CN103290138B - The PCR in real time method for quick of abaca bunchy top virus - Google Patents
The PCR in real time method for quick of abaca bunchy top virus Download PDFInfo
- Publication number
- CN103290138B CN103290138B CN201210042111.XA CN201210042111A CN103290138B CN 103290138 B CN103290138 B CN 103290138B CN 201210042111 A CN201210042111 A CN 201210042111A CN 103290138 B CN103290138 B CN 103290138B
- Authority
- CN
- China
- Prior art keywords
- buffer
- banana
- aphid
- real time
- probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to biological technical field, disclose a kind of PCR in real time based on Taqman probe (Real-time PCR) detection method detecting abaca bunchy top virus.It is characterized in that (1) preparation detection sample fast; (2) real time PCR amplification, obtains result.The object of the invention is to overcome weak point of the prior art, providing a kind of method simple, can detect without the virus in the banana plant of obvious susceptible symptom; Also can detect biography malicious medium-Banana aphid (Pentalonia nigronervosa) and whether be with poison; The present invention effectively reduces sample cross contamination, and detection efficiency is high and accurate.
Description
Technical field
The invention belongs to Agricultural biotechnologies Application Areas, relate to a kind of real time PCR detection method detecting abaca bunchy top virus and the test kit set up according to the method.
Background technology
Banana is the important cash crop of south China, is the mainstay industry of some city fruit industry of south and important agricultural exports, finds a good sale in Japan and other countries.Current banana disease viral disease is one of key constraints of China's banana production and tissue culture seedlings of bananas departure always.Banana bunchy top disease is one the most serious in banana disease.
Abaca bunchy top virus (BBTV) is the cause of disease of banana bunchy top disease, causes plant bunchy top and obviously downgrades, the yellow of blade outer rim, vein, petiole and the blackish green striped of false stem tool.Its route of transmission mainly contains after Banana aphid (Pentalonia nigronervosa) sucks disease plant, then propagates abaca bunchy top virus when sucking healthy plant, causes healthy plant morbidity.After morbidity, do not have effective chemical reagent to control, cause crushing disaster time serious, this disease just spreads in the banana plantation in the world.
The important prerequisite that it is prevention and cure of viruses that BBTV detects, the virus-free seedling of fashion trend research, banana is identified and link.
In existing detection technique, common method is enzyme-linked immunosorbent assay (ELISA), but temporary asymptomatic banana plant, banana seedling particularly tissue cultured seedling, because plant is immature, body inner virus content is very low, usually there will be undetected and situation that is flase drop by the method for ELISA; The detection method of regular-PCR, its sensitivity is higher than ELISA method more than 1000 times, be applicable to very much the sample detecting lower concentration virus, but existing method to the technology of preparing complicated operation duration of measuring samples, costly, and easily cause sample cross contamination, can not be quantitative to the band poison amount of susceptible sample.
Therefore, the detection method for detecting abaca bunchy top virus awaits further improvement.
Summary of the invention
The object of the invention is to overcome weak point of the prior art, providing a kind of method simple, can relative quantification, and reduce sample cross contamination to a certain extent, the high and detection method accurately of detection efficiency.
