CN103290102A - SNP (Single Nucleotide Polymorphism) classification method and application based on PCR (Polymerase Chain Reaction) - Google Patents

Abstract

The invention provides an SNP (Single Nucleotide Polymorphism) classification method and application based on PCR (Polymerase Chain Reaction). The SNP classification method comprises the steps of: (1) selecting a plant sample for experiment-tissues of a plurality of strains of certain species; (2) extracting genomic DNA of the tissues; (3) purifying the genomic DNA as a template for PCR amplification; (4) selecting AT type SNP in an SNP database of the species; (5) screening out SNP of which the third base before the SNP locus is G; (6) using primer 3 software to design a primer so that the last base of a positive primer is at the SNP locus and the last base is T; (7) introducing mispairing, and changing the antepenultimate base of the positive primer into A; (8) performing PCR amplification; (9) treating the PCR products by means of modified polyacrylamide gel electrophoretic separation; and (10) observing whether amplification band exists. The invention further provides application of the SNP classification method based on PCR in pyramiding breeding; the method is easy to implement, simple, convenient, and low in cost; the detection is simple and efficient; the classification success rate of SNP is as high as 91%.

Description

A kind of SNP classifying method and application of PCR-based

Technical field

The present invention relates to molecular biology and field of bioinformatics, be specifically related to a kind of method of carrying out the SNP somatotype by PCR, also relate to a kind of SNP classifying method of PCR-based in the application of rape pyramiding breeding.This method is quick, and simple, cost is low, can be widely used in fields such as medical diagnosis on disease and crop breeding.

Background technology

Molecule marker is the genetic marker based on genetic material inner nucleotide sequence variations between individuality, is the direct reflection of dna level genetic polymorphism.With other several genetic markers---morphology mark, biochemical biomarker, cytological marker are compared, the superiority that dna molecular marker has has: most of molecule markers are codominance, and are very convenient to the selection of the proterties of recessiveness; Genome mutation is extremely abundant, and the quantity of molecule marker almost is unlimited; In the different steps of biological development, the DNA of different tissues can be used for labeled analysis; Molecule marker discloses the variation from DNA; Show as neutrality, do not influence the expression of objective trait, do not have chain with bad proterties; Detection means is simple, rapid.Along with the development of Protocols in Molecular Biology, the dna molecular marker technology is existing tens of kinds now, is widely used in aspects such as genetic breeding, genomic mapping, the assignment of genes gene mapping, the discriminating of species sibship, gene pool structure, gene clone.

The requirement of desirable molecule marker: (1) has high polymorphism; (2) codominant inheritance namely utilizes molecule marker can differentiate heterozygosis and homozygous genotype in the diploid; (3) can clearly distinguish allelotrope; (4) spread all over whole genome; (5) except the mark of special site, require molecule marker to be uniformly distributed in whole genome; (6) select neutral (namely not having polypheny); (7) detection means simple, quick (as the easy automatization of experiment program); (8) cost of development and use cost are cheap as far as possible; (9) in the laboratory and inter-laboratory reproducibility good (being convenient to data exchange).The SNP mark is the third generation DNA genetic marker that American scholar Lander E proposed in 1996.SNP meets the optimal selection of above-mentioned requirements beyond doubt.

SNP is monokaryon former times acid polymorphism mark, mainly refers to the dna sequence polymorphism that caused by the variation on the genome nucleotide level comprise conversion, the transversion of single base, and the slotting people/disappearance of single base etc.The site of SNP is extremely abundant, almost spreads all over whole genome.A SNP will appear in about average every 1000bp in the genome according to estimates.SNP is marked at generally has only two kinds of allelotypes (allele) so also be called two equipotential marks (bi-allelic marker) in crowd or the biotic population.When detecting, only need the mode of "+/-" or " all or none " like this and need not the picture detection microsatellite marker length of fragment to be made measurement.

The existing traditional means of the means of SNP mark somatotype such as SSCP (single strand conformation polymorphism) and CAPs (Cleavage Amplification Polymorphisms) etc., faster means such as MassARRAY mass spectrum and TaqMan detecting probe method etc. are also arranged now, also have based on the detection means of chip such as DNA chip technology to have developed and be employed rapidly and be tending towards ripe.Use highdensity DNA chip or little array can be simultaneously to the somatotype of up to ten thousand SNP.SNP has been widely used in association analysis at present, in gene Fine Mapping and the molecular mark process.But all there is certain shortcoming in aforesaid method: the SSCP means can only be with non-sex change glue, and the experiment condition harshness needs normal temperature condition, and common laboratory is difficult to reach; CAPs means experimentation is loaded down with trivial details, and an experimental arrangement need expend long time; MassARRAY mass spectrum and TaqMan detecting probe method and other chip method appropriate litigation fees are high, and common laboratory is difficult to bear.

The present invention is based on above consideration, realize a kind of both cheap, simply, the SNP classifying method that efficient is high again, during by the design primer, introduce specific mispairing type and mispairing site at 3 ' end of forward primer, make primer very high to the efficient of pcr amplification in containing the genotypic material of a certain SNP, and the efficient of pcr amplification is very low in the material in another kind of SNP site, thereby reaches the purpose of SNP somatotype.The present invention is under the experimental procedure condition the same with the SSR molecule marker, has improved the ratio of primer polymorphism greatly, has enlarged the zone of covering gene group greatly.Generally about 30%, and molecule marking method of the present invention can reach more than 90% two storeroom polymorphism ratios the SSR molecule marker two storeroom polymorphism ratios.With the prerequisite of the same experimental cost of SSR molecule marker under, molecule marking method of the present invention has higher efficient.

Summary of the invention

The objective of the invention is to be to provide a kind of SNP classifying method of PCR-based, during by the design primer, 3 ' end at forward primer is introduced specific mispairing type and mispairing site, make primer very high to the efficient of pcr amplification in containing the genotypic material of a certain SNP, and the efficient of pcr amplification is very low in the material in another kind of SNP site, thereby reaches the purpose of SNP somatotype.Compare with many existing methods, its major advantage is fast, and simple, cost is low, can be widely used in fields such as medical diagnosis on disease and crop breeding.

Another object of the present invention is to be to provide the application of a kind of SNP classifying method of PCR-based at the rape pyramiding breeding, molecule marker commonly used at present is SSR, this molecule marker distributes less in genome, and mainly being positioned at non-coding region, this specific character has hindered the exploitation of close linkage assisted Selection mark.Be the SNP molecule marker and the present invention uses, the SNP molecule marker is wide in genome distribution scope, and extensively is present in gene coding region.Find that in human genome research only about half of non-synonym base mutation is the source of causing a disease.And SSR only is closely linked molecule marker, causes the possibility of pathology little.In the pyramiding breeding process, in fact polymerization is good allelotrope, as if assisted Selection mark SSR, has the possibility of the good allelic loss of target in the assisted Selection process, because the restriction of SSR self character, can not be all the time with the good allelotrope of target be divided into from.And the SNP molecule marker can be positioned at the coding region, and may be good allelic excellent source, and that SSR becomes the possibility in good allelic excellent source is very little.So, use the inventive method, can reach better effect using on the basis of same cost with SSR.

To achieve these goals, the present invention is by the following technical solutions:

A kind of SNP classifying method of PCR-based the steps include:

1, selects in two brassica napus two No. 11 and 73290, get 5 gram leaf samples;

2, the leaf sample that step 1 is obtained grinds the genomic dna that tissue is extracted in the back with liquid nitrogen freezing; The method of wherein extracting DNA in the step is the CTAB small-sample method.

3, with behind the genomic dna purifying as the template of pcr amplification; What wherein purify DNA was used in the step is the test kit of AXYGEN company, carries out according to instructions to the user.

4, in develop between two No. 11 and 73290 liang of strains snp database in have 4 types of SNP:A/G (C/T), A/C (G/T), A/T, G/C.The SNP that selects the A/T type is used for next step.The SNP that selects in this step is that it is 4 layers that SNP is subjected to the degree of depth of reads support minimum by two strains of rape (in two No. 11 and 73290) solexa SNP that order 5X data analysis obtains that resurveys.

5, filtering out the 3rd base in front, SNP site in the result of step 4 is the SNP of G;

6, with primer3 software (http://primer3.sourceforge.net/releases.php) design primer, make last base of forward primer be positioned at the SNP site, and last base is T; Wherein in the step during primer3 software design primer Tm value minimum be 62 ℃, be 68 ℃ to the maximum, 65 ℃ of Optimal Temperature, expanding fragment length is between 300 to 500bp.

7, introduce mispairing, third from the bottom base of forward primer become A; Primer is PrimerID01-23.

8, the reaction conditions according to design carries out pcr amplification;

9, the PCR product that step 8 is obtained electrophoresis under specific voltage conditions and specific denaturing polyacrylamide gel concentration; Wherein suitable deposition condition is in the step: use be the electrophoresis system of the DYCZ-20C type of Liuyi Instruments Plant, Beijing, deposition condition is electrophoresis 80 minutes under the 1800V voltage.

Described specific voltage conditions is that the heat that produces in the electrophoresis process can be fully lost because under this voltage conditions, and unlikely electrophoresis temperature is too high.Electrophoresis is because under this concentration under the described specific denaturing polyacrylamide gel concentration, and the mesh that gel produces can just reach the purpose that dna fragmentation separates.

10, the gel silver that step 9 is obtained is dyed the back and is observed having or not of amplified band, has the brightness of band very high, and the brightness of no band is very low even do not have, and reaches the purpose of two kinds of SNP types of somatotype.Wherein the silver nitrate concentration that silver dyes in the step is 10 μ g/ml.

Present method is verified in sesame and soybean equally, all reaches the polymorphism ratio more than 90%.

A kind of SNP classifying method of PCR-based the steps include: in the application of rape pyramiding breeding

1, finds the particular line that to improve some defective proterties of backbone parent, with backbone parent hybridization preparation mapping population.

2, resurvey order particular line and backbone parent are searched the corresponding SNP of the present invention, do genotype identification at mapping population, make up genetic map.

3, mapping population is done the field test of multiple spot, obtained phenotypic data, again with genetic map binding analysis Mapping of QTL, find closely linked SNP molecule marker and corresponding good allelotype.

4, in the strain system of mapping population, select to contain the strain system of how good as far as possible allelotype, backcross with backbone parent again, up to having kept all good allelotypes, reach till the purpose of improvement backbone parent.

The present invention compared with prior art has the following advantages and effect:

1, easy to implement the method, easy and simple to handle, cost is low.Present SNP typing method, as the TaqMan probe technique, a synthetic probe needs about 1000 yuans, and our this invention only needs about 60 yuans of synthetic primer as one to one;

2, detection is easy.When the somatotype SNP, need do that DNA purifying and enzyme are cut etc. as CAPS, experimentation is loaded down with trivial details, adds gel detection and the present invention only needs to run PCR, and experimentation is simple;

3, somatotype equipment is simple.Need fluoroscopic examination, apparatus expensive to need 700,000 yuans approximately during as TaqMan probe method somatotype.And the present invention only needs general electrophoresis equipment, only needs 4000 yuans approximately;

4, efficient height.The somatotype success ratio of SNP of the present invention reaches 91%, this be SSR (simple repeated sequence) molecule marker can not than;

5, flux is controlled.SNP classifying method based on TaqMan probe and chip technology only is fit to the big or many SNP somatotypes of SNP site amount of sample size at present, and to general QTL (quantitative trait locus) Position Research, SNP classifying method of the present invention is the most suitable, can satisfy the needs of common laboratory.

Description of drawings

Fig. 1, be a kind of design of primers synoptic diagram.

Last base of forward primer is to be positioned at the SNP site, and is base T; The antepenultimate base of 3 ' end originally is G, becomes A.

Fig. 2, be a kind of 23 SNP somatotype result schematic diagrams.

A: in two No. 11; B:73290; 1-23:1 number-No. 23 SNP; The amplified band luminance difference of two materials of No. 03 SNP is not obvious, and No. 14 SNP does not all increase at two materials, and remaining 21 SNP site all can detect polymorphism well.

Fig. 3, be a kind of genetic map synoptic diagram.

Ns162 and ns163 are the molecule markers of method exploitation of the present invention, are the closely linked molecule markers of rape proterties resistant to lodging.Other skeleton marks that are labeled as QTL designation of chromosome resistant to lodging reach and the not closely linked SNP mark of QTL resistant to lodging, and the QTL region represented in asterisk.

Embodiment

Usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989), or people (Blackwell Science Press such as Draper, 1988) described condition, or the condition of advising according to agents useful for same manufacturer.Agents useful for same is as without special instruction, and is all available in the biochemical reagents shop, and used software is freeware.

Embodiment 1:

A kind of SNP classifying method of PCR-based the steps include:

1. utilize the CTAB method to extract the total DNA of blade:

A. with after two No. 11 and 73290 leaf samples take out from Ultralow Temperature Freezer (70 ℃) in an amount of swede type rape, put into frappe mortar immediately, adding liquid nitrogen grinding powdering; Pack into fast in the 50ml centrifuge tube, be added in the extracting solution (25mM EDTA, 0.5% (mass ratio) SDS, pH 7.5 for 0.2M Tris-Cl, 0.25NaCl) of preheating in 60 ℃ the water-bath, mix, put into 60 ℃ water-bath water-bath 40min;

B. take out centrifuge tube, add the equal-volume chloroform: primary isoamyl alcohol (24: 1, V/V), centrifuge tube 30-50 time of slowly turning upside down makes abundant mixing, centrifugal 10 minutes of 1300g;

C. get supernatant in another centrifuge tube, add the equal-volume chloroform: (24: 1, V/V), extracting once again for primary isoamyl alcohol.Get supernatant, add 0.6 times of ice-cold primary isoamyl alcohol of volume, slowly put upside down centrifuge tube, till having flocks to assemble.Static 30min chooses precipitation, and 70% (volume ratio) alcohol is washed 2-3 time, and dehydrated alcohol is washed once, adds 65 ℃ of 20min dissolvings of sterilized water after the drying;

D. add the equal-volume chloroform again: primary isoamyl alcohol (24: 1, V/V), extracting again.Get supernatant, add 0.1 times of NaAc (3mol/L, pH5.2), the ice dehydrated alcohol that slowly adds 2 times of volumes behind the mixing slowly rotates centrifuge tube and occurs until flocks behind the static 5min, choose precipitation and change in the 1.5ml centrifuge tube, 70% (volume ratio) alcohol is washed 2-3 time, dehydrated alcohol is washed once, adds the sterilized water dissolving after the drying, preserves standby in-20 ℃ of refrigerators.

2.snp the screening in site:

In two No. 11 and each 1ug of DNA of 73290 send the big gene studies institute of China by solexa order-checking acquisition 5X sequence data.The genome sequence (chiff-401and 02-212) of Chinese cabbage and wild cabbage is merged as the genomic reference sequences of swede type rape, use again 2bwt-builder software ( Http:// soap.genomics.org.cn/Soapaligner.html) reference sequences is formatd, reference sequences comparison after the sequence that the order-checking of two materials is obtained is used SOAP software (http://soap.genomics.org.cn/soapaligner.html) and formatd then (the comparison parameter-v5), screening obtains mating the comparison result of unique position then, obtain a large amount of SNP with soapsnp (http://soap.genomics.org.cn/soapsnp.html) analysis, two material reads support that the degree of depth all need reach more than the 4X, two No. 11 and 73290 real SNP in just calculating, extracting in the SNP information that obtains is the A/T type again, 3 ' end left several three be the SNP site of G, be used for next step design of primers.This has selected 23 SNP sites altogether, and its site information is shown in the SNP01-23.

3. design of primers:

Determine forward primer earlier, the optimal T m value of primer is made as 65 ℃, and is minimum 62 ℃, the highest 68 ℃.Last base of forward primer is to be positioned at the SNP site, and is base T, and antepenultimate base originally is G, becomes A, makes primer prolong (Fig. 1) to 5 ' end, usefulness oligotm software ( Http:// primer3.sourceforge.net/Releases.php) detect the Tm value of forward primer till the Tm value reaches optimum.After determining, forward primer determines reverse primer again, utilize primer3 software (http://primer3.sourceforge.net/releases.php) fixedly behind the forward primer position, search for reverse primer again, make the Tm value of reverse primer consistent with forward primer, and the length of amplified production is between 300-500bp.According to selected SNP site information, 23 pairs of primers of design are shown in the PrimerID01-23.

Primer with in two No. 11 dna profilings when being combined, only have that the artificial a pair of base mismatch of introducing does not influence the efficient of pcr amplification to A-C between primer and template.And when 73290 dna profiling was combined, owing to there are two base mismatch, the T-T mispairing in SNP site and the tertiary A-C mispairing of 3 ' end caused the efficient of pcr amplification extremely low, and gel almost detects less than amplified production.

4.PCR amplification and gel somatotype:

(1) PCR system and program:

The PCR response procedures:

(2) gel electrophoresis:

The reagent preparation:

6% (mass ratio) PAGE glue: 6% (mass ratio) acrylamide, 7mol/L urea adds 300ul 10% (mass ratio) NH before the 0.5 * tbe buffer liquid, encapsulating ₄S ₂O ₄, 30ulTEMED; 10 * TBE:Tris-base 108g, boric acid 55g, 0.5MEDTA (pH8.0) 40ml, dilution is 0.5 * TBE working fluid when being settled to the 1000ml. use.

The preparation of PAGE glue:

Offset plate is cleaned airing with 10% (mass ratio) NaOH solution soaking 24 hours.Long offset plate is evenly smeared anti-silanizing agent (AMMMRESCO) with medicated napkin, short offset plate is smeared 1ml silanizing agent (0.5% (volume ratio) Glacial acetic acid, 1.5ml95% (volume ratio) ethanol, the 1-2ul silanizing agent), place after 5 minutes, shampoo to remove unnecessary anti-silanizing agent and silanizing agent gently with the ethanol of 95% (volume ratio).Glass is installed, and separate with edge strip, carefully be inserted in the glue folder (GIBCO/BRL).Ready back on short offset plate with syringe with 50ml (long offset plate 80ml) sex change glue mixed solution, slowly inject, in order to avoid the generation bubble.Insert comb, and clip with clip, condense and get final product electrophoresis after 2 hours.

Electrophoresis:

Take out offset plate from the glue folder, clean glass outer side, be fixed on the electrophoresis chamber, groove respectively adds 500ml 0.5 * tbe buffer liquid up and down, washes the point sample hole immediately after comb is extracted, and connects 1500 volts of constant voltage preheatings of power supply 30min.In the PCR product, add isopyknic sample-loading buffer (98% (volume ratio) deionized formamide, 10mmol/L EDTA, the blue or green FF of 0.005% (mass ratio) dimethylbenzene, 0.005% (mass ratio) tetrabromophenol sulfonphthalein), 95 ℃ of sex change 5 minutes, ice bath cooling, last sample 5ul, 1800 volts of constant voltage electrophoresis 80min.When arriving 2/3 offset plate, the blue or green FF of dimethylbenzene stops electrophoresis.

Dyeing:

Adopt argentation to dye: it is colourless that 10% (volume ratio) Glacial acetic acid is fixed to offset plate, ddH ₂O rinsing twice, each 2-3 minute.0.1AgNO then dyes ₃, 0.56% formaldehyde (volume ratio) 30 minutes.Take out offset plate, at ddH ₂O rinsing 10s is again at developing solution (3% (mass ratio) Na of precooling (4 ℃) ₂CO ₃, 0.56 (volume ratio) %HCHO, 2mg/LNa ₂S ₂O ₃.5H ₂O) shake to band high-visiblely in gently, pour into then and end in the liquid (10% (volume ratio) glacial acetic acid), stop to develop.With distilled water rinsing 3 minutes, room temperature (20-25 ℃) is the nature airing down, the preservation of taking pictures.

5. interpretation of result:

As shown in Figure 2, from left to right carried out the somatotype in 23 SNP sites altogether, a be in two No. 11, b is 73290, as can be seen in 23 sites, have 21 SNP sites all can detect well polymorphism (by amplified band have or not embody), obtained somatotype result more clearly.Only the amplified band luminance difference of two materials of No. 03 SNP is not obvious, and No. 14 SNP does not all increase at two materials.The somatotype success ratio reaches 91%.

Embodiment 2:

The a plurality of good characters of farm crop tradition molecular breeding method polymerization often use the SSR mark, and this to be marked at genomic density lower, is difficult to find the closely linked mark of functional gene.Use indicia means of the present invention, can reach the inaccessiable linkage degree of SSR mark, improve efficient greatly.Two No. 11 (state examines oil 2008030) and 73290 materials in the current material have the cracking resistance angle two No. 11 in wherein, and are resistant to lodging, anti-sclerotium disease, and the angle is really long, good character such as thousand seed weight is big, and 73290 to have a branch amount many, good character is waited at complete stool angle really number more.The good character transformation that present target is that the branch amount of 73290 materials is many and complete stool angle fruit number is many in two No. 11 materials, reach in the improvement pairs No. 11 purpose.

A kind of SNP classifying method of PCR-based the steps include: in the application of rape pyramiding breeding

1, F2 is for the structure of mapping population.With in two No. 11 be female parent, 73290 is male parent, artificial hybridization acquisition F1 generation, again with F1 for selfing, obtain a lot of F2 generation.Get F2 and extract DNA for single-strain blade, as the dna sample of F2 mapping population, do genotype identification after giving over to.Then with F2 for the selfing of the whole branches of individual plant, divide individual plant results selfed seed, as the strain system of F2 for mapping population, giving over to after for phenotypic evaluation.

2, SNP exploitation.In the order of resurveying two No. 11 and 73290, after the DNA extraction of two materials come out, be purified into each 1ug and offer the big gene of China and be used for order-checking, check order and read long 100bp, order-checking amount 5G.Sequencing result SOAP software comparison (parameter-v5), the reads that extracts the unique position of coupling from comparison result out is used for SNP to be identified, being SNP with SOAPsnp identifies, in the SNP qualification result, extract the SNP of A/T type again out, and 3 ' end antepenulatimate be the SNP of bases G, the SNP site information is shown in the SNP01-23.

3, map construction.According to the design of the primer design method among the embodiment 1 primer, primer sequence is shown in the PrimerID01-23.The F2 that the 1st step of present embodiment is obtained does genotype identification for the dna sample of mapping population then, the step of the 4th in the concrete steps reference example 1.After obtaining the genotype data of mapping population, usefulness joinmap3 ( Http:// www.kyazma.nl/Index.php/mc.JoinMap/sc.Updates/) make up genetic map (Fig. 3).

4, phenotypic evaluation.The first step of present embodiment is obtained F2 does the field test of multiple spot for the strain system of mapping population, investigate proterties, obtains resistant to lodging, the cracking resistance angle, anti-sclerotium disease, complete stool angle fruit number, the angle is length really, angle fruit grain number, the phenotypic evaluation data (table 1) of proterties such as thousand seed weight.

5, the proterties phenotypic data resistant to lodging of table 1. mapping population

6, QTL location.The 3rd step of present embodiment and the result in the 4th step are input to WinQTLCart2.5 software (http://statgen.ncsu.edu/qtlcart/WQTLCart.htm) for the QTL location, permutation test is set to 1000 times, carry out QTL scanning, obtain the QTL data of a plurality of proterties.

7, strain system selects and backcrosses.From the strain system of F2 for mapping population, select and contain the genotypic strain system of good QTL (to the QTL allelotype of proterties forward effect resistant to lodging), again with in backcross for two No. 11, up to both obtaining all 73290 good allelotypes, thereby two No. 11 original good characters reach in the improvement till two No. 11 the purpose in having kept again.

8, the SNP molecular marker assisted selection of at present having utilized the present invention to obtain obtains a plurality of improvement strains system, is used for product and compares.

The SNP site information is as follows:

SNP01

AAAGAGAGGTGACGATGAAACTTGAGACCCAGTAGATTCGTAACGTTAACGGATGGTTGG[A/T]TGATGCGAATCTTTTCTGGTGGAGAACCAAAACGGCGATGACGGCGTAAGTAACGGCGTG

SNP02

TTCTGTGACATTCTTCTGTAAAGCCTCTTCAACATTTGGTGTTGTGTTCTCTTGTTGGGA[A/T]TGATCTGTGTTGGGCTGCAAAGGAGGAGGCTGGGATGGTAAGTTCTCTGTCTGAGATGCT

SNP03

TGAGGATGAGATGGTGATTCACGTAAACAAATCAGCAAATCCTTCATCTGAGGACTATGG[A/T]ATACCATCGCAGCTTGTGCAGAAATATGTTAAAGGTACATTTATCTTCACTTGAGTCCTT

SNP04

ACCAGCTTAGAAACCAGCTGAGATAGATCAGCATAGAGGAGGCAAGCCAAAGACTGAGGA[A/T]CACATGGTGCATTGTAGTAGTTACATACCTTACGAACAACACCCCCCCCCCCCCCCCCCC

SNP05

GATGTAATGGTTATGGGCACATAAAATTAGAGTGTGTGAATACAAAGAAGATGAAGATGA[A/T]GAGAAGTTGCAGTGATAAGAAGCCAGAGAGAAAAGAAGATGCTCTAAATTTTGTGGCTCT

SNP06

GATCCTAAAGATTCACAATACTCTAAACCCAGCAGATATGTTGACCAAGTGTTTACCTGG[A/T]AGCGCGTTCGAGAAGTGCCTCGTAACGCCGAGGGTCACCGTCTGATCATGTGTCGAAGTA

SNP07

CTTTCTTCCTTACGACATACGCCTCAAGGAGCCTCACGCAGCAGTTTCAGGGATAGTAGG[A/T]AGCACCTTGGCAGCTTGGATCACAGGCCGAGACACGAAGAGGAGGAGTCCGATAACTGCA

SNP08

CATCGCCACTGAGATATGCGCAGCGCTTGTCTTTCTTCACTCCAATAAATCTCATAGCGT[A/T]GTCCACGGTGATTTGAAGGCGGCGAGTGTTCTTCTCGATGCTAATCTCGTTAGCAAGTTA

SNP09

GAGCACTCTCCAGGAAACGCCCTGCCTTTAGAGAGAAGAAGATTCAAGAGGAGTCTCGGA[A/T]CGACACAGACAGAACAAGAACTGAGGAGGCAAAAGACACGAATCTAAACAGTCGCAGACA

SNP10

GAGGCTAAATATTCAAGAAAAAAAGGAAGCTTTCATTCAATAAAAGCTAATAGGCAACGT[A/T]GTATAGGTCCATCAAAAGCTAAAACAGAGTGTAGAGAGCCTAACACAATCATACAGCAAA

SNP11

ATGCATAGCCTCTTCCTCTCGCTCACAGCAGCTCTAGGACTCGGTGGCCTCCCCCTTTGT[A/T]GCATGCTTGCATACGTACTCGGATATGGAAAACCTAGAATTGCACCCGCAGTTGGAGAGA

SNP12

GTATTACCGCAGACACAAAGTCTGTGAGGTTCATGCAAAGGCCTCTTCTGCAACTGTTGC[A/T]GGAGTCAAGCAACGTTTTTGTCAACAATGCAGCAGGTAACCATTTTTCCCTTCAAATATA

SNP13

AAGAGATTCATGCTTAGTCGACACAGCGAGAAACTTGCAATGGCCTTTGGTCTCATCAGC[A/T]CAAACAAAGGCACAAGAATAAGAATAGTAAAAAACCTGAGAGTATGTTCTGATTGTCATT

SNP14

ATTATTGGCTTCAGGTGCGAGGGGAAAGGTGGCTGCACCATGGAGGTCTGATGTAGATGG[A/T]TGGGATGGTCCTAGCTATGCTTCTTCGAGAAACGCTCAGACCAGTTCGAGAAAGACACTT

SNP15

AGTGGTTAAGGAATCTCTGGAAGAAGTTGAAGTTGAGTACTTAATGTTAGCAGAGGAAGC[A/T]TTAGGCAATGACACTTATGATGAGGATGTATGGATGATATACCCCGATGGTACAACGAAT

SNP16

ATAGAATATCAGAAACACTAGAGGCAATAGTGTCAGCTTTGGACTTGGTTTTGTCTTGGC[A/T]ACATTTTCATCGTTTGCGGTTGTCTCTTCACCCATCAGACAAGTACCACCGGCAGATTTG

SNP17

AGGACGATGTCACTACTCCGAGCCTGGATTGAGATCATTCAGGCGGCGCAAGCCTATTGA[A/T]GACGGCAAGACCTCTTGAGAATGCTCTGAGGGATAAATTTCGATCAGCTCTAACTAGTTT

SNP18

AGTCCTTTACAAACCAGAGATCTAGCAGAGATCATACTTCTCCAGCCATATGACGGGAGT[A/T]GGATCGGATCGGTTCAAGGGGTGAAGCATTCCTATAGTACCGTCCTTTAAAGACTCTAGA

VSNP19

CTATGATGCAAGGAACGAGTTACCTGGGTTCGATCTTCACTTGGGACCAAACAAATGGGA[A/T]AGTGTTAAACTGGAGTCTTCTGAGGGAACAGTTTCCAAAGAGATTATATACTCTGTCTTG

SNP20

ACAGTACGGGAAACACTGGTGGTGGCTCTCTTTCTTCTCCGTCTACGTTTCTCAGCAGGT[A/T]AAGATCCACCAACTGTTCGATGATTTGCCTCAACGAGTAGATTTTCATTTGGTTCTTTTG

SNP21

TGGTATCTTCTTTTTTTTTTTTTTTTTTTTTGTTTACAGGAGGTTCAAAGGTGAACCCGT[A/T]ATCCGCACGTGGTTTCCGTTTTGCCCAAAGGCCCGTAATCTGCACGTTGTTTCCGATTGC

SNP22

TAAGCTCACCTGCAGGCAATTTTATTTTTTGATTGATGTTAGTGATTTCAACTGGAATGA[A/T]ACATCTACATGTCTCCATATTTATATGGAGAAAGGAGGTAAACCACAGTGAAGAGAAATA

SNP23

AATCCAAACATCCTTAAAAACCTCATTTTTTATAAAAGCATGGTTCAAACACAAGGCCGG[A/T]AAAAGGACTTACTCGGCCAGTCCAATTACATAAAAAAACGGCAATACTGGGCCAGCACAC

The primer information of 23 SNP of somatotype is as follows:

PrimerID	The forward primer sequence	The reverse primer sequence
			Primer01	CCAGTAGATTCGTAACGTTAACGGATGGTTAGT	GTCGATCTACTCTTCCTCATCATCCTAACCTTCTT
Primer02	AACATTTGGTGTTGTGTTCTCTTGTTGGAAT	ATGCATCTATGAATGAAGGAGATGAAACTAATGATG
			Primer03	ACAAATCAGCAAATCCTTCATCTGAGGACTATAGT	CGGACTTTGGTGGCCACTGGAAT
Primer04	AGAGGAGGCAAGCCAAAGACTGAGAAT	CAGCTATTTCTCTAGCGTGAGATGTTCCTGAGTAT
			Primer05	ATTAGAGTGTGTGAATACAAAGAAGATGAAGATAAT	TCAATTTGTTCCATCTCTAGGATGTTGACTTGA
Primer06	CCAGCAGATATGTTGACCAAGTGTTTACCTAGT	TAAGTTTTCTTCCTTACACAACTCGAATCTCCCTT
			Primer07	CTCACGCAGCAGTTTCAGGGATAGTAAGT	TCATCACACTACTTTGGAACAAGAAGCTTAAGTACC
Primer08	CTTGTCTTTCTTCACTCCAATAAATCTCATAGCATT	CCGGACGATTCTCACTGACAGTCTCAC
			Primer09	CTTTAGAGAGAAGAAGATTCAAGAGGAGTCTCGAAT	GAAGACAACAAAGCTTCGACCTTTGCAAT
Primer10	GAAGCTTTCATTCAATAAAAGCTAATAGGCAACATT	TTTTGTTTACCGTGGTGTTAATAGGACTCTGTTTTT
			Primer11	GACTCGGTGGCCTCCCCCTTTATT	GTTGAGGAAGAATGGCGTTCTCACCAT
Primer12	GCAAAGGCCTCTTCTGCAACTGTTACT	GGTTGGGTGAGTTGATATTGTTTTATCTGATCTGT
			Primer13	GCAATGGCCTTTGGTCTCATCAACT	TGCTGAGCTTTGGGGTTCTGATCCT
Primer14	GCTGCACCATGGAGGTCTGATGTAGATAGT	GCTCCAACAAGTCCAGACAGGGTCC
			Primer15	GTTGAAGTTGAGTACTTAATGTTAGCAGAGGAAACT	CTGCTCCAGTCCGGTCTAGAAAAGTGC
Primer16	TCAGCTTTGGACTTGGTTTTGTCTTGACT	AACGTCACATCCAATCTTGAATCTGAGAAGTAAA
			Primer17	TCAGGCGGCGCAAGCCTATTAAT	CCAGTTATGTCCCTCTCGATTGACAGACA
Primer18	TCATACTTCTCCAGCCATATGACGGGAATT	AGTCGGTGGTTACGACTCTGCCAAATC
			Primer19	TCTTCACTTGGGACCAAACAAATGGAAT	GAAACTTACCGCTACTGTTGCGTGAGGA
Primer20	TCTTTCTTCTCCGTCTACGTTTCTCAGCAGATT	GATGCCTCGAGTAATACCACAAACCCG
			Primer21	TGTTTACAGGAGGTTCAAAGGTGAACCCATT	TTATGTTATCTCCATTGCTAGTGTTCATGTGATCAG
Primer22	TTTTTGATTGATGTTAGTGATTTCAACTGGAATAAT	ATGCGATAGAAATGGGTGTTTTCTAAAGATGTG
			Primer23	AAAGCATGGTTCAAACACAAGGCCAGT	AATTTCTGAGGTTGAGGAAGAGATTTGGGAG

Claims (2)

1. the SNP classifying method of a PCR-based the steps include:

A, select to be used for the tissue of the plant sample of experiment, plant sample is the leaf sample of two swede type rape strains: in two No. 11 and 73290;

B, the plant sample that steps A is obtained grind the genomic dna that tissue is extracted in the back with liquid nitrogen freezing;

C, with behind the genomic dna purifying as the template of pcr amplification;

D, select the SNP of A/T type at the snp database of swede type rape, the SNP that selects in this step is by two strains of swede type rape: in two No. 11 and 73290, the degree of depth that the solexa SNP that order 5X data analysis obtains that resurveys, SNP are supported by reads is minimum to be 4X;

E, to filter out the 3rd base in front, SNP site in the result of step D be the SNP of G;

F, usefulness primer3 software design primer make last base of forward primer be positioned at the SNP site, and last base is T; In this step during primer3 software design primer Tm value minimum be 62 ℃, be 68 ℃ to the maximum, 65 ℃ of temperature, expanding fragment length is between 300 to 500bp;

G, introduce mispairing, third from the bottom base of forward primer become A; Described forward primer is PrimerID01-23..

H, according to the design reaction conditions carry out pcr amplification;

J, PCR product electrophoresis under specific voltage conditions and specific non-denaturing polyacrylamide gel concentration that step H is obtained, deposition condition are electrophoresis 80 minutes under the 1800V voltage;

K, the gel silver that step J is obtained are dyed the back and are observed having or not of amplified band, and the silver nitrate concentration that silver dyes is 10 μ g/ml.

2. the SNP classifying method of the described a kind of PCR-based of claim 1 is in the application of rape pyramiding breeding.

Images