTATCTTCACTCTTTTAATAAATCGTTTAGGGGATAGTTTCTTTTTAGT TACAATTATGTTATTTTTTTACTACCATTCTGATCTTACAATGTTTGGTTCCCATCTTCCTTCCTTTTTGACTCTTCTTTTTCTTATACTTACTTTTATAACTAAAAGAGCTATTTATCCTTTCTCTCCTTGGCTTCCTTGGCTATGGCTGCCCAACCCCCATTAGTGG。
Claims (3)
1. a part DNA sequencing method for the plastosome ND4 gene of Brachionus wheel animalcule, comprises the following steps:
A, Brachionus wheel animalcule total DNA extraction;
The amplification of B, PCR primer and sequencing;
In described step B, PCR primer is: ND4W1:5 '-CCTADGGCTCATGTTGAGGC-3 ' and ND5W2:5 '-ACAAGGGTRGAAGAATGAAC-3 ', and wherein D is T or A or G, R is G or A.
2. sequence measurement as claimed in claim 1, is characterized in that: in described step B, amplified reaction program is: 95 DEG C of denaturation 5min; 95 DEG C of sex change 30s, 48 DEG C of annealing 50s, 68 DEG C extend 3min, totally 15 circulations; 95 DEG C of denaturation 5min; 95 DEG C of sex change 30s, 48 DEG C of annealing 50s, 68 DEG C extend 3min, and the extension time, each circulation added 5s, totally 15 circulations; Last 72 DEG C extend 10min, 4 DEG C of preservations.
3. identify the method for Brachionus wheel animalcule for one kind, use the partial dna sequence of the plastosome ND4 gene of Brachionus wheel animalcule to identify, the partial dna sequence of the plastosome ND4 gene of described Brachionus wheel animalcule uses the sequence measurement described in claim 1 or 2 to record.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210563401.9A CN103409497B (en) | 2012-12-22 | 2012-12-22 | Sequencing method for part of DNA (deoxyribonucleic acid) of mitochondrial ND4 genes of Brachionus rotifer and identification method of Brachionus rotifer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210563401.9A CN103409497B (en) | 2012-12-22 | 2012-12-22 | Sequencing method for part of DNA (deoxyribonucleic acid) of mitochondrial ND4 genes of Brachionus rotifer and identification method of Brachionus rotifer |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103409497A CN103409497A (en) | 2013-11-27 |
| CN103409497B true CN103409497B (en) | 2015-03-11 |
Family
ID=49602539
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210563401.9A Expired - Fee Related CN103409497B (en) | 2012-12-22 | 2012-12-22 | Sequencing method for part of DNA (deoxyribonucleic acid) of mitochondrial ND4 genes of Brachionus rotifer and identification method of Brachionus rotifer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103409497B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104094901B (en) * | 2014-07-11 | 2016-07-06 | 江苏农牧科技职业学院 | A kind of indoor high-density wheel animalcule being suitable to molecular biology research cultivates collecting method |
| CN106755393B (en) * | 2016-12-16 | 2020-12-18 | 国投生物科技投资有限公司 | qPCR (quantitative polymerase chain reaction) method for rapidly and quantitatively detecting Brachionus brachialis in algae culture |
| CN107828893A (en) * | 2017-11-06 | 2018-03-23 | 程双怀 | The part DNA sequencing of Brachionus wheel animalcule karyogene Hsp82 a kind of and the method for identifying Brachionus wheel animalcule |
| CN109355397A (en) * | 2018-11-09 | 2019-02-19 | 安徽师范大学 | A kind of part DNA sequencing method of Brachionus wheel animalcule mitochondrial cytochrome b gene and the method for identifying Brachionus wheel animalcule |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101698842A (en) * | 2009-10-22 | 2010-04-28 | 厦门大学 | Amplification primer for grouper catostomidae mitochondrial genome complete sequence and design method thereof |
-
2012
- 2012-12-22 CN CN201210563401.9A patent/CN103409497B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101698842A (en) * | 2009-10-22 | 2010-04-28 | 厦门大学 | Amplification primer for grouper catostomidae mitochondrial genome complete sequence and design method thereof |
Non-Patent Citations (3)
| Title |
|---|
| Phylogenetic analyses of endoparasitic Acanthocephala based on mitochondrial genomes suggest secondary loss of sensory organs;Mathias Weber,et al;《Molecular Phylogenetics and Evolution》;20121005;第66卷;182-189 * |
| 基于线粒体 COI基因序列探讨臂尾轮属的系统发生和几种轮虫的分类地位;程双怀等;《动物分类学报》;20070430;第32卷(第2期);328-334 * |
| 黄鲷线粒体CO Ⅰ基因部分序列遗传变异研究;张凤英等;《热带海洋学报》;20050930;第24卷(第5期);83-89 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103409497A (en) | 2013-11-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhang et al. | Construction of a high density SNP linkage map of kelp (Saccharina japonica) by sequencing Taq I site associated DNA and mapping of a sex determining locus | |
| CN103409497B (en) | Sequencing method for part of DNA (deoxyribonucleic acid) of mitochondrial ND4 genes of Brachionus rotifer and identification method of Brachionus rotifer | |
| CN111394445B (en) | Indel marker for sex identification of channa maculata and application thereof | |
| Christe et al. | New genetic markers for Sapotaceae phylogenomics: More than 600 nuclear genes applicable from family to population levels | |
| CN105018483A (en) | DOCK2 gene fragment used as molecular marker for detecting immune character of pig and application of DOCK2 gene fragment | |
| Ma et al. | Parentage assignment of the mud crab (Scylla paramamosain) based on microsatellite markers | |
| CN105671174B (en) | Chicken crawls character gene and to crawl the relevant DNA molecular marker of character to chicken | |
| CN114657264A (en) | Clarias fuscus gender-specific molecular marker primer and application thereof | |
| CN109486961B (en) | Construction method of scylla paramamosain high-density genetic map | |
| CN103589715B (en) | One of pig AMY2 gene can be used for the SNP marker of tracing to the source and detection method thereof | |
| CN106755371A (en) | Method and its application using PCR RFLP detection sheep PCNP gene mononucleotide polymorphisms | |
| CN104131097B (en) | A kind of method detecting beef cattle UCP3 gene mononucleotide polymorphism and application thereof | |
| CN101818195A (en) | Genetic marker by taking pig miR-27a precursor flanking sequence SNP as trait of litter size of pig and application | |
| Zhong et al. | Genome-wide identification of sequence variations and SSR marker development in the Munake grape cultivar | |
| CN106256904B (en) | Genetic marker related to immune traits of grass carp hemorrhagic disease | |
| CN104480212A (en) | Detection method of SNP (single nucleotide polymorphism) site of cattle PLIN2 gene as well as detection kit | |
| CN103361340B (en) | Bay scallop thermostable related heat shock protein 70 gene marker and assistant breeding method thereof | |
| CN101921848A (en) | Method for detecting single nucleotide polymorphism (SNP) of cattle MGAT2 gene | |
| CN111321242A (en) | Rapid molecular detection method and application of rubber tree anthracnose pathogen Siamese anthrax | |
| Liu et al. | Molecular karyotyping on Populus simonii× P. nigra and the derived doubled haploid | |
| CN103060443B (en) | Methods for sequencing of partial ribose desoxyribonucleic acid (rDNA) of mitochondria 12s genes of brachionus rotifer and identifying brachionus rotifer | |
| CN103088125B (en) | Method for sequencing partial DNA of mitochondria ND5 gene of brachionus rotifera and authenticating brachionus rotifera | |
| CN103361416B (en) | Method for partial rDNA (recombinant deoxyribonucleic acid) sequencing of mitochondrial 16S genes of Brachionus rotifer and identification of Brachionus rotifer | |
| CN103589716A (en) | SNP molecular marker in porcine SNCG gene for tracing and detection method thereof | |
| CN107828893A (en) | The part DNA sequencing of Brachionus wheel animalcule karyogene Hsp82 a kind of and the method for identifying Brachionus wheel animalcule |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150311 Termination date: 20151222 |
|
| EXPY | Termination of patent right or utility model |