To achieve these goals, BBTV PCR in real time method for quick provided by the present invention is as follows:
Prepare banana plant and detect sample: that get known infection BBTV, that do not infect BBTV and banana to be measured blade, vein or false stem sample 1-2mm
2, be positioned in PCR pipe, add the freshly prepared buffer A of 50-100 μ L, 95 DEG C hatch 10 minutes after, add equivalent buffer B ,-20 DEG C save backup, and get 1 μ L supernatant liquor for real time PCR amplification;
Preparation passes the detection sample in malicious medium-Banana aphid (Pentalonia nigronervosa): the whole head banana aphid from banana plant collection is placed in the Eppendorf pipe of 0.5mL by (1) gently with writing brush, after racking aphid with rifle head, add 20 μ L buffer A, 94 DEG C 10 minutes, add 20 μ L buffer B again ,-20 DEG C save backup; (2) stab the lymph position of aphid with very thin pin or very thin liquid-transfering gun rifle head accurately, pin or rifle head be placed in 20 μ L buffer A, in 94 DEG C 10 minutes, then add 20 μ L buffer B ,-20 DEG C save backup; (3) aphid is on a full stomach touched, induction aphid secretion honeydew, dip a small amount of honeydew with syringe needle and be placed in 20 μ L buffer A, in 94 DEG C 10 minutes, add 20 μ L buffer B again,-20 DEG C save backup, and 1 μ L supernatant liquor is all got for real time PCR amplification in (1), (2), (3);
Real time PCR amplification: reaction primer, according to the banana BBTV coat protein gene (CP that GenBank announces, BBTVcomponent 3) sequence (Accession number:AY534140), therefrom select conserved sequence design primers F 1 and R1, wherein F1 sequence is 5 ' ACCAGCCGACT (a) ACA (c) TGTCTG 3 ', R1 sequence is 5 ' TCCTCAACACGGTTGTCTTC 3 '; And utilize Primer express (1.0, PE Applied Biosystem) design TaqMan probe, probe sequence is 5 ' ACATTCAACATCTGATGTCCCTGTTGC 3 ', probe is between upstream and downstream primer, and mark fluorescent element FAM held by 5 ' of probe, 3 ' end mark fluorescent element TAMRA, specificity and the conservative property of above-mentioned primer are strong, almost comprise found from BBTV strain all over the world, as Hawaii, Fiji, Tonga, India, Haikou etc., react at iCycler
tMreal-Time Detection System (Bio-rad) carries out, reaction system (20 μ L): 2 × TaqImmomix (BioLine) 10 μ L, MgCl
2(50mM) 1.8 μ L; Upstream and downstream primer (5 μMs) 1 μ L; Taqman probe 1 μ L; 20%PVP-40 1 μ L; 1%BSA 1 μ L; 1 μ L sample supernatant; All the other supply 20 μ L with ultrapure water.Reaction conditions is: 95 DEG C of sex change 7 minutes; 95 DEG C of sex change 30 seconds; 58 DEG C of renaturation 30 seconds; 72 DEG C extend 30 seconds; Circulate 50 times.Temperature transition rate is 20 DEG C/sec, and collect fluorescent signal in the extension stage of each circulation, phosphor collection pattern is set to F1/F2.
Production standard curve: by BBTV coat protein gene (composition 3), is cloned on pGEM-T (Promega company) carrier, transformation of E. coli.Extract plasmid, by 10 times of gradient dilutions.Then 1 μ L10 is got respectively
-1, 10
-2, 10
-3, 10
-4, 10
-5, 10
-6, 10
-7the DNA of BBTV-pGEM-T carry out quantitative amplification, production standard curve.Get the sample that 1 μ L is to be measured, carry out Real-time pcr amplification.Reaction terminates rear Bio-Rad iQ5 Optical system software and carries out data analysis (see table 1).Amplification curve is shown in Fig. 1, and typical curve is shown in Fig. 2.Can find out from typical curve, this testability is high, can reach 10 to the detection by quantitative of virus
-6reaction system.Cycle threshold (Ct value) and original viral amount good to data/coherency, relation conefficient is 0.9967, the linear relationship expression formula between original viral amount and Ct value: Ct=-2.7569 × Log (number of virus copy)+40.001.Gradient dilution test is carried out to extraction sample.
The analysis of table 1 Real-Time PCR quantitation
| Extension rate | The amount of BBTV (composition 3) | Ct value |
| 1 | 3.2pg | 14.58 |
| 10 -1 | 0.32pg | 20.35 |
| 10 -2 | 32fg | 23.43 |
| 10 -3 | 3.2fg | 28.77 |
| 10 -4 | 0.32fg | 29.86 |
| 10 -5 | 32ag | 33.80 |
| 10 -6 | 3.2ag | 35.19 |
| 10 -7 | 0.32ag | - |
| H 2O | 0 | - |
Result is diagnosed:
Result shows, the sample of disease plant or viruliferous aphid worm can amplify S type curve, and non-infected plant and the aphid not with poison can not produce S type amplification curve; And according to Ct value, the opposite band poison amount of sample can be judged.
One as above detects abaca bunchy top virus real time PCR detection method, and wherein said buffer A is 100mMNaOH, and 2%
20; Buffer B is 100mM Tris-HCl, 2mM EDTA.
Another aspect of the present invention is to provide the test kit based on above-mentioned detection method, and it comprises: noted earlier for viral DNA amplification and detect primer and probe; Buffer A: 100mM NaOH, 2%
20; Buffer B: 100mMTris-HCl, 2mM EDTA; 2 × Taq Immomix (BioLine); MgCl
2(50mM); 20%PVP-40; 1%BSA.
The country of origin of the portion of material that the present invention uses:
The susceptible material of banana: pick up from State of Hawaii, US and Chinese Hainan Province.
Detection method of the present invention has following benefit:
(1) the present invention can prepare measuring samples within 10 several minutes, and simple to operate, fast, result is sensitive and accurate.Thus improve detection efficiency greatly, and avoid artificial sample contamination, be a practicality detecting of banana BBTV and method quickly and accurately;
(2) in BBTV detection method in the past, the just detection of banana plant, does not have to find the report to the detection method of propagation medium-banana aphid; The present invention can be quick, sensitive, quantitative the band poison situation of detection aphid different sites, provide strong means to BBTV in the popular monitoring on banana farm and research aphid, BBTV, relation between banana three;
(3) Coat protein gene sequence of the abaca bunchy top virus BBTV that the different areas, the world that comparison GenBank of the present invention announces find, chooses conserved sequence design primer and TaqMan probe, establishes the PCR detection technique of real-time quantitative.Amplified reaction is very fast, and complete in 2 hours, result just went out at that time, does not need electrophoresis to run the step of glue.Highly sensitive, high specificity, the more important thing is the band poison amount quantitatively can knowing plant and aphid, is applicable to production application, is also applicable to scientific research.
(4) the present invention also correspondingly establishes detection kit according to detection method, the inventive method and test kit can detect BBTV fast, accurately, delicately, are applicable to sample rapid detection, the popular monitoring of BBTV, the qualification of detoxification nursery stock and the discriminating of decline virus.
Accompanying drawing explanation
Fig. 1 10 times of gradient dilutions contain the plasmid of BBTV coat protein gene, Real-Time PCR quantitation amplification curve diagram.
BBTV copy number in the quantitative sample of typical curve of the Ct value drafting that Fig. 2 is obtained by the PCR in real time of Fig. 1, linear relationship expression formula: Ct=-3.3986 × Log (number of virus copy)+40.163.
The PCR electrophorogram that Fig. 3 inventive samples extraction method and traditional CT AB sample extraction method compare
M-DNA Marker; 1-H
2o; 2-plant A (CTAB method); 3-plant B (CTAB method); 4-H
2o; 5-plant A (the present invention); 6-plant B (the present invention).
Fig. 4 PCR in real time detects susceptible and non-disease plant false stem, petiole and blade.
Fig. 5 M-DNA Marker; 1-H
2o; The false stem (not susceptible) of 2-; 3-petiole (not susceptible); 4-blade (not susceptible); The false stem (susceptible) of 5-; 6-petiole (susceptible); 7-blade (susceptible).
The Realtime pcr amplification curve of the BBTV in the susceptible banana plant of Fig. 6 10 times of gradient dilutions.
BBTV copy number in the quantitative susceptible banana plant of typical curve of the Ct value drafting that Fig. 7 is obtained by the PCR in real time of Fig. 4, linear relationship expression formula: Ct=-2.7569 × Log (number of virus copy)+40.001.
Fig. 8 PCR in real time detects the susceptible banana plant of 28 strain artificial inoculations, result display 5-45 days more Zao than the appearance of BBTV early symptom.
Embodiment
Below in conjunction with specific embodiment, the present invention is described in further detail:
1 sample preparation is simple, convenient:
The banana testing sample preparation method that current production uses, adopt traditional CTAB nucleic acid extraction method, be extracted the hybrid dna comprising banana plant DNA and viral DNA, need the step such as extracting of the extracting of liquid nitrogen grinding, chloroform/foreign matter alcohol, Virahol or ethanol.Complex steps, and unnecessary.Prepare a sample and need 2 hours, and sample preparation method of the present invention, simple and quick, only need 10 several minutes, be applicable to the detection of the BBTV in the honeydew of banana plant, biography virulent aphis worm, even aphid secretion.Have wide range of applications.Because step is simple, greatly reduce the crossed contamination of sample room.
Experiment proves, testing sample prepared by the present invention and the standby sample of traditional CTAB legal system can obtain same result.Illustrate that the present invention is applicable to the sample preparation of large flux, as shown in Figure 3.
2 specificity experiments:
(1) by the false stem of susceptible, not susceptible banana plant, petiole and blade respectively with quick sample preparation method preparation of the present invention, carry out detections analysis with real time PCR detection method of the present invention.Result shows, coat protein primer of the present invention all can increase and obtain S type amplification curve, and the banana plant that contrast is not infected and water can not produce S type amplification curve (Fig. 4).The agarose gel electrophoresis analytical results of amplified production is consistent with PCR in real time (Fig. 5), the product 155bp of specific fragment, and electrophoresis is single bright band.Further demonstrate that the specificity of this detection method.
(2) the Real-time PCR of aphid
the specificity of system
Feed with susceptible banana plant banana nontoxic and hand over aphid 48 hours, by method described in summary of the invention, sample preparation is carried out to viruliferous aphid worm (whole worm), aphid lymph and its honeydew produced, and get 1 μ L supernatant liquor and carry out PCR in real time detection.Result shows, the honeydew of the whole body of viruliferous aphid worm, lymph and secretion all can increase and obtain S type amplification curve, and contrasts nontoxic aphid and water can not produce S type amplification curve, by the toxic amount (table 2) of C (t) value expression different sites.The agarose gel electrophoresis analytical results of amplified production is consistent with PCR in real time, the product 155bp of specific fragment, and electrophoresis is single bright band.Further demonstrate that the specificity of this detection method.
Table 2
| C (t) value | C (t)-aphid | C (t)-honeydew | C (t)-lymph |
| Aphid 1 | +(27.95) | +(33.61) | +(33.64) |
| Aphid 2 | +(22.20) | +(37.32) | +(30.39) |
| Aphid 3 | +(27.76) | +(37.73) | +(33.43) |
| Without virulent aphis | - | - | - |
Note :+be These positive bands poison; (numeral) represents Ct value, and numeral is less, and to represent aphid band poison amount higher, and numeral is larger, and to represent aphid band poison amount lower;-be not with poison for feminine gender;
3 sensitivity experiments:
Get the frank sick leaf texture of 10mg, extract DNA as template by above-mentioned steps, 10 times of gradient dilutions to 10
-8, then get 10 respectively
-1, 10
-2, 10
-3, 10
-4, 10
-5, 10
-6, 10
-7, 10
-8the DNA 1 μ L of dilution carries out quantitative amplification.Reaction terminates rear Bio-Rad iQ5 Optical system software and carries out data analysis.Amplification curve is shown in Fig. 6, and typical curve is shown in Fig. 7.Can find out from typical curve, this testability is high, can reach 10 to the detection by quantitative of virus
-7reaction system.Cycle threshold (Ct value) and original viral amount good to data/coherency, relation conefficient is 0.9967, the linear relationship expression formula between original viral amount and Ct value: Ct=-2.7569 × Log (number of virus copy)+40.001.Gradient dilution test is carried out to extraction sample.Result display can from being diluted to 10
7in extracting solution, augmentation detection goes out BB TV; PCR in real time has identical detection sensitivity with gel PCR.
Get the sick leaf texture of 10mg in the same area of same plant of being infected by BBTV, extract total protein (specification sheets of Agdia company), 10 times of gradient dilutions to 10
-8, then get 10 respectively
-1, 10
-2, 10
-3, 10
-4, 10
-5, 10
-6, 10
-7, 10
-8the protein 10 0 μ L of dilution, carries out ELISA detection with the BBTV antibody purchased from Agdia company.The susceptibility of (as table 3) result display Real-time PCR and the identical of normal PCR, but than highly sensitive nearly 5 orders of magnitude of the ELISA that market uses.
Table 3
Note :+be These positive bands poison; (numeral) represents Ct value, and numeral is less, and to represent aphid band poison amount higher, and numeral is larger, and to represent aphid band poison amount lower;-be not with poison for feminine gender;
4 application example test experience:
Detection to the susceptible banana plant of asymptomatic BBTV:
We are at large Tanaka's artificial growth of State of Hawaii, US, and artificial inoculation 42 strain bananas, and plant 2 months is large, belongs to two local masters and carries banana strain.Under natural environment, wherein only have 28 strains (70%) finally to fall ill, manifest the classical symptom (bottle-green striped appears in the base portion of young leaves) that BBTV infects; The classical symptom infected all is there is not after inoculation in 14 plant after 3 months.After inoculation, banana plant occurs that there are some differences the time of classical symptom.Wherein 20 there is symptom at 20-40 days, and 5 occurred symptom at 41-70 days, and 3 occurred symptom at 71-85 days.We arrived sampling every 5 days before inoculation and after inoculation, took back the real-time PCR method set up by us in laboratory and detected virus quantity.Result shows real time PCR detection method of the present invention and can occur virus being detected in front 5 to 45 days in BBTV early symptom, and obvious along with symptom, and the Ct value reduction of PCR in real time, illustrates that viral level increases gradually.And negative control and H
2o can't detect virus (accompanying drawing 7).14 strains also do not show the inoculation banana plant of BBTV symptom for 90 days under physical environment, and PCR in real time does not detect the existence of virus always.
Above experimental result illustrates, BBTV real time PCR detection method of the present invention and based on the test kit that the method is set up have detect accurately, quantitatively, high specificity, the advantage such as highly sensitive, easy to operate, speed of response is fast.This method and test kit can be used for sample rapid detection, the popular monitoring of BBTV, tissue culture seedlings of bananas qualification and differentiate.Find virus accurately early, conveniently, carry out taking control strategy targetedly, reduce the loss that disease is brought.
Claims (6)
1. for detecting real time PCR amplification primer and the probe of abaca bunchy top virus, it is characterized in that: according to abaca bunchy top virus BBTV Coat protein gene sequence, its GenBank publication No. is AY534140, design primers F 1 and R1; And utilizing Primer express to design TaqMan probe, probe is between upstream and downstream primer; 5 ' end mark fluorescent element FAM of probe, 3 ' mark fluorescent element TAMRA, wherein the sequence of F1 is 5 ' ACCAGCCGACT (a) ACA (c) TGTCTG 3 ', the sequence of R1 is 5 ' TCCTCAACACGGTTGTCTTC3 ', and the sequence of TaqMan probe is 5 ' ACATTCAACATCTGATGTCCCTGTTGC 3 '.
2. a detection method for abaca bunchy top virus, comprises the steps:
(1) banana plant extracted respectively without obvious susceptible symptom detects sample with the viral DNA passed in malicious medium-Banana aphid, for subsequent use;
(2) with (1) step extract DNA for template, utilize the primer described in claim 1 and probe to carry out real time PCR amplification;
Reading of data after (3) 2 hours, whether judgement sample is with poison.
3. method according to claim 2, is characterized in that: the step extracted without the viral DNA in the banana plant of obvious susceptible symptom is as follows:
(1) 1-2mm is got
2banana Tissue to be detected, is positioned in PCR pipe;
(2) add the freshly prepared buffer A of 50-100 μ L, hatch 10 minutes for 95 DEG C;
(3), after, equivalent buffer B is added;-20 DEG C save backup, and get 1 μ L supernatant liquor for real time PCR amplification;
Wherein buffer A is 100mM NaOH, 2%
20; Buffer B is 100mM Tris-HCl, 2mMEDTA.
4. method according to claim 2, is characterized in that: the step extracting the viral DNA passed in malicious medium-Banana aphid (Pentalonianigronervosa) is as follows:
(1) the whole head banana aphid from banana plant collection is placed in gently the Eppendorf pipe of 0.5mL with writing brush, after racking aphid with rifle head, adds 20 μ L buffer A, 94 DEG C 10 minutes; Add 20 μ L buffer B again ,-20 DEG C save backup;
(2) stab the lymph position of aphid with very thin pin or very thin liquid-transfering gun rifle head accurately, pin or rifle head be placed in 20 μ L buffer A, in 94 DEG C 10 minutes; Add 20 μ L buffer B again ,-20 DEG C save backup;
(3) touch aphid on a full stomach, induction aphid secretion honeydew, dip a small amount of honeydew with syringe needle and be placed in 20 μ L buffer A, in 94 DEG C 10 minutes; Add 20 μ L buffer B again ,-20 DEG C save backup;
(1), (2), (3) all get 1 μ L supernatant liquor for real time PCR amplification, and wherein buffer A is 100mMNaOH, and 2%
20; Buffer B is 100mM Tris-HCl, 2mM EDTA.
5. method according to claim 2, is characterized in that: it is as follows to carry out real time PCR amplification reaction conditions:
Reaction is carried out on iCycler real-time System; Reaction system is 20 μ L, consists of the following composition: Taq enzyme, 2 × Taq Immomix, 10 μ L; The MgCl21.8 μ L of 50mM; The each 1 μ L of upstream and downstream primer of 5 μMs; Taqman probe 1 μ L; 20%PVP-401 μ L; 1%BSA 1 μ L; Sample supernatant 1 μ L; All the other supply 20 μ L with ultrapure water; Reaction conditions is: 95 DEG C of sex change 7 minutes, 95 DEG C of sex change 30 seconds, and 58 DEG C of renaturation 30 seconds, 72 DEG C extend 30 seconds, circulates 50 times, and at the extension stage collection fluorescent signal of each circulation, phosphor collection pattern is set to F1/F2.
6., for detecting a test kit for abaca bunchy top virus, it is characterized in that comprising following composition:
(1) primer according to claim 1 and probe;
(2) buffer A: 100mM NaOH, 2%
20;
(3) buffer B: 100mM Tris-HCl, 2mM EDTA;
(4) 2 × Taq Immomix; The MgCl of 50mM
2; The PVP-40 of 20%; The BSA of 1%.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210042111.XA CN103290138B (en) | 2012-02-23 | 2012-02-23 | The PCR in real time method for quick of abaca bunchy top virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210042111.XA CN103290138B (en) | 2012-02-23 | 2012-02-23 | The PCR in real time method for quick of abaca bunchy top virus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103290138A CN103290138A (en) | 2013-09-11 |
| CN103290138B true CN103290138B (en) | 2015-08-19 |
Family
ID=49091664
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210042111.XA Expired - Fee Related CN103290138B (en) | 2012-02-23 | 2012-02-23 | The PCR in real time method for quick of abaca bunchy top virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103290138B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103911351B (en) * | 2014-03-21 | 2015-12-30 | 浙江大学 | Secrete anti-abaca bunchy top virus monoclonal antibody hybridoma cell strain and monoclonal antibody application thereof |
| CN106119418A (en) * | 2016-08-09 | 2016-11-16 | 陈定虎 | Abaca bunchy top virus LAMP primer, test kit and detection method |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5756708A (en) * | 1994-02-24 | 1998-05-26 | Queensland University Of Technology | DNA sequences of banana bunchy top virus |
| CN1506469A (en) * | 2002-12-10 | 2004-06-23 | 福建省农业科学院生物技术中心 | PCR kit for testing banana apical tuft virus and its test method |
| CN101487058A (en) * | 2008-12-25 | 2009-07-22 | 中山出入境检验检疫局检验检疫技术中心 | PCR primer for banana bunchy top virus detection method and detection kit thereof |
| CN101561415A (en) * | 2008-04-18 | 2009-10-21 | 陈定虎 | Method for simultaneously detecting banana bunchy top virus and floral leaf heart rot virus |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1996038564A1 (en) * | 1995-05-30 | 1996-12-05 | Queensland University Of Technology | Dna sequences of banana bunchy top virus |
-
2012
- 2012-02-23 CN CN201210042111.XA patent/CN103290138B/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5756708A (en) * | 1994-02-24 | 1998-05-26 | Queensland University Of Technology | DNA sequences of banana bunchy top virus |
| CN1506469A (en) * | 2002-12-10 | 2004-06-23 | 福建省农业科学院生物技术中心 | PCR kit for testing banana apical tuft virus and its test method |
| CN101561415A (en) * | 2008-04-18 | 2009-10-21 | 陈定虎 | Method for simultaneously detecting banana bunchy top virus and floral leaf heart rot virus |
| CN101487058A (en) * | 2008-12-25 | 2009-07-22 | 中山出入境检验检疫局检验检疫技术中心 | PCR primer for banana bunchy top virus detection method and detection kit thereof |
Non-Patent Citations (2)
| Title |
|---|
| 一种简单快速的DNA提取方法在水稻上的应用;孙林静;《天津农学院学报》;20090930;第14卷(第3期);第1页摘要，第2页第1.2节 * |
| 香蕉束顶病毒PCR检测技术研究;肖火根等;《华南农业大学学报》;19990130;第20卷(第1期);第5页摘要，第5-6页第1.1-1.3节，第6页第2.1节 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103290138A (en) | 2013-09-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103146847B (en) | RT-LAMP (loop-mediated isothermal amplification) rapid detection kit for cucumber green mottle mosaic virus (CGMMV) and detection method | |
| CN105039586A (en) | Primer and kit for detecting duck type-II adenovirus | |
| CN101805793B (en) | PCR detection method of L.maculans and primer used for detection | |
| CN103642945A (en) | Reference-containing high-sensitivity fluorescent quantitative polymerase chain reaction (PCR) kit for Epstein-Barr virus | |
| CN101603091A (en) | Detection kit and the test kit using method of the bacillary fruit blotch bacterial immunity of watermelon PCR | |
| CN104031991B (en) | Fluorescent quantitative PCR detection method and the kit thereof of Bemisia tabaci to Diacloden resistance | |
| CN104232782B (en) | A kind of detect tobacco soil-borne fungus pathogen PCR primer and application and method | |
| CN103627798A (en) | Primer group, kit and method for detecting pathogenic bacteria of rice by multiplex PCR (Polymerase Chain Reaction) method | |
| CN103725793A (en) | Multiple fluorescent quantitative RT-PCR (reverse transcriptase-polymerase chain reaction) method for detecting PRRSV (porcine reproductive and respiratory syndrome virus) and application thereof | |
| CN103290138B (en) | The PCR in real time method for quick of abaca bunchy top virus | |
| CN104745689A (en) | Primers, probe and kit used for detecting bordetella pertussis | |
| CN105112558B (en) | The triple real time fluorescent quantitative RT PCR detection kits of the type of foot and mouth disease virus O, A and Asia I | |
| CN106435007A (en) | Primer, probe, kit and method for detecting bacillus erysipelatos-suis by fluorescent quantitative PCR (Polymerase Chain Reaction) | |
| CN105238880A (en) | Enterovirus real-time fluorescent quantitative detection kit | |
| CN101805795A (en) | Detection reagent kit and detection method of soybean phytophthora | |
| CN103088147B (en) | PCR (polymerase chain reaction) method and kit for simultaneously identifying specificities of Q-type bemisia tabaci and B-type bemisia tabaci | |
| CN101928779A (en) | Real-time fluorescent RCR molecular detection kit for leptosphaeria maculans and detection method thereof | |
| CN104232755A (en) | Tobacco phytophthora LAMP detection primer and rapid detection method thereof | |
| CN101560570B (en) | Nest-type NEST-PCR amplification primer for detecting Clavibacter michiganensis subsp, michiganensis, detection kit and using method of kit thereof | |
| CN104099408A (en) | Method for qualitatively detecting potato scab pathogen | |
| CN111088394A (en) | LAMP (loop-mediated isothermal amplification) detection primer group for Helminthosporium funiculosum of rhizoctonia solani and application of LAMP detection primer group | |
| CN102816835A (en) | Clavibacter michiganensis subsp.nebraskensis(Cmn) PCR detection method, and detection primer | |
| CN104388577A (en) | Loop-mediated isothermal amplification primer for detecting erwinia amylovory and kit | |
| CN113136442B (en) | Method and kit for detecting erwinia amylovora based on LFD-RPA technology and application of method and kit | |
| CN101988121A (en) | Quantitative detection technique for fusarium graminearum infestation quantity in wheat grains |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| DD01 | Delivery of document by public notice |
Addressee: Chen Yan Document name: the First Notification of an Office Action |
|
| DD01 | Delivery of document by public notice |
Addressee: Chen Yan Document name: Notification of an Office Action |
|
| DD01 | Delivery of document by public notice |
Addressee: Chen Yan Document name: Notification of an Office Action |
|
| DD01 | Delivery of document by public notice |
Addressee: Chen Yan Document name: Notification that Application Deemed not to be Proposed |
|
| ASS | Succession or assignment of patent right |
Free format text: FORMER OWNER: HU JINSHENG Effective date: 20150416 Owner name: BEIJING AGRICULTURAL COLLEGE Free format text: FORMER OWNER: CHEN YAN Effective date: 20150416 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| COR | Change of bibliographic data |
Free format text: CORRECT: ADDRESS; FROM: 100101 CHAOYANG, BEIJING TO: 102206 CHANGPING, BEIJING |
|
| TA01 | Transfer of patent application right |
Effective date of registration: 20150416 Address after: 102206 Beijing Changping District city Huilongguan Town Road No. 7 Applicant after: Beijing University Of Agriculture Address before: 100101 Institute of Microbiology, Chinese Academy of Sciences, No. 1, West Beichen Road, Chaoyang District, Beijing, A416, Applicant before: Chen Yan Applicant before: Hu Jinsheng |
|
| DD01 | Delivery of document by public notice |
Addressee: Chen Yan Document name: Notification of Passing Examination on Formalities |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150819 Termination date: 20170223 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |