CN103276066B - Nucleic acid detection kit and method for detecting nucleic acid by amplifying plurality of biotin signals - Google Patents
Nucleic acid detection kit and method for detecting nucleic acid by amplifying plurality of biotin signals Download PDFInfo
- Publication number
- CN103276066B CN103276066B CN201310183261.7A CN201310183261A CN103276066B CN 103276066 B CN103276066 B CN 103276066B CN 201310183261 A CN201310183261 A CN 201310183261A CN 103276066 B CN103276066 B CN 103276066B
- Authority
- CN
- China
- Prior art keywords
- molecule
- nucleic acid
- amplification
- capture
- biotin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention relates to a nucleic acid detection kit and a method for detecting nucleic acid by amplifying plurality of biotin signals. The kit comprises a capturing molecule and a capturing bridge molecule, wherein the capturing molecule is oligonucleotide and is covered on a solid phase; one end of the capturing bridge molecule can be partially hybridized with the capturing molecule and the other end of the capturing bridge molecule can be partially hybridized with a nucleic acid target molecule to be detected; the kit further comprises an amplification bridge molecule and an amplification molecule; and the amplification molecule comprises a carrier molecule and a mark molecule. The mark molecule is polynucleotide marked by a biotin; one carrier molecule is connected with a plurality of biotin molecules through the polynucleotide; and one end of the amplification bridge molecule can be partially hybridized with the nucleic acid target molecule to be detected and the other end of the amplification bridge molecule can be partially hybridized with the carrier molecule. According to the kit disclosed by the invention, signals are subjected to secondary amplification through the amplification molecule, so that the detection method disclosed by the invention has the very high sensitivity, the inherent pollution problem of PCR (Polymerase Chain Reaction) is avoided, and operation steps are greatly simplified.
Description
Technical field
The present invention relates to a kind of method of kit for detecting nucleic acid and detection nucleic acid, belongs to field of biological detection.
Background technology
Detection of nucleic acids mainly has two kinds of approach：（1）Template amplification technology, it improves sensitivity by expanding target sequence,
（2）Signal amplifying system, it improves sensitivity by amplifying signal intensity, and it is swift in response, simple and easy to do, and no template expands
The interference factor of increasing.
The nucleic acid signal amplification detecting process for developing rapidly in recent years effectively raises sensitivity and the spy of detection of nucleic acids
The opposite sex.Conventional signal amplifying system has branched DNA probe, the tree-shaped bodies of 3DNA etc..In bDNA methods, it is logical that its signal amplifies
Parlkaline phosphatase（AP）What the oligonucleotide hybridization of labelling was attached on a dendroid branched nucleic acid body and realized.One people
The branched DNA of work synthesis can be with reference to multiple enzyme labelled probes, so as to the target signal of capture is amplified, to be detected.Alkali
Acid phosphatase（AP）The signal amplifying probe of labelling is the core of bDNA systems, and its preparation process is more complicated, and step includes branch
The chemosynthesis of chain and main chain oligodeoxynucleotide, the connection of main chain, and connection after product purification.Therefore, branched chain molecule
Preparation be extremely difficult and relatively costly.Additionally, alkali phosphatase（AP）The molecule of the oligonucleotide conjugate molecule of labelling
Amount is big, and in hybridization, mobility is low, causes detection efficiency not high.When amplification is low, its sensitivity is also poor, detection range
It is narrow, it is not suitable for the detection of low concentration sample.
The branch of the complexity that the tree-shaped bodies of 3DNA are made up of the 3DNA monomer structure units of multiple natures or synthesis staggeredly
Shape molecular configuration.Each 3DNA monomer is made up of the complementary DNA of two middle bodies, and during annealing, two chains can be formed in one
Between the single-stranded structure in double-strand two.Single-stranded between 3DNA monomers constitutes the tree-shaped body configurations of 3DNA by base complementrity.3DNA
Tree-shaped body it is single-stranded be fluorescent tag molecule binding site.Although the tree-shaped bodies of 3DNA can with many fluorescence molecules of labelling,
Be due to fluorescently-labeled molecule have AP enzyme branched DNA amplification techniques in two grades of enzymatic amplification abilities, the method it is sensitive
Degree is not ideal enough.
Biotin is a kind of vitamin B group being distributed widely in natural food, and Avidin is with very strong combination work
With the generally effect is irreversible.Traditional biological element label probe is connected to biotin on nucleic acid, using affine
Element have the principle of high affinity to biology, uses enzyme, fluorescein or high electron density after molecule hybridization（Ferritin, gold colloidal
Deng）Mark substance markers Avidin or Streptavidin detected.Finally, enzyme-substrate color reaction detection.Traditional biological
Plain label probe is stable, not easy in inactivation, and the various detecting systems of energy adapted, simple and convenient, in field of nucleic acid detection with extensive.
But its amplification is not enough, and probe insufficient sensitivity is high, can not meet the needs of practical application in some fields.
The content of the invention
The technical problem to be solved is to provide a kind of high kit for detecting nucleic acid of sensitivity and use to be somebody's turn to do
The method that test kit detects nucleic acid.
The technical solution used in the present invention is,
A kind of kit for detecting nucleic acid, including capture molecule and capture bridging molecule, the capture molecule is oligonucleotide, is wrapped
By in solid phase；The capture bridging molecule is DNA, and one end can be with determined nucleic acid target with capture molecule partial hybridization, the other end
Molecular moiety hybridizes；
Also include amplifying bridging molecule and amplification molecule, the amplification molecule includes carrier molecule and mark molecule, the load
Body molecule is DNA or RNA, and polynucleotide of the mark molecule for biotin labeling, a carrier molecule pass through polynucleotide
It is connected with multiple biotin molecules；It is described amplification bridging molecule be DNA, one end can with determined nucleic acid target molecule partial hybridization, it is another
End can be with carrier molecule partial hybridization.
Described determined nucleic acid is DNA or RNA.
Described carrier molecule is connected with 2-100 biotin molecule by polynucleotide.
Described carrier molecule can pass through chemosynthesis or biosynthesiss.
Described polynucleotide can be made up of 15-50 one or more nucleotide.
Described amplification bridging molecule can be multiple different DNA or RNA so that multiple in the zones of different connection of target molecule
Amplify bridging molecule, so as to obtain bigger amplification effect.
The above-mentioned test kit of the present invention, in actual use, also including hybridization solution, hybridization washing liquid, confining liquid, label mark
The Streptavidin of note, etc..
Amplification bridging molecule, the design of capture bridging molecule and amplification molecule and synthetic method in the test kit of the present invention is such as
Under：
1）Biotin is connected to form mark molecule with polynucleotide by chemical reaction.
2）Synthetic vectors molecule, the partial sequence of carrier molecule can with the partial sequence complementarity for amplifying bridging molecule, it is another
Partial sequence is complementary with the sequence of polynucleotide in mark molecule.
3）Multiple mark molecules are hybridized with carrier molecule under certain conditions, form the amplification of multi-biotin labelling
Molecule.
4）The purification of amplification molecule.
5）According to the sequence of detected nucleic acid molecules, design and synthesis capture bridging molecule and amplification bridging molecule, capture bridge divides
The partial sequence of son and amplification bridging molecule can be matched with the partial sequence complementarity of target molecule, both areas with target molecule complementary pairing
Domain does not overlap.The partial sequence and capture molecule complementary pairing of capture bridging molecule, the partial sequence for amplifying bridging molecule can be with amplification
The sequence complementary pairing of mark molecule hybridization is not involved in molecule.
As target molecule is captured in solid phase by capturing the hybridization of bridging molecule and capture molecule, by amplifying bridge point
The amplification hybridized to realize signal of son and amplification molecule, therefore for different objects to be measured, capture molecule and amplification molecule
All it is identical, need to only designs different capture bridging molecules and amplify bridging molecule, you can realize signal amplification detection.
The method that nucleic acid is detected using the test kit of the present invention, comprises the steps：
（1）Determined nucleic acid is added in solid phase together with bridging molecule, capture bridging molecule is amplified and is hybridized, 50 DEG C of incubations
12-16 hours, determined nucleic acid are captured by capturing bridging molecule and the specific recognition of the pre-coated capture molecule in solid phase
In solid phase；
（2）The nucleic acid molecules and amplification bridging molecule, capture bridging molecule being not associated with solid phase are washed away, amplification molecule is added
To in solid phase, 50 DEG C are incubated 1 hour；
（3）The Streptavidin or Avidin of labelling substance markers are added in solid phase, half an hour is incubated at room temperature；
（4）By the characteristic reaction of the label on Streptavidin or Avidin, the secondary amplification of nucleic acid signal is realized
And detection.
According to labels different on Streptavidin or Avidin, detected using different methods.With described
As a example by label is horseradish peroxidase, chromogenic reaction is carried out to horseradish peroxidase by chemical luminous substrate.According to
The relative light unit measured value of sample to be detected is carrying out qualitative analyses to sample.
In the present invention, the principle of nucleic acid signal amplification is：Target molecule to be measured is together with bridging molecule, capture bridging molecule is amplified
Be added in solid phase and hybridized, by capture bridging molecule respectively with target molecule and the partial hybridization of capture molecule, by target molecule
Capture in solid phase, and amplify one end and the target hybridization identification of bridging molecule, the amplification molecule that the other end is added with next step
With reference to the multiple biotin molecules connected in amplification molecule are combined with label such as horseradish peroxidase again, finally realize core
The two-stage amplification process of acid signal.
Biotin is connected by the present invention with polynucleotide, rather than alkali phosphatase.Due to biotin small volume, biotin
It is connected the mark molecule to be formed with polynucleotide and can effectively hybridizes to the amplification that multi-biotin labelling is formed on carrier molecule
Molecule, this causes detection sensitiveer.Also, for biotin detection Avidin or Streptavidin can labelling have it is secondary
The enzyme of amplification ability（Horseradish peroxidase or alkali phosphatase）, carry out the secondary amplification of signal so that the detection of the present invention
Nuclei aoid methods have high sensitivity.
It is the template amplification technology by signal amplification rather than PCR-based that beneficial effects of the present invention also reside in the present invention
To realize the detection to nucleic acid, so as to the pollution problem for avoiding PCR intrinsic.Additionally, the technology of the present invention can be with direct detection RNA
Molecule, must not carry out reverse transcription and the pre-separation of RNA, greatly simplify operating procedure.
Description of the drawings
Fig. 1 test kits of the present invention detect the schematic diagram of nucleic acid,
Wherein, 1：Determined nucleic acid molecule, 2：Capture bridging molecule, 3：Amplification bridging molecule, 4：Carrier molecule, 5：Mark molecule
6：The Streptavidin or Avidin of labelling substance markers, 7：Capture molecule, 8：Solid phase.
Specific embodiment
Embodiment 1, HPV detections
1. capture molecule, capture bridging molecule, the design and synthesis of amplifying bridging molecule, mark molecule and carrier molecule：
Capture molecule：GTTGGGCTACGACTTAGAGGCC（SEQ ID No 1）
Mark molecule 1：Biotin-ACCCGATGGATAGGTCGGTGAA（SEQ ID No 2）
Mark molecule 2：Biotin-TAAGCATCGTGCCCTTTCGCAG（SEQ ID No 3）
Mark molecule 3：biotin-ACCACGTTCGCGTTCTCACATG（SEQ ID No 4）
Carrier molecule：
AGAAGGCGTCCGTCTTTGAGGCTTCACCGACCTATCCATCGGGTCTGCGAAAGGGCACGATGCTTACATGTGAGAAC
GCGAACGTGGT（SEQ ID No 5）
According to the sequence of the sequence of HPV in genebank, design capture bridging molecule and amplification bridging molecule, sequence is as follows：
Capture bridging molecule：CAGGTAGCTTGTAGGGttttGGCCTCTAAGTCGTAGCCCAAC（SEQ ID No 6）
Amplify bridging molecule 1：AATAAATCTTTAAATGttttAGAAGGCGTCCGTCTTTGAGGC（SEQ ID No 7）
Amplify bridging molecule 2：GTCTCTATACACCACAttttAGAAGGCGTCCGTCTTTGAGGC（SEQ ID No 8）
2. pre-coated：Capture molecule is coated with microwell plate, fixative is added, 2 hours rear chamber warm airs is fixed and is done.
3. sample process
Patient's sample is cracked with cell pyrolysis liquid, wherein the nucleic acid for being contained.
4. sample nucleic acid and amplification bridging molecule, capture bridging molecule are incubated：
Sample nucleic acid is diluted in the hybridization solution of 100uL preheatings jointly with bridging molecule, capture bridging molecule is amplified, is added to
In microwell plate.Reacting hole, 50 DEG C of incubations, 12 to 16 hours are sealed with aluminium foil film.
5. incubate with amplification molecule：
Sealer is removed, liquid is discarded in hole and is patted dry in clean absorbent paper.The hybridization of 200 μ L preheatings is added to wash per hole
Liquid, static to discard liquid in a moment and pat dry in clean absorbent paper, repeated washing 2 times, totally 3 washings.By 1:500 ratio
Example, dilutes amplification molecule with hybridization solution, and 100 μ L amplification molecules after dilution, sealer are added per hole.50 DEG C incubate 1 hour.
6. incubate with Streptavidin-Radix Cochleariae officinalises enzyme：
Sealer is removed, liquid is discarded in hole and is patted dry in clean absorbent paper.The hybridization of 200 μ L preheatings is added to wash per hole
Liquid, static to discard liquid in a moment and pat dry in clean absorbent paper, repeated washing 2 times, totally 3 washings.200 are added per hole
μ L confining liquids, shaken at room temperature 15 minutes.Liquid in hole is discarded, the enzyme-linked things of 100 μ L Streptavidin-HRP, room temperature shake are added per hole
Swing 30 minutes.
7. develop the color
Discard in hole liquid and pat dry in clean absorbent paper.The detection cleaning mixture of 200 μ L preheatings, room temperature are added per hole
After vibration 5 minutes, discard liquid and pat dry in clean absorbent paper, repeated washing 2 times, totally 3 washings.Prepare substrate molten
Liquid, adds 95 μ L substrate solutions, after being incubated 1 minute, is placed on chemiluminescence detector and is measured per hole.
6. result judges
| Sample number | RLU values |
| 1 | 259697 |
| 2 | 904107 |
| 3 | 3432 |
| Positive quality control | 108073 |
| Negative Quality Control | 2629 |
| Critical Quality Control | 5486 |
When the RLU values of sample are more than marginal value, HPV test positive in the sample is can determine whether, during less than marginal value,
HPV is detected as feminine gender.
Embodiment 2：Late period or Metastatic Nsclc chemosensitirity testing
A large amount of clinical research confirmations, in tumor cell, the gene expression dose related to chemotherapeutics effect or metabolism is to changing
The curative effect for the treatment of has important impact.In tumor tissues, the target gene such as ERCC1/RRM1/TYMS/TUBB3 mRNA expressions can
To predict reaction of the patient to Common Chemotherapy medicines such as platinum class/gemcitabine/fluorine class/anti-micro-pipe classes respectively.Studies have reported that, it is high
The ERCC1 of level expresses the unfavorable adjuvant chemotherapy based on platinum class；ERCC1 negative patients are to the adjuvant chemotherapy containing platinum-based chemotherapy medicine
Show good yield.ERCC1 levels can as one of key gene of platinum medicine drug resistance, corresponding relation pulmonary carcinoma,
Find in breast carcinoma, ovarian cancer, bladder cancer, hepatocarcinoma, colon cancer, late gastric cancer, squamous cell carcinoma of the head and neck etc..
1. the composition of test kit：
Micro reaction plate, amplifies bridging molecule, captures bridging molecule, and hybridization solution hybridizes washing liquid（5×）, amplification molecule, closing
Liquid, the enzyme-linked things of Streptavidin-HRP detect washing liquid（5×）, SuperSignal ELISA Pico chemical luminous substrates
（Thermo）, substrate dilution, aluminium foil film, critical Quality Control thing.
2. capture molecule, capture bridging molecule, the design and synthesis of amplifying bridging molecule, mark molecule and carrier molecule：
Capture molecule：GTTGGGCTACGACTTAGAGGCC（SEQ ID No 9）
Mark molecule 1：Biotin-ACCCGATGGATAGGTCGGTGAA（SEQ ID No 10）
Mark molecule 2：Biotin-TAAGCATCGTGCCCTTTCGCAG（SEQ ID No 11）
Mark molecule 3：biotin-ACCACGTTCGCGTTCTCACATG（SEQ ID No 12）
Carrier molecule：
AGAAGGCGTCCGTCTTTGAGGCTTCACCGACCTATCCATCGGGTCTGCGAAAGGGCACGATGCTTACATGTGAGAAC
GCGAACGTGGT（SEQ ID No 13）
For the amplification bridging molecule and capture bridging molecule of ERCC1 and RRM1mRNA design specificitys, sequence is as follows：
ERCC1：
Capture bridging molecule：GAGGGCTCACAATGATttttGGCCTCTAAGTCGTAGCCCAAC（SEQ ID No 14）
Amplify bridging molecule 1：CACAGGTGCTCTGGCCttttAGAAGGCGTCCGTCTTTGAGGC（SEQ ID No 15）
Amplify bridging molecule 2：ATTACGTCGCCAAATTttttAGAAGGCGTCCGTCTTTGAGGC（SEQ ID No 16）
RRM1：
Capture bridging molecule：TCTTTGCTGGTGTACTttttGGCCTCTAAGTCGTAGCCCAAC（SEQ ID No 17）
Amplify bridging molecule 1：TGTGTGTTCTGATGTGttttAGAAGGCGTCCGTCTTTGAGGC（SEQ ID No 18）
Amplify bridging molecule 2：TTAGTGACTTCAGCCAttttAGAAGGCGTCCGTCTTTGAGGC（SEQ ID No 19）
3. hybridization solution is prepared：
20 × SSC 250mL,
10%SDS 10mL,
1000 mL are settled to the purified water of sterilizing, are mixed.Place room temperature preservation.
4. washing liquid is hybridized（5×）Prepare：
20 × SSC 250mL,
10%SDS 50mL,
1000 mL are settled to the purified water of sterilizing, are mixed.Place room temperature preservation.
5. washing liquid is detected（5×）
10 × PBS 500mL,
10%SDS 50mL
1000 mL are settled to the purified water of sterilizing, are mixed.Place room temperature preservation.
6. confining liquid
10×PBS：100 mL
The purified water of sterilizing：900 mL
Bovine serum albumin：5 g
Kathon：500 μL
Room temperature preservation is placed after mixing.
7. preparation is checked
（1）Washing liquid will be hybridized（5X）With detection washing liquid（5X）Hybridize washing liquid and 1X detection washing liquids with distilled water diluting to 1X.
（2）Hybridization solution and 1X hybridization washing liquids are using forward horizontal stand to 50 DEG C.
8. sample process
By patient's sample（Flesh tissue or paraffin section）Cracked with cell pyrolysis liquid, extracted the RNA for wherein containing.
9. pre-coated：Capture molecule is coated with microwell plate, fixative is added, 2 hours rear chamber warm airs is fixed and is done.
10. hybridization check
（1）Patient's sample nucleic acid mixes with amplifying bridging molecule and capturing bridging molecule, is diluted to the hybridization solution of 100 μ L preheatings
In, in adding pre-coated microwell plate.
（2）By micropore hybridize on plate using to micropore carry out sealer, and firmly by aluminium foil film compacting.
（3）50 DEG C of overnight incubations.
（4）Sealer is removed, liquid is discarded in hole and is patted dry in clean absorbent paper.The 1X of 200 μ L preheatings is added per hole
Hybridization washing liquid, static to discard liquid in a moment and pat dry in clean absorbent paper, repeated washing 2 times, totally 3 washings.
（5）By 1:500 ratio, dilutes amplification molecule with hybridization solution, and 100 μ L amplification molecules after dilution are added per hole,
Sealer.
（6）50 DEG C are incubated 1 hour.
（7）Repeat step（4）.
（8）200 μ L confining liquids, shaken at room temperature 15 minutes are added per hole.
（9）Liquid in hole is discarded, adds per hole the enzyme-linked things of 100 μ L Streptavidin-HRP, room temperature to shake 30 minutes.
（10）Discard in hole liquid and pat dry in clean absorbent paper.The detection cleaning mixture of 200 μ L preheatings is added per hole
（1X）, shaken at room temperature discards liquid and pats dry in clean absorbent paper after 5 minutes, repeated washing 2 times, totally 3 washings.
（11）Chemical luminous substrate solution is prepared, SuperSignal ELISA Pico chemical luminous substrate A, B, substrate are dilute
Release liquid in proportion 1：1：8 mix.
（12）95 μ L substrate solutions are added per hole, after being incubated 1 minute, being placed on chemiluminescence detector carries out light list relatively
Position（RLU）Determine.
11. results judge
As RLU ＜ 4000, detect that the expression of gene is low expression；
As 4000 ＜ RLU ＜ 10000, detect that the expression of gene is medium expression；
As RLU ＞ 20000, detect that the expression of gene is high expression.
12. interpretations of result
Judged according to experimental result：
In No. 1 tissue of patient section, ERCC low expressions, RRM1 low expressions, it is proposed that receive carboplatin and gemcitabine treatment；
In No. 2 tissue of patient sections, the high expression of ERCC, RRM1 low expressions, it is proposed that receive docetaxel and gemcitabine is controlled
Treat；
In No. 3 tissue of patient sections, ERCC low expressions, the high expression of RRM1, it is proposed that receive carboplatin and docetaxel treatment；
In No. 4 tissue of patient sections, the high expression of ERCC, the high expression of RRM1, it is proposed that receive docetaxel and Docetaxel
Treatment；
3. MP of embodiment is detected
1. capture molecule, capture bridging molecule, the design and synthesis of amplifying bridging molecule, mark molecule and carrier molecule：
Capture molecule：GTTGGGCTACGACTTAGAGGCC（SEQ ID No 20）
Mark molecule 1：Biotin-ACCCGATGGATAGGTCGGTGAA（SEQ ID No 21）
Mark molecule 2：Biotin-TAAGCATCGTGCCCTTTCGCAG（SEQ ID No 22）
Mark molecule 3：biotin-ACCACGTTCGCGTTCTCACATG（SEQ ID No 23）
Carrier molecule：
AGAAGGCGTCCGTCTTTGAGGCTTCACCGACCTATCCATCGGGTCTGCGAAAGGGCACGATGCTTACATGTGAGAAC
GCGAACGTGGT（SEQ ID No 24）
According to the sequence of the 16srRNA sequences of MP in genebank, design capture bridging molecule and amplification bridging molecule, sequence is such as
Under：
Capture bridging molecule：cgacacgagctgacgttttGGCCTCTAAGTCGTAGCCCAAC（SEQ ID No 25）
Amplify bridging molecule 1：tgcgctcgttgcgggattttAGAAGGCGTCCGTCTTTGAGGC（SEQ ID No 26）
Amplify bridging molecule 2：catgatgatttgacgttttAGAAGGCGTCCGTCTTTGAGGC（SEQ ID No 27）
The amplification molecule of the amplification molecule of simultaneously synthesizing single marking molecular marker and multiple mark molecule labellings, it is relatively more single
The signal amplification effect of biotin and multi-biotin.
2. pre-coated：Capture molecule is coated with microwell plate, fixative is added, 2 hours rear chamber warm airs is fixed and is done.
3. sample process
Mix the sample with cell pyrolysis liquid to be cracked, wherein the nucleic acid for being contained.
4. sample nucleic acid and amplification bridging molecule, capture bridging molecule are incubated：
Sample nucleic acid is diluted in the hybridization solution of 100uL preheatings jointly with bridging molecule, capture bridging molecule is amplified, is added to
In microwell plate.Reacting hole, 50 DEG C of incubations, 12 to 16 hours are sealed with aluminium foil film.
5. incubate with amplification molecule：
Sealer is removed, liquid is discarded in hole and is patted dry in clean absorbent paper.The hybridization of 200 μ L preheatings is added to wash per hole
Liquid, static to discard liquid in a moment and pat dry in clean absorbent paper, repeated washing 2 times, totally 3 washings.By 1:500 ratio
Example, dilutes amplification molecule with hybridization solution, and 100 μ L amplification molecules after dilution, sealer are added per hole.50 DEG C incubate 1 hour.
6. incubate with Streptavidin-Radix Cochleariae officinalises enzyme：
Sealer is removed, liquid is discarded in hole and is patted dry in clean absorbent paper.The hybridization of 200 μ L preheatings is added to wash per hole
Liquid, static to discard liquid in a moment and pat dry in clean absorbent paper, repeated washing 2 times, totally 3 washings.200 are added per hole
μ L confining liquids, shaken at room temperature 15 minutes.Liquid in hole is discarded, the enzyme-linked things of 100 μ L Streptavidin-HRP, room temperature shake are added per hole
Swing 30 minutes.
7. develop the color
Discard in hole liquid and pat dry in clean absorbent paper.The detection cleaning mixture of 200 μ L preheatings, room temperature are added per hole
After vibration 5 minutes, discard liquid and pat dry in clean absorbent paper, repeated washing 2 times, totally 3 washings.Prepare substrate molten
Liquid, adds 95 μ L substrate solutions, after being incubated 1 minute, is placed on chemiluminescence detector and is measured per hole.
6. result
| Sample | The amplification molecule of single biotin labeling | The amplification molecule of multi-biotin labelling |
| MP strains 1 | 1650 | 231790 |
| MP strains 2 | 1078 | 31456 |
| MP strains 3 | 1232 | 108073 |
| Blank | 332 | 433 |
The signal that the amplification molecule of multi-biotin labelling is detected is the amplification molecule detection signal of single biotin labeling
10-100 times.
SEQUENCE LISTING
<110>Wuhan Zhong Zhi bio tech ltd；Shenzhen Hongxin Biotechnology Co., Ltd.
<120>A kind of method of kit for detecting nucleic acid and multi-biotin signal amplification detection nucleic acid
<130>
<160> 27
<170> PatentIn version 3.3
<210> 1
<211> 22
<212> DNA
<213>Artificial sequence
<400> 1
gttgggctac gacttagagg cc 22
<210> 2
<211> 22
<212> DNA
<213>Artificial sequence
<400> 2
acccgatgga taggtcggtg aa 22
<210> 3
<211> 22
<212> DNA
<213>Artificial sequence
<400> 3
taagcatcgt gccctttcgc ag 22
<210> 4
<211> 22
<212> DNA
<213>Artificial sequence
<400> 4
accacgttcg cgttctcaca tg 22
<210> 5
<211> 88
<212> DNA
<213>Artificial sequence
<400> 5
agaaggcgtc cgtctttgag gcttcaccga cctatccatc gggtctgcga aagggcacga 60
tgcttacatg tgagaacgcg aacgtggt 88
<210> 6
<211> 42
<212> DNA
<213>Artificial sequence
<400> 6
caggtagctt gtagggtttt ggcctctaag tcgtagccca ac 42
<210> 7
<211> 42
<212> DNA
<213>Artificial sequence
<400> 7
aataaatctt taaatgtttt agaaggcgtc cgtctttgag gc 42
<210> 8
<211> 42
<212> DNA
<213>Artificial sequence
<400> 8
gtctctatac accacatttt agaaggcgtc cgtctttgag gc 42
<210> 9
<211> 22
<212> DNA
<213>Artificial sequence
<400> 9
gttgggctac gacttagagg cc 22
<210> 10
<211> 22
<212> DNA
<213>Artificial sequence
<400> 10
acccgatgga taggtcggtg aa 22
<210> 11
<211> 22
<212> DNA
<213>Artificial sequence
<400> 11
taagcatcgt gccctttcgc ag 22
<210> 12
<211> 22
<212> DNA
<213>Artificial sequence
<400> 12
accacgttcg cgttctcaca tg 22
<210> 13
<211> 88
<212> DNA
<213>Artificial sequence
<400> 13
agaaggcgtc cgtctttgag gcttcaccga cctatccatc gggtctgcga aagggcacga 60
tgcttacatg tgagaacgcg aacgtggt 88
<210> 14
<211> 42
<212> DNA
<213>Artificial sequence
<400> 14
gagggctcac aatgattttt ggcctctaag tcgtagccca ac 42
<210> 15
<211> 42
<212> DNA
<213>Artificial sequence
<400> 15
cacaggtgct ctggcctttt agaaggcgtc cgtctttgag gc 42
<210> 16
<211> 42
<212> DNA
<213>Artificial sequence
<400> 16
attacgtcgc caaatttttt agaaggcgtc cgtctttgag gc 42
<210> 17
<211> 42
<212> DNA
<213>Artificial sequence
<400> 17
tctttgctgg tgtacttttt ggcctctaag tcgtagccca ac 42
<210> 18
<211> 42
<212> DNA
<213>Artificial sequence
<400> 18
tgtgtgttct gatgtgtttt agaaggcgtc cgtctttgag gc 42
<210> 19
<211> 42
<212> DNA
<213>Artificial sequence
<400> 19
ttagtgactt cagccatttt agaaggcgtc cgtctttgag gc 42
<210> 20
<211> 22
<212> DNA
<213>Artificial sequence
<400> 20
gttgggctac gacttagagg cc 22
<210> 21
<211> 22
<212> DNA
<213>Artificial sequence
<400> 21
acccgatgga taggtcggtg aa 22
<210> 22
<211> 22
<212> DNA
<213>Artificial sequence
<400> 22
taagcatcgt gccctttcgc ag 22
<210> 23
<211> 22
<212> DNA
<213>Artificial sequence
<400> 23
accacgttcg cgttctcaca tg 22
<210> 24
<211> 88
<212> DNA
<213>Artificial sequence
<400> 24
agaaggcgtc cgtctttgag gcttcaccga cctatccatc gggtctgcga aagggcacga 60
tgcttacatg tgagaacgcg aacgtggt 88
<210> 25
<211> 41
<212> DNA
<213>Artificial sequence
<400> 25
cgacacgagc tgacgttttg gcctctaagt cgtagcccaa c 41
<210> 26
<211> 42
<212> DNA
<213>Artificial sequence
<400> 26
tgcgctcgtt gcgggatttt agaaggcgtc cgtctttgag gc 42
<210> 27
<211> 41
<212> DNA
<213>Artificial sequence
<400> 27
catgatgatt tgacgtttta gaaggcgtcc gtctttgagg c 41
Claims (5)
1. a kind of kit for detecting nucleic acid, including capture molecule and capture bridging molecule, the capture molecule is oligonucleotide, is coated with
In solid phase；The capture bridging molecule is DNA, and one end can be divided with determined nucleic acid target with capture molecule partial hybridization, the other end
Subdivision hybridizes；
Also include amplifying bridging molecule and amplification molecule, the amplification bridging molecule is DNA, and one end can be with determined nucleic acid target molecule part
Hybridization, the other end can include carrier molecule and labelling point with the carrier molecule partial hybridization in amplification molecule, the amplification molecule
Son, carrier molecule are DNA, polynucleotide of the mark molecule for biotin labeling, it is characterised in that：One carrier molecule leads to
Cross polynucleotide to be connected with multiple biotin molecules；Mark molecule per se with oligonucleotide can be with the widow of other mark molecules
Nucleotide is combined, and the heterozygote after mark molecule phase mutual cross can be hybridized with carrier molecule again.
2. kit for detecting nucleic acid according to claim 1, it is characterised in that described carrier molecule passes through polynucleotide
It is connected with 2-100 biotin molecule.
3. kit for detecting nucleic acid according to claim 1, it is characterised in that described carrier molecule passes through chemosynthesis
Or biosynthesiss.
4. kit for detecting nucleic acid according to claim 1, it is characterised in that described polynucleotide are by 15-50
Plant or various nucleotide composition.
5. kit for detecting nucleic acid according to claim 1, it is characterised in that also including hybridization solution, hybridization washing liquid, closing
The Streptavidin or Avidin of liquid and labelling substance markers.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310183261.7A CN103276066B (en) | 2013-05-17 | 2013-05-17 | Nucleic acid detection kit and method for detecting nucleic acid by amplifying plurality of biotin signals |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310183261.7A CN103276066B (en) | 2013-05-17 | 2013-05-17 | Nucleic acid detection kit and method for detecting nucleic acid by amplifying plurality of biotin signals |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103276066A CN103276066A (en) | 2013-09-04 |
| CN103276066B true CN103276066B (en) | 2017-04-12 |
Family
ID=49058681
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310183261.7A Active CN103276066B (en) | 2013-05-17 | 2013-05-17 | Nucleic acid detection kit and method for detecting nucleic acid by amplifying plurality of biotin signals |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103276066B (en) |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105301237A (en) * | 2015-10-12 | 2016-02-03 | 武汉中帜生物科技股份有限公司 | Method for detecting nucleic acid by colloidal gold chromatography technology and reagent kit |
| CN107058584A (en) * | 2017-06-07 | 2017-08-18 | 浙江殷欣生物技术有限公司 | A kind of nucleic acid hybridizes chemical luminescence detection method |
| CN111304295B (en) * | 2019-12-19 | 2022-08-05 | 武汉中帜生物科技股份有限公司 | Kit for simultaneously detecting nucleic acids of neisseria gonorrhoeae, chlamydia trachomatis and ureaplasma urealyticum and application thereof |
| CN110923362B (en) * | 2019-12-19 | 2023-06-06 | 武汉中帜生物科技股份有限公司 | Colloidal gold chromatography kit for simultaneously detecting herpes simplex virus type I/II and application thereof |
| CN110923344B (en) * | 2019-12-19 | 2023-06-27 | 武汉中帜生物科技股份有限公司 | Staphylococcus aureus and methicillin-resistant staphylococcus aureus drug-resistant gene mecA detection kit and application thereof |
| CN110964854B (en) * | 2019-12-19 | 2021-09-03 | 武汉中帜生物科技股份有限公司 | Kit for simultaneously detecting seven respiratory tract pathogen nucleic acids and application thereof |
| CN111334611B (en) * | 2020-03-24 | 2021-09-24 | 武汉中帜生物科技股份有限公司 | Kit for detecting novel coronavirus (2019-nCoV) based on double amplification technology and application thereof |
| CN112226485A (en) * | 2020-10-20 | 2021-01-15 | 天津贝猫科技有限公司 | Nucleic acid detection method |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101792800A (en) * | 2010-01-19 | 2010-08-04 | 深圳市宏信生物技术有限公司 | Multi-biotin signal amplification method |
-
2013
- 2013-05-17 CN CN201310183261.7A patent/CN103276066B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN103276066A (en) | 2013-09-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103276066B (en) | Nucleic acid detection kit and method for detecting nucleic acid by amplifying plurality of biotin signals | |
| Zheng et al. | Lateral flow test for visual detection of multiple MicroRNAs | |
| Zhou et al. | CRISPR/Cas12a based fluorescence-enhanced lateral flow biosensor for detection of Staphylococcus aureus | |
| Deng et al. | Quantum dots-labeled strip biosensor for rapid and sensitive detection of microRNA based on target-recycled nonenzymatic amplification strategy | |
| Mukama et al. | A high fidelity CRISPR/Cas12a based lateral flow biosensor for the detection of HPV16 and HPV18 | |
| Zhang et al. | Sensitive and rapid on-site detection of SARS-CoV-2 using a gold nanoparticle-based high-throughput platform coupled with CRISPR/Cas12-assisted RT-LAMP | |
| CN1898395B (en) | Method and kit for primer based amplification of nucleic acids | |
| Liu et al. | Visual and sensitive detection of viable pathogenic bacteria by sensing of RNA markers in gold nanoparticles based paper platform | |
| CN105821138B (en) | A kind of method that double loop-stem structure DNA profiling detection nucleic acid are built based on coupled reaction | |
| Zhang et al. | SARS-CoV-2 detection using quantum dot fluorescence immunochromatography combined with isothermal amplification and CRISPR/Cas13a | |
| CN106399517B (en) | Nucleic acid detection technology combining multi-cross constant-temperature amplification with gold nano biosensing | |
| JP2014516591A (en) | Multivariate diagnostic assay and method for using the same | |
| CN106544434B (en) | Method for detecting Listeria monocytogenes by combining multi-cross amplification with gold nano biosensing | |
| Cao et al. | Ultrasensitive detection of mucin 1 biomarker by immuno-loop-mediated isothermal amplification | |
| Khoothiam et al. | Ultrasensitive detection of lung cancer-associated miRNAs by multiple primer-mediated rolling circle amplification coupled with a graphene oxide fluorescence-based (MPRCA-GO) sensor | |
| CN106957908A (en) | MiRNA and/or target molecules with aptamer detection method and detection probe | |
| CN106755358B (en) | Method for detecting vibrio parahaemolyticus by combining multi-cross amplification with gold nano biosensing | |
| Khandan-Nasab et al. | Biosensors, microfluidics systems and lateral flow assays for circulating microRNA detection: A review | |
| CN101586149B (en) | Oligonucleotide chip and application thereof | |
| Li et al. | DNA-silver nanoclusters/polypyrrole nanoparticles: a label-free and enzyme-free platform for multiplexed transcription factors detection | |
| CN103397090A (en) | MicroRNA (micro ribonucleic acid) detection kit and method for detecting microRNA by multiple biotin molecules | |
| CN109439727A (en) | A kind of method and kit detecting microorganism | |
| CN110317861A (en) | A kind of kit detecting pathogen | |
| CN101948931A (en) | Single-tube multiplex fluorescence PCR (Polymerase Chain Reaction) detection method and kit for 1,2,3-type parainfluenza viruses | |
| CN104278079A (en) | Test strip and method for detecting nucleic acid through nucleic acid chromatographic technique |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